Update README.md

README.md

@@ -1,2 +1,23 @@
 # uflow
-USEARCH based workflow
+
+USEARCH based workflow. See [dadaist2](https://github.com/quadram-institute-bioscience/dadaist2) for an Open Source workflow.
+
+## Instructions
+
+1. Generate a singularity container using the definition from [`deps`](./deps/)
+2. Download Dadaist2 databases and use that directory as `--dbdir`
+3. Run the workflow selecting or creating a profile:
+```bash
+nextflow run uflow/ --input DIR --outdir OUT -profile bact
+```
+
+Parameters:
+* `--outdir` output directory
+* `--dir` path to the input directory
+* `--pattern` expansion to get the read pairs (default = "_R{1,2}.fastq.gz")
+* `--dbdir` path to the database directory (hint: put it in the profile)
+* `--db` actual database (file in the dbdir) to be used
+* `--its` enable ITS processing
+* `--its_region` ITS region (default = "ITS1")
+* `--forward` sequence of the forward primer (default = "CTTGGTCATTTAGAGGAAGTAA")
+* `--reverse`  sequence of the reverse primer (default = "GCTGCGTTCTTCATCGATGC")