More tests and debugging

viash-hub · Aug 29, 2024 · 8dc31c2 · 8dc31c2
1 parent 981f6f2
commit 8dc31c2
Show file tree

Hide file tree

Showing 3 changed files with 86 additions and 29 deletions.
diff --git a/src/bcftools/bcftools_norm/config.vsh.yaml b/src/bcftools/bcftools_norm/config.vsh.yaml
@@ -51,26 +51,21 @@ argument_groups:
         choices: [".", "*"]
         description: | 
           Use the star allele (*) for overlapping alleles or set to missing (.).
-        default: "*"
+        #default: "*"
 
       - name: --check_ref
         alternatives: -c
         type: string
         choices: ['e', 'w', 'x', 's']
         description: | 
           Check REF alleles and exit (e), warn (w), exclude (x), or set (s) bad sites.
-        default: "e"
+        #default: "e"
 
       - name: --remove_duplicates
-        alternatives: -D
-        type: boolean_true
-        description: Remove duplicate lines of the same type.
-
-      - name: --rm_dup
         alternatives: -d
         type: string
-        choices: ['snps', 'indels', 'both', 'all', 'exact']
-        description: Remove duplicate snps, indels, both, all, or exact matches.
+        choices: ['snps', 'indels', 'both', 'all', 'exact', 'none']
+        description: Remove duplicate snps, indels, both, all, exact matches, or none (old -D option).
 
       - name: --fasta_ref
         alternatives: -f
@@ -134,14 +129,14 @@ argument_groups:
         choices: ['pos', 'record', 'variant', '1', '2', '3']
         description: | 
           Include if POS in the region (0), record overlaps (1), variant overlaps (2).
-        default: "1"
+        #default: "1"
 
       - name: --site_win
         alternatives: -w
         type: integer
         description: | 
           Buffer for sorting lines that changed position during realignment.
-        default: 1000
+        #default: 1000
 
       - name: --strict_filter
         alternatives: -s
@@ -163,13 +158,13 @@ argument_groups:
         choices: ['pos', 'record', 'variant', '1', '2', '3']
         description: | 
           Include if POS in the region (0), record overlaps (1), variant overlaps (2).
-        default: "0"
+        #default: "0"
 
       - name: --threads
         type: integer
         description: | 
           Use multithreading with the specified number of worker threads.
-        default: 0
+        #default: 0
 
 
 resources:

diff --git a/src/bcftools/bcftools_norm/script.sh b/src/bcftools/bcftools_norm/script.sh
@@ -25,23 +25,22 @@ done
 bcftools norm \
     ${par_atomize:+--atomize} \
     ${par_atom_overlaps:+--atom-overlaps "$par_atom_overlaps"} \
-    ${par_check_ref:+--check-ref "$par_check_ref"} \
-    ${par_remove_duplicates:+--remove-duplicates} \
-    ${par_rm_dup:+--rm-dup "$par_rm_dup"} \
-    ${par_fasta_ref:+--fasta-ref "$par_fasta_ref"} \
+    ${par_check_ref:+-c "$par_check_ref"} \
+    ${par_remove_duplicates:+-d "$par_remove_duplicates"} \
+    ${par_fasta_ref:+-f "$par_fasta_ref"} \
     ${par_force:+--force} \
     ${par_keep_sum:+--keep-sum "$par_keep_sum"} \
-    ${par_multiallelics:+--multiallelics "$par_multiallelics"} \
+    ${par_multiallelics:+-m "$par_multiallelics"} \
     ${par_no_version:+--no-version} \
-    ${par_do_not_normalize:+--do-not-normalize} \
+    ${par_do_not_normalize:+-N} \
     ${par_old_rec_tag:+--old-rec-tag "$par_old_rec_tag"} \
-    ${par_regions:+--regions "$par_regions"} \
-    ${par_regions_file:+--regions-file "$par_regions_file"} \
+    ${par_regions:+-r "$par_regions"} \
+    ${par_regions_file:+-R "$par_regions_file"} \
     ${par_regions_overlap:+--regions-overlap "$par_regions_overlap"} \
-    ${par_site_win:+--site-win "$par_site_win"} \
-    ${par_strict_filter:+--strict-filter} \
-    ${par_targets:+--targets "$par_targets"} \
-    ${par_targets_file:+--targets-file "$par_targets_file"} \
+    ${par_site_win:+-w "$par_site_win"} \
+    ${par_strict_filter:+-s} \
+    ${par_targets:+-t "$par_targets"} \
+    ${par_targets_file:+-T "$par_targets_file"} \
     ${par_targets_overlap:+--targets-overlap "$par_targets_overlap"} \
     ${par_threads:+--threads "$par_threads"} \
     ${par_output_type:+-O "$par_output_type"} \

diff --git a/src/bcftools/bcftools_norm/test.sh b/src/bcftools/bcftools_norm/test.sh
@@ -38,31 +38,94 @@ cat <<EOF > "$TMPDIR/example.vcf"
 ##fileformat=VCFv4.1
 ##contig=<ID=1,length=249250621,assembly=b37>
 #CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	SAMPLE1
-1	752567	llama	A	C	.	.	.	.	.
-1	752722	.	G	A	.	.	.	.	.
+1	752567	llama	G	C,A	.	.	.	.	1/2
+1	752722	.	G	A,AAA	.	.	.	.	./.
 EOF
 
 bgzip -c $TMPDIR/example.vcf > $TMPDIR/example.vcf.gz
 tabix -p vcf $TMPDIR/example.vcf.gz
 
+cat <<EOF > "$TMPDIR/reference.fa"
+>1
+ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
+>2
+CGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT
+EOF
+
 # Test 1: Remove ID annotations
 mkdir "$TMPDIR/test1" && pushd "$TMPDIR/test1" > /dev/null
 
 echo "> Run bcftools_norm"
 "$meta_executable" \
   --input "../example.vcf" \
   --output "normalized.vcf" \
+  --atomize \
+  --atom_overlaps "." \
 
 # checks
 assert_file_exists "normalized.vcf"
 assert_file_not_empty "normalized.vcf"
-assert_file_contains "normalized.vcf" "##fileformat=VCFv4.2"
+assert_file_contains "normalized.vcf" "bcftools_normCommand=norm --atomize --atom-overlaps . -o normalized.vcf ../example.vcf"
 echo "- test1 succeeded -"
 
 popd > /dev/null
 
+# Test 2: Check reference
+mkdir "$TMPDIR/test2" && pushd "$TMPDIR/test2" > /dev/null
+
+echo "> Run bcftools_norm with remove duplicates"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "normalized.vcf" \
+  --atomize \
+  --remove_duplicates 'all' \
+
+# checks
+assert_file_exists "normalized.vcf"
+assert_file_not_empty "normalized.vcf"
+assert_file_contains "normalized.vcf" "norm --atomize -d all -o normalized.vcf ../example.vcf"
+echo "- test2 succeeded -"
+
+popd > /dev/null
+
+# Test 3: Check reference and fasta reference
+mkdir "$TMPDIR/test3" && pushd "$TMPDIR/test3" > /dev/null
+
+echo "> Run bcftools_norm with check reference and fasta reference"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "normalized.vcf" \
+  --atomize \
+  --fasta_ref "../reference.fa" \
+  --check_ref "e" \
+
+# checks
+assert_file_exists "normalized.vcf"
+assert_file_not_empty "normalized.vcf"
+assert_file_contains "normalized.vcf" "norm --atomize -c e -f ../reference.fa -o normalized.vcf ../example.vcf"
+echo "- test3 succeeded -"
+
+popd > /dev/null
+
+# Test 4: Multiallelics
+mkdir "$TMPDIR/test4" && pushd "$TMPDIR/test4" > /dev/null
+
+echo "> Run bcftools_norm with multiallelics"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "normalized.vcf" \
+  --multiallelics "-any" \
+  --old_rec_tag "wazzaaa" \
+
+# checks
+assert_file_exists "normalized.vcf"
+assert_file_not_empty "normalized.vcf"
+assert_file_contains "normalized.vcf" "norm -m -any --old-rec-tag wazzaaa -o normalized.vcf ../example.vcf"
+echo "- test4 succeeded -"
 
 echo "---- All tests succeeded! ----"
 exit 0
 
-
+# echo
+# cat "normalized.vcf"
+# echo