MRG: misc updates (#1)

* add a few fields

* add cargo fmt

* upd

* fix warnings

* add dependabot config

* add an example doc

* update README

* upd

* upd 2

* more README

.github/dependabot.yml

@@ -0,0 +1,20 @@
+version: 2
+updates:
+- package-ecosystem: pip
+  directory: "/"
+  schedule:
+    interval: weekly
+  open-pull-requests-limit: 10
+- package-ecosystem: cargo
+  directory: "/"
+  schedule:
+    interval: weekly
+  allow:
+    - dependency-type: "direct"
+  open-pull-requests-limit: 10
+  ignore:
+  - dependency-name: "zip"
+- package-ecosystem: "github-actions"
+  directory: "/"
+  schedule:
+    interval: weekly

.github/workflows/lint.yml

@@ -0,0 +1,61 @@
+# This file is autogenerated by maturin v1.4.0
+# To update, run
+#
+#    maturin generate-ci github
+#
+
+name: "lint"
+on:
+  pull_request:
+  push:
+    branches: [latest]
+jobs:
+  tests_on_linux:
+    runs-on: ubuntu-latest
+    steps:
+    - uses: actions/checkout@v4
+      with:
+        fetch-depth: 0
+
+    - name: cache conda
+      uses: actions/cache@v4
+      env:
+        CACHE_NUMBER: 1
+      with:
+        path: ~/conda_pkgs_dir
+        key:
+          ${{ runner.os }}-conda-${{ env.CACHE_NUMBER }}-${{ hashFiles('environment.yml') }}
+
+    - name: cache rust
+      uses: Swatinem/rust-cache@v2
+
+    - name: setup conda
+      uses: conda-incubator/setup-miniconda@v3
+      with:
+        auto-update-conda: true
+        python-version: 3.12
+        channels: conda-forge,bioconda
+        miniforge-variant: Mambaforge
+        miniforge-version: latest
+        use-mamba: true
+        mamba-version: "*"
+        activate-environment: sourmash_dev
+        auto-activate-base: false
+#        use-only-tar-bz2: true
+
+    - run: conda info
+    - run: conda list
+    - run: conda config --show
+
+    - run: mamba search rust
+
+    - name: install dependencies
+      shell: bash -l {0}
+      run: mamba install rust==1.75.0
+
+    - name: install dependencies 2
+      shell: bash -l {0}
+      run: mamba install compilers maturin pytest pandas
+
+    - name: Run cargo fmt
+      run: cargo fmt --all -- --check --verbose

README.md

@@ -1,2 +1,59 @@
 # oxli
-k-mers and the like
+
+Author: C. Titus Brown (@ctb), [email protected]
+
+oxli is a simple Rust library + Python interface for counting k-mers
+in genomic sequencing data.
+
+## Installation
+
+You can try building it yourself:
+```
+mamba env create -f environment.yml -n oxli
+make wheel
+```
+and then install the resulting wheel.
+
+We are working on packaging via conda-forge.
+
+## Documentation
+
+Please see [the API documentation](doc/api.md).
+
+## Is there anything I should know about oxli?
+
+Two things -
+
+First, oxli is channeling
+[khmer](https://khmer.readthedocs.io/en/latest/), a package written by
+@ctb and many others.  You shouldn't be too surprised to see useful
+functionality from khmer making an appearance in oxli.
+
+Second, it's written on top of the
+[sourmash](https://sourmash.readthedocs.io/)
+[rust library](https://sourmash.readthedocs.io/), and the underlying
+code for dealing with sequence data is pretty well tested.
+
+## What's the history here?
+
+The history is a bit convoluted:
+
+* the khmer package was useful for inspecting large collections of
+  k-mers, but was hard to maintain and evolve.
+
+* in ~2016 @ctb's lab more or less switched over to developing
+  sourmash, which was initially built on a similar tech stack to khmer
+  (Python & C++).
+
+* at some point, @luizirber rewrote the sourmash C++ code into Rust.
+
+* this forced @ctb to learn Rust to maintain sourmash.
+
+* @ctb then decided he liked Rust an awful lot, and missed some of the
+  khmer functionality.
+
+* voila, oxli was born.
+
+---
+
+(Sep 2024)

doc/api.md

@@ -0,0 +1,33 @@
+# A simple example of the API
+
+Import necessary modules:
+
+```python
+>>> import screed
+>>> import oxli
+
+```
+
+Create a KmerCountTable with a k-mer size of 31:
+
+```python
+>>> counts = oxli.KmerCountTable(31)
+
+```
+
+Open a FASTA file and consume k-mers from all the sequences within:
+
+```python
+>>> for record in screed.open('example.fa'):
+...    counts.consume(record.sequence)
+349900
+
+```
+
+Get the count of `CGGAGGAAGCAAGAACAAAATATTTTTTCAT` in the data::
+
+```python
+>>> counts.get('CGGAGGAAGCAAGAACAAAATATTTTTTCAT')
+1
+
+```