more version badges

observablehq · Aug 5, 2023 · 0de63df · 0de63df
1 parent 72831bb
commit 0de63df
Show file tree

Hide file tree

Showing 5 changed files with 7 additions and 7 deletions.
diff --git a/docs/features/shorthand.md b/docs/features/shorthand.md
@@ -73,7 +73,7 @@ const gene = "AAAAGAGTGAAGATGCTGGAGACGAGTGAAGCATTCACTTTAGGGAAAGCGAGGCAAGAGCGTTTC
 
 </script>
 
-# Shorthand
+# Shorthand <VersionBadge version="0.4.2" />
 
 The most concise form of Plot is its **shorthand** syntax where no options are specified — only data. To use this shorthand, the data must have a specific structure: either a one-dimensional array of values [*v₀*, *v₁*, *v₂*, …] or a two-dimensional array of tuples [[*x₀*, *y₀*], [*x₁*, *y₁*], [*x₂*, *y₂*], …].
 

diff --git a/docs/features/transforms.md b/docs/features/transforms.md
@@ -191,7 +191,7 @@ You can specify a custom initializer by specifying a function as the mark **init
 
 If an initializer desires a channel that is not supported by the downstream mark, additional channels can be declared using the mark **channels** option.
 
-## transform(*options*, *transform*) {#transform}
+## transform(*options*, *transform*) <VersionBadge version="0.4.3" /> {#transform}
 
 ```js
 Plot.transform(options, (data, facets) => {
@@ -203,7 +203,7 @@ Plot.transform(options, (data, facets) => {
 ```
 Given an *options* object that may specify some basic transforms (**filter**, **sort**, or **reverse**) or a custom **transform** function, composes those transforms if any with the given *transform* function, returning a new *options* object. If a custom **transform** function is present on the given *options*, any basic transforms are ignored. Any additional input *options* are passed through in the returned *options* object. This method facilitates applying the basic transforms prior to applying the given custom *transform* and is used internally by Plot’s built-in transforms.
 
-## initializer(*options*, *initializer*) {#initializer}
+## initializer(*options*, *initializer*) <VersionBadge version="0.5.0" /> {#initializer}
 
 This helper composes the *initializer* function with any other transforms present in the *options*, and returns a new *options* object. It is used internally by Plot’s built-in initializer transforms.
 
@@ -226,7 +226,7 @@ If *type* is specified, it must be Array or a similar class that implements the
 
 valueof is not guaranteed to return a new array. When a transform method is used, or when the given *value* is an array that is compatible with the requested *type*, the array may be returned as-is without making a copy.
 
-## column(*source*) {#column}
+## column(*source*) <VersionBadge version="0.4.3" /> {#column}
 
 ```js
 const [X, setX] = Plot.column();

diff --git a/docs/marks/hexgrid.md b/docs/marks/hexgrid.md
@@ -6,7 +6,7 @@ import penguins from "../data/penguins.ts";
 
 </script>
 
-# Hexgrid mark
+# Hexgrid mark <VersionBadge version="0.5.0" />
 
 The **hexgrid mark** draws a hexagonal grid spanning the frame. It can be used with the [hexbin transform](../transforms/hexbin.md) to show how points are binned. The **binWidth** option specifies the distance between centers of neighboring hexagons in pixels; it defaults to 20, matching the hexbin transform.
 

diff --git a/docs/transforms/normalize.md b/docs/transforms/normalize.md
@@ -121,7 +121,7 @@ The **basis** option specifies how to normalize the series values; it is one of:
 * a function to be passed an array of values, returning the desired basis
 * a function to be passed an index and channel value array, returning the desired basis
 
-## normalize(*basis*) {#normalize}
+## normalize(*basis*) <VersionBadge version="0.2.3" /> {#normalize}
 
 ```js
 Plot.map({y: Plot.normalize("first")}, {x: "Date", y: "Close", stroke: "Symbol"})

diff --git a/docs/transforms/window.md b/docs/transforms/window.md
@@ -181,7 +181,7 @@ The following named reducers are supported:
 
 A reducer may also be specified as a function to be passed an index of size **k** and the corresponding input channel array; or if the function only takes one argument, an array of **k** values.
 
-## window(*k*) {#window}
+## window(*k*) <VersionBadge version="0.2.3" /> {#window}
 
 ```js
 Plot.map({y: Plot.window(24)}, {x: "Date", y: "Close", stroke: "Symbol"})