Co-authored-by: Jakub Majercik <[email protected]>

CHANGELOG.md

@@ -20,21 +20,29 @@
                 based on a provided sequence IDs or region coordinates file (PR #85).
 
 * `agat`:
-  - `agat_convert_sp_gff2gtf`: convert any GTF/GFF file into a proper GTF file (PR #76).
-  - `/agat_convert_bed2gff`: convert bed file to gff format (PR #97).
+  - `agat/agat_convert_sp_gff2gtf`: convert any GTF/GFF file into a proper GTF file (PR #76).
+  - `agat/agat_convert_bed2gff`: convert bed file to gff format (PR #97).
+  - `agat/agat_convert_embl2gff`: convert an EMBL file into GFF format (PR #99).
+  - `agat/agat_convert_sp_gff2tsv`: convert gtf/gff file into tabulated file (PR #102).
+  - `agat/agat_convert_sp_gxf2gxf`: fixes and/or standardizes any GTF/GFF file into full sorted GTF/GFF file (PR #103).
 
 * `bedtools`:
   - `bedtools/bedtools_intersect`: Allows one to screen for overlaps between two sets of genomic features (PR #94).
   - `bedtools/bedtools_sort`: Sorts a feature file (bed/gff/vcf) by chromosome and other criteria (PR #98).
   - `bedtools/bedtools_bamtobed`: Converts BAM alignments to BED6 or BEDPE format (PR #109).
-
+  - `bedtools/bedtools_bamtofastq`: Convert BAM alignments to FASTQ files (PR #101).
+  - `bedtools/bedtools_bedtobam`: Converts genomic feature records (bed/gff/vcf) to BAM format (PR #111).
 
 ## MINOR CHANGES
 
 * `busco` components: update BUSCO to `5.7.1` (PR #72).
 
 * Update CI to reusable workflow in `viash-io/viash-actions` (PR #86).
 
+* Update several components in order to avoid duplicate code when using `unset` on boolean arguments (PR #133).
+
+* Bump viash to `0.9.0-RC7` (PR #134)
+
 ## DOCUMENTATION
 
 * Extend the contributing guidelines (PR #82):

CONTRIBUTING.md

@@ -320,6 +320,31 @@ Notes:
 
 * If your tool allows for multiple inputs using a separator other than `;` (which is the default Viash multiple separator), you can substitute these values with a command like: `par_disable_filters=$(echo $par_disable_filters | tr ';' ',')`.
 
+* If you have a lot of boolean variables that you would like to unset when the value is `false`, you can avoid duplicate code by using the following syntax:
+
+```bash
+unset_if_false=(
+    par_argument_1
+    par_argument_2
+    par_argument_3
+    par_argument_4
+)
+
+for par in ${unset_if_false[@]}; do
+    test_val="${!par}"
+    [[ "$test_val" == "false" ]] && unset $par
+done
+```
+
+this code is equivalent to
+
+```bash
+[[ "$par_argument_1" == "false" ]] && unset par_argument_1
+[[ "$par_argument_2" == "false" ]] && unset par_argument_2
+[[ "$par_argument_3" == "false" ]] && unset par_argument_3
+[[ "$par_argument_4" == "false" ]] && unset par_argument_4
+```
+
 
 ### Step 12: Create test script
 

_viash.yaml

@@ -7,7 +7,7 @@ links:
   issue_tracker: https://github.com/viash-hub/biobox/issues
   repository: https://github.com/viash-hub/biobox
 
-viash_version: 0.9.0-RC6
+viash_version: 0.9.0-RC7
 
 config_mods: |
   .requirements.commands := ['ps']

src/agat/agat_convert_embl2gff/config.vsh.yaml

@@ -0,0 +1,84 @@
+name: agat_convert_embl2gff
+namespace: agat
+description: |
+  The script takes an EMBL file as input, and will translate it in gff format.
+keywords: [gene annotations, GFF conversion]
+links:
+  homepage: https://github.com/NBISweden/AGAT
+  documentation: https://agat.readthedocs.io/en/latest/tools/agat_convert_embl2gff.html
+  issue_tracker: https://github.com/NBISweden/AGAT/issues
+  repository: https://github.com/NBISweden/AGAT
+references: 
+  doi: 10.5281/zenodo.3552717
+license: GPL-3.0
+authors:
+  - __merge__: /src/_authors/leila_paquay.yaml
+    roles: [ author, maintainer ]
+
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: --embl
+        description: Input EMBL file that will be read.
+        type: file
+        required: true
+        direction: input
+        example: input.embl
+  - name: Outputs
+    arguments:
+      - name: --output
+        alternatives: [-o, --out, --outfile, --gff]
+        description: Output GFF file. If no output file is specified, the output will be written to STDOUT.
+        type: file
+        direction: output
+        required: false
+        example: output.gff
+  - name: Arguments
+    arguments:
+      - name: --emblmygff3
+        description: |
+          Means that the EMBL flat file comes from the EMBLmyGFF3 software. This is an EMBL format dedicated for submission and contains particularity to deal with. This parameter is needed to get a proper sequence id in the GFF3 from an embl made with EMBLmyGFF3.
+        type: boolean_true
+      - name: --primary_tag
+        alternatives: [--pt, -t]
+        description: |
+          List of "primary tag". Useful to discard or keep specific features. Multiple tags must be comma-separated.
+        type: string
+        multiple: true
+        required: false
+        example: [tag1, tag2]
+      - name: --discard
+        alternatives: [-d]
+        description: |
+          Means that primary tags provided by the option "primary_tag" will be discarded.
+        type: boolean_true
+      - name: --keep
+        alternatives: [-k]
+        description: |
+          Means that only primary tags provided by the option "primary_tag" will be kept.
+        type: boolean_true
+      - name: --config
+        alternatives: [-c]
+        description: |
+          Input agat config file. By default AGAT takes as input agat_config.yaml file from the working directory if any, otherwise it takes the original agat_config.yaml shipped with AGAT. To get the agat_config.yaml locally type: "agat config --expose". The --config option gives you the possibility to use your own AGAT config file (located elsewhere or named differently).
+        type: file
+        required: false
+        example: custom_agat_config.yaml
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - type: file
+    path: test_data
+engines:
+  - type: docker
+    image: quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0
+    setup:
+      - type: docker
+        run: |
+          agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.txt
+runners:
+  - type: executable
+  - type: nextflow

src/agat/agat_convert_embl2gff/help.txt

@@ -0,0 +1,78 @@
+ ```sh
+agat_convert_embl2gff.pl --help
+```
+
+ ------------------------------------------------------------------------------
+|   Another GFF Analysis Toolkit (AGAT) - Version: v1.4.0                      |
+|   https://github.com/NBISweden/AGAT                                          |
+|   National Bioinformatics Infrastructure Sweden (NBIS) - www.nbis.se         |
+ ------------------------------------------------------------------------------
+
+
+Name:
+    agat_converter_embl2gff.pl
+
+Description:
+    The script takes an EMBL file as input, and will translate it in gff
+    format.
+
+Usage:
+        agat_converter_embl2gff.pl --embl infile.embl [ -o outfile ]
+
+Options:
+    --embl  Input EMBL file that will be read
+
+    --emblmygff3
+            Bolean - Means that the EMBL flat file comes from the EMBLmyGFF3
+            software. This is an EMBL format dedicated for submission and
+            contains particularity to deal with. This parameter is needed to
+            get a proper sequence id in the GFF3 from an embl made with
+            EMBLmyGFF3.
+
+    --primary_tag, --pt, -t
+            List of "primary tag". Useful to discard or keep specific
+            features. Multiple tags must be coma-separated.
+
+    -d      Bolean - Means that primary tags provided by the option
+            "primary_tag" will be discarded.
+
+    -k      Bolean - Means that only primary tags provided by the option
+            "primary_tag" will be kept.
+
+    -o, --output, --out, --outfile or --gff
+            Output GFF file. If no output file is specified, the output will
+            be written to STDOUT.
+
+    -c or --config
+            String - Input agat config file. By default AGAT takes as input
+            agat_config.yaml file from the working directory if any,
+            otherwise it takes the orignal agat_config.yaml shipped with
+            AGAT. To get the agat_config.yaml locally type: "agat config
+            --expose". The --config option gives you the possibility to use
+            your own AGAT config file (located elsewhere or named
+            differently).
+
+    -h or --help
+            Display this helpful text.
+
+Feedback:
+  Did you find a bug?:
+    Do not hesitate to report bugs to help us keep track of the bugs and
+    their resolution. Please use the GitHub issue tracking system available
+    at this address:
+
+                https://github.com/NBISweden/AGAT/issues
+
+     Ensure that the bug was not already reported by searching under Issues.
+     If you're unable to find an (open) issue addressing the problem, open a new one.
+     Try as much as possible to include in the issue when relevant:
+     - a clear description,
+     - as much relevant information as possible,
+     - the command used,
+     - a data sample,
+     - an explanation of the expected behaviour that is not occurring.
+
+  Do you want to contribute?:
+    You are very welcome, visit this address for the Contributing
+    guidelines:
+    https://github.com/NBISweden/AGAT/blob/master/CONTRIBUTING.md

src/agat/agat_convert_embl2gff/script.sh

@@ -0,0 +1,23 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+
+# unset flags
+[[ "$par_emblmygff3" == "false" ]] && unset par_emblmygff3
+[[ "$par_discard" == "false" ]] && unset par_discard
+[[ "$par_keep" == "false" ]] && unset par_keep
+
+# replace ';' with ','
+par_primary_tag=$(echo $par_primary_tag | tr ';' ',')
+
+# run agat_convert_embl2gff
+agat_convert_embl2gff.pl \
+  --embl "$par_embl" \
+  -o "$par_output" \
+  ${par_emblmygff3:+--emblmygff3} \
+  ${par_primary_tag:+--primary_tag "${par_primary_tag}"} \
+  ${par_discard:+-d} \
+  ${par_keep:+-k} \
+  ${par_config:+--config "${par_config}"}

src/agat/agat_convert_embl2gff/test.sh

@@ -0,0 +1,28 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+test_dir="${meta_resources_dir}/test_data"
+out_dir="${meta_resources_dir}/out_data"
+
+echo "> Run $meta_name with test data and --emblmygff3"
+"$meta_executable" \
+  --embl "$test_dir/agat_convert_embl2gff_1.embl" \
+  --output "$out_dir/output.gff" \
+  --emblmygff3
+
+echo ">> Checking output"
+[ ! -f "$out_dir/output.gff" ] && echo "Output file output.gff does not exist" && exit 1
+
+echo ">> Check if output is empty"
+[ ! -s "$out_dir/output.gff" ] && echo "Output file output.gff is empty" && exit 1
+
+echo ">> Check if output matches expected output"
+diff "$out_dir/output.gff" "$test_dir/agat_convert_embl2gff_1.gff"
+if [ $? -ne 0 ]; then
+  echo "Output file output.gff does not match expected output"
+  exit 1
+fi
+
+echo "> Test successful"

src/agat/agat_convert_embl2gff/test_data/agat_convert_embl2gff_1.embl

@@ -0,0 +1,51 @@
+ID   patatrac; SV 1; circular; genomic DNA; XXX; PRO; 317941 BP.
+XX
+AC   XXX; 
+XX
+AC * _ERS324955|SC|contig000001
+XX
+PR   Project:PRJEBNNNN;
+XX
+DE   XXX
+XX
+RN   [1]
+RP   1-2149
+RA   XXX;
+RT   ;
+RL   Submitted {(DD-MMM-YYYY)} to the INSDC.
+XX
+FH   Key           Location/Qualifiers
+FH
+FT   source        1..588788
+FT                 /organism={"scientific organism name"}
+FT                 /mol_type={"in vivo molecule type of sequence"}
+XX
+SQ   Sequence 588788 BP; 101836 A; 193561 C; 192752 G; 100639 T; 0 other;
+     tgcgtactcg aagagacgcg cccagattat ataagggcgt cgtctcgagg ccgacggcgc        60
+     gccggcgagt acgcgtgatc cacaacccga agcgaccgtc gggagaccga gggtcgtcga       120
+     gggtggatac gttcctgcct tcgtgccggg aaacggccga agggaacgtg gcgacctgcg       180
+//
+ID   fdssf; SV 1; circular; genomic DNA; XXX; PRO; 317941 BP.
+XX
+AC   XXX; 
+XX
+AC * _ERS344554
+XX
+PR   Project:PRJEBNNNN;
+XX
+DE   XXX
+XX
+RN   [1]
+RP   1-2149
+RA   XXX;
+RT   ;
+RL   Submitted {(DD-MMM-YYYY)} to the INSDC.
+XX
+FH   Key           Location/Qualifiers
+FH
+FT   source        1..588788
+FT                 /organism={"scientific organism name"}
+FT                 /mol_type={"in vivo molecule type of sequence"}
+XX
+SQ   Sequence 588788 BP; 101836 A; 193561 C; 192752 G; 100639 T; 0 other;
+     TTTTTTTTTT aagagacgcg cccagattat ataagggcgt cgtctcgagg ccgacggcgc        60

src/agat/agat_convert_embl2gff/test_data/agat_convert_embl2gff_1.gff

@@ -0,0 +1,10 @@
+##gff-version 3
+ERS324955|SC|contig000001	EMBL/GenBank/SwissProt	source	1	588788	.	+	1	mol_type={"in vivo molecule type of sequence"};organism={"scientific organism name"}
+ERS344554	EMBL/GenBank/SwissProt	source	1	588788	.	+	1	mol_type={"in vivo molecule type of sequence"};organism={"scientific organism name"}
+##FASTA
+>ERS324955|SC|contig000001 XXX
+TGCGTACTCGAAGAGACGCGCCCAGATTATATAAGGGCGTCGTCTCGAGGCCGACGGCGCGCCGGCGAGTACGCGTGATC
+CACAACCCGAAGCGACCGTCGGGAGACCGAGGGTCGTCGAGGGTGGATACGTTCCTGCCTTCGTGCCGGGAAACGGCCGA
+AGGGAACGTGGCGACCTGCG
+>ERS344554 XXX
+TTTTTTTTTTAAGAGACGCGCCCAGATTATATAAGGGCGTCGTCTCGAGGCCGACGGCGC

src/agat/agat_convert_embl2gff/test_data/script.sh

@@ -0,0 +1,10 @@
+#!/bin/bash
+
+# clone repo
+if [ ! -d /tmp/agat_source ]; then
+  git clone --depth 1 --single-branch --branch master https://github.com/NBISweden/AGAT /tmp/agat_source
+fi
+
+# copy test data
+cp -r /tmp/agat_source/t/scripts_output/in/agat_convert_embl2gff_1.embl src/agat/agat_convert_embl2gff/test_data/agat_convert_embl2gff_1.embl
+cp -r /tmp/agat_source/t/scripts_output/out/agat_convert_embl2gff_1.gff src/agat/agat_convert_embl2gff/test_data/agat_convert_embl2gff_1.gff