Add Kallisto index

CHANGELOG.md

@@ -145,7 +145,11 @@
 * `sortmerna`: Local sequence alignment tool for mapping, clustering, and filtering rRNA from metatranscriptomic 
                data. (PR #146)
 
-*  `fq_subsample`: Sample a subset of records from single or paired FASTQ files (PR #147).
+* `fq_subsample`: Sample a subset of records from single or paired FASTQ files (PR #147).
+
+* `kallisto`:
+    - `kallisto_index`: Create a kallisto index (PR #149).
+
 
 ## MINOR CHANGES
 

src/kallisto/kallisto_index/config.vsh.yaml

@@ -0,0 +1,89 @@
+name: kallisto_index
+namespace: kallisto
+description: |
+  Build a Kallisto index for the transcriptome to use Kallisto in the mapping-based mode.
+keywords: [kallisto, index]
+links:
+  homepage: https://pachterlab.github.io/kallisto/about
+  documentation: https://pachterlab.github.io/kallisto/manual
+  repository: https://github.com/pachterlab/kallisto
+  issue_tracker: https://github.com/pachterlab/kallisto/issues
+references: 
+  doi: https://doi.org/10.1038/nbt.3519
+license: BSD 2-Clause License
+
+argument_groups:
+- name: "Input"
+  arguments: 
+  - name: "--input"
+    type: file
+    description: |
+      Path to a FASTA-file containing the transcriptome sequences, either in plain text or 
+      compressed (.gz) format.
+    required: true
+  - name: "--d_list"
+    type: file
+    description: |
+      Path to a FASTA-file containing sequences to mask from quantification.
+
+- name: "Output"
+  arguments:
+  - name: "--kallisto_index"
+    type: file
+    direction: output
+    must_exist: false
+    example: Kallisto_index
+
+- name: "Options"
+  arguments:
+  - name: "--kmer_size"
+    type: integer
+    description: |
+      Kmer length passed to indexing step of pseudoaligners (default: '31').
+    example: 31
+  - name: "--make_unique"
+    type: boolean_true
+    description: |
+      Replace repeated target names with unique names.
+  - name: "--aa"
+    type: boolean_true
+    description: |
+      Generate index from a FASTA-file containing amino acid sequences.
+  - name: "--distiguish"
+    type: boolean_true
+    description: |
+       Generate index where sequences are distinguished by the sequence names.
+  - name: "--min_size"
+    alternatives: ["-m"]
+    type: integer
+    description: |
+      Length of minimizers (default: automatically chosen).
+  - name: "--ec_max_size"
+    alternatives: ["-e"]
+    type: integer
+    description: |
+      Maximum number of targets in an equivalence class (default: no maximum).
+
+resources:
+  - type: bash_script
+    path: script.sh
+
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - path: test_data
+
+engines:
+  - type: docker
+    image: ubuntu:22.04
+    setup:
+      - type: docker
+        run: |
+          apt-get update && \
+          apt-get install -y --no-install-recommends wget && \
+          wget --no-check-certificate https://github.com/pachterlab/kallisto/releases/download/v0.50.1/kallisto_linux-v0.50.1.tar.gz && \
+          tar -xzf kallisto_linux-v0.50.1.tar.gz && \
+          mv kallisto/kallisto /usr/local/bin/
+runners:
+  - type: executable
+  - type: nextflow  

src/kallisto/kallisto_index/help.txt

@@ -0,0 +1,21 @@
+```
+kallisto index
+```
+kallisto 0.50.1
+Builds a kallisto index
+
+Usage: kallisto index [arguments] FASTA-files
+
+Required argument:
+-i, --index=STRING          Filename for the kallisto index to be constructed 
+
+Optional argument:
+-k, --kmer-size=INT         k-mer (odd) length (default: 31, max value: 31)
+-t, --threads=INT           Number of threads to use (default: 1)
+-d, --d-list=STRING         Path to a FASTA-file containing sequences to mask from quantification
+    --make-unique           Replace repeated target names with unique names
+    --aa                    Generate index from a FASTA-file containing amino acid sequences
+    --distinguish           Generate index where sequences are distinguished by the sequence name
+-T, --tmp=STRING            Temporary directory (default: tmp)
+-m, --min-size=INT          Length of minimizers (default: automatically chosen)
+-e, --ec-max-size=INT       Maximum number of targets in an equivalence class (default: no maximum)

src/kallisto/kallisto_index/script.sh

@@ -0,0 +1,25 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+set -eo pipefail
+
+if [ -n "$par_kmer_size" ]; then
+    if [[ "$par_kmer_size" -lt 1 || "$par_kmer_size" -gt 31 || $(( par_kmer_size % 2 )) -eq 0 ]]; then
+        echo "Error: Kmer size must be an odd number between 1 and 31."
+        exit 1
+    fi
+fi
+
+kallisto index \
+    -i "${par_kallisto_index}" \
+    ${par_kmer_size:+--kmer-size $par_kmer_size} \
+    ${par_make_unique:+--make-unique} \
+    ${par_aa:+--aa} \
+    ${par_distinguish:+--distinguish} \
+    ${par_min_size:+--min-size $par_min_size} \
+    ${par_ec_max_size:+--ec-max-size $par_ec_max_size} \
+    ${par_d_list:+--d-list "${par_d_list}"} \
+    "${par_input}"
+

src/kallisto/kallisto_index/test.sh

@@ -0,0 +1,35 @@
+#!/bin/bash
+
+echo ">>>Test1: Testing $meta_functionality_name with non-default k-mer size"
+
+"$meta_executable" \
+  --input "$meta_resources_dir/test_data/transcriptome.fasta" \
+  --kallisto_index Kallisto \
+  --kmer_size 21
+
+
+echo ">>> Checking whether output exists and is correct"
+[ ! -f "Kallisto" ] && echo "Kallisto index does not exist!" && exit 1
+[ ! -s "Kallisto" ] && echo "Kallisto index is empty!" && exit 1
+
+kallisto inspect Kallisto 2> test.txt
+grep "number of k-mers: 2,978" test.txt || { echo "The content of the index seems to be incorrect." && exit 1; }
+
+################################################################################
+
+echo ">>>Test2: Testing $meta_functionality_name with d_list argument"
+
+"$meta_executable" \
+  --input "$meta_resources_dir/test_data/transcriptome.fasta" \
+  --kallisto_index Kallisto \
+  --d_list "$meta_resources_dir/test_data/d_list.fasta"
+
+echo ">>> Checking whether output exists and is correct"
+[ ! -f "Kallisto" ] && echo "Kallisto index does not exist!" && exit 1
+[ ! -s "Kallisto" ] && echo "Kallisto index is empty!" && exit 1
+
+kallisto inspect Kallisto 2> test.txt
+grep "number of k-mers: 3,056" test.txt || { echo "The content of the index seems to be incorrect." && exit 1; }
+
+echo "All tests succeeded!"
+exit 0

src/kallisto/kallisto_index/test_data/d_list.fasta

@@ -0,0 +1,5 @@
+>YAL067W-A CDS=1-228
+ATGCCAATTATAGGGGTGCCGAGGTGCCTTATAAAACCCTTTTCTGTGCCTGTGACATTTCCTTTTTCGG
+TCAAAAAGAATATCCGAATTTTAGATTTGGACCCTCGTACAGAAGCTTATTGTCTAAGCCTGAATTCAGT
+CTGCTTTAAACGGCTTCCGCGGAGGAAATATTTCCATCTCTTGAATTCGTACAACATTAAACGTGTGTTG
+GGAGTCGTATACTGTTAG

src/kallisto/kallisto_index/test_data/transcriptome.fasta

@@ -0,0 +1,23 @@
+>YAL069W CDS=1-315
+ATGATCGTAAATAACACACACGTGCTTACCCTACCACTTTATACCACCACCACATGCCATACTCACCCTC
+ACTTGTATACTGATTTTACGTACGCACACGGATGCTACAGTATATACCATCTCAAACTTACCCTACTCTC
+AGATTCCACTTCACTCCATGGCCCATCTCTCACTGAATCAGTACCAAATGCACTCACATCATTATGCACG
+GCACTTGCCTCAGCGGTCTATACCCTGTGCCATTTACCCATAACGCCCATCATTATCCACATTTTGATAT
+CTATATCTCATTCGGCGGTCCCAAATATTGTATAA
+>YAL068W-A CDS=1-255
+ATGCACGGCACTTGCCTCAGCGGTCTATACCCTGTGCCATTTACCCATAACGCCCATCATTATCCACATT
+TTGATATCTATATCTCATTCGGCGGTCCCAAATATTGTATAACTGCCCTTAATACATACGTTATACCACT
+TTTGCACCATATACTTACCACTCCATTTATATACACTTATGTCAATATTACAGAAAAATCCCCACAAAAA
+TCACCTAAACATAAAAATATTCTACTTTTCAACAATAATACATAA
+>YAL068C CDS=1-363
+ATGGTCAAATTAACTTCAATCGCCGCTGGTGTCGCTGCCATCGCTGCTACTGCTTCTGCAACCACCACTC
+TAGCTCAATCTGACGAAAGAGTCAACTTGGTGGAATTGGGTGTCTACGTCTCTGATATCAGAGCTCACTT
+AGCCCAATACTACATGTTCCAAGCCGCCCACCCAACTGAAACCTACCCAGTCGAAGTTGCTGAAGCCGTT
+TTCAACTACGGTGACTTCACCACCATGTTGACCGGTATTGCTCCAGACCAAGTGACCAGAATGATCACCG
+GTGTTCCATGGTACTCCAGCAGATTAAAGCCAGCCATCTCCAGTGCTCTATCCAAGGACGGTATCTACAC
+TATCGCAAACTAG
+>YAL067W-A CDS=1-228
+ATGCCAATTATAGGGGTGCCGAGGTGCCTTATAAAACCCTTTTCTGTGCCTGTGACATTTCCTTTTTCGG
+TCAAAAAGAATATCCGAATTTTAGATTTGGACCCTCGTACAGAAGCTTATTGTCTAAGCCTGAATTCAGT
+CTGCTTTAAACGGCTTCCGCGGAGGAAATATTTCCATCTCTTGAATTCGTACAACATTAAACGTGTGTTG
+GGAGTCGTATACTGTTAG