TEsmall

Version 2.0.8

A pipeline for profiling TE-derived small RNAs.

Created by Wen-Wei Liao, Kat O'Neill & Molly Gale Hammell, March 2017

Contact: [email protected]

Install Miniconda 3 (Linux)

$ wget https://repo.continuum.io/miniconda/Miniconda3-latest-Linux-x86_64.sh
$ bash Miniconda3-latest-Linux-x86_64.sh

Setup channels

$ conda config --add channels conda-forge
$ conda config --add channels bioconda

Install TEsmall

$ git clone https://github.com/mhammell-laboratory/TEsmall.git
$ cd TEsmall
$ conda env create -f environment.yaml -n TEsmall
$ conda activate TEsmall
$ python setup.py install

How to run TEsmall

1. Before executing TEsmall, make sure you have activated the environment

   $ conda activate TEsmall
   

2. For example, you would like to apply TEsmall on 2 FASTQ files: Parental_1.fastq.gz and DroKO_1.fastq.gz

   $ TEsmall -f Parental_1.fastq.gz DroKO_1.fastq.gz -l Parental DroKO
   

3. When it's done, deactivate the environment

   $ conda deactivate
   

4. If you would like to specify the directory to which the genomes TEsmall uses for annotation are downloaded and read from, you can specify it at runtime using the --dbfolder parameter

   $ TEsmall -f Parental_1.fastq.gz DroKO_1.fastq.gz -g hg19 -l
   Parental DroKO --dbfolder /path/to/another/folder/
   

   The files used by TEsmall will be downloaded to/access from the genomes folder inside /path/to/another/folder/.

   The default location is $HOME/TEsmall_db/

For more information

$ TEsmall -h
usage: TEsmall [-h] [-a STR] [-m INT] [-M INT] [-g STR] [--maxaln INT]
               [--mismatch INT] [-o STR [STR ...]] [-p INT] [-f STR [STR ...]]
               [-l STR [STR ...]] [--dbfolder STR] [--verbose INT] [-v]

optional arguments:
  -h, --help            show this help message and exit
  -a STR, --adapter STR
                        Sequence of an adapter that was ligated to the 3' end.
                        The adapter itself and anything that follows is
                        trimmed. (default: TGGAATTCTCGGGTGCCAAGG)
  -m INT, --minlen INT  Discard trimmed reads that are shorter than INT. Reads
                        that are too short even before adapter removal are
                        also discarded. (default: 16)
  -M INT, --maxlen INT  Discard trimmed reads that are longer than INT. Reads
                        that are too long even before adapter removal are also
                        discarded. (default: 36)
  -g STR, --genome STR  Version of reference genome (default: hg38)
  --maxaln INT          Suppress all alignments for a particular read if more
                        than INT reportable alignments exist for it. (default:
                        100)
  --mismatch INT        Report alignments with at most INT mismatches.
                        (default: 0)
  -o STR [STR ...], --order STR [STR ...]
                        Annotation priority. (default: structural_RNA miRNA
                        hairpin exon TE intron piRNA_cluster)
  -p INT, --parallel INT
                        Parallel execute by INT CPUs. (default: 1)
  -f STR [STR ...], --fastq STR [STR ...]
                        Input in FASTQ format. Compressed input is supported
                        and auto-detected from the filename extension (.gz).
  -l STR [STR ...], --label STR [STR ...]
                        Unique label for each sample.
  --dbfolder STR        Custom location of TEsmall database folder (containing the "genomes" folder).
						DEFAULT: $HOME/TEsmall_db/

  --verbose INT         Set verbose level.
                        0: only show critical message
						1: show additional warning message
						2: show process information
						3: show debug messages.
						DEFAULT: 2
  -v, --version         show program's version number and exit

Output files

Here are some brief explanations of the output files generated by TEsmall

Final output

count_summary.txt    -    This is the file containing the combined count table
                          of all libraries processed by TEsmall. This is typically
	                  the file you want to use for differential analysis.
report.html          -    HTML report of QC and annotation statistics

For the following files, they are generated for each library, using the -l, --label parameter the user provided.

Preprocessing output

[label].trimmed1.fastq    -   FASTQ file after 3' adapter trimming
[label].cutadapt1.log     -   Cutadapt log from 3' adapter trimming
[label].trimmed2.fastq    -   FASTQ file after 3' & 5' adapter trimming
[label].cutadapt2.log     -   Cutadapt log from 5' adapter trimming
[label].bam               -   BAM output for reads that aligned to rRNA (in older versions)
[label].rRNA.bam          -   BAM output for reads that aligned to rRNA
[label].rRNA.log          -   Bowtie log for rRNA mapping
[label].rm_rRNA.fastq     -   FASTQ file depleted for rRNA reads
                              Used for subsequent analysis

Genome alignment output

[label].log               -   Bowtie log for genome alignment (in older versions)
[label].genome.log        -   Bowtie log for genome alignment
[label].unaligned.fastq   -   FASTQ containing reads that failed to align to genome
[label].exceeded.fastq    -   FASTQ containing reads that aligned too many times to genome
[label].rinfo             -   Length & alignment counts for each aligned read (in older versions)
[label].aligned.rinfo     -   Length & alignment counts for each aligned read
[label].multi.bam         -   BAM output for reads aligned to genome (in older versions)
[label].genome.bam        -   BAM output for reads aligned to genome

Identifying tRNA fragment (tRF)

Schorn et al. 2017

[label].cca.fa                    -   FASTA file containing aligned reads terminating with CCA, with CCA tail cleaved
[label].tRNA.bam                  -   BAM output for CCA-trimmed reads that aligned to tRNA
[label].3trf.log                  -   Bowtie log for CCA-trimmed reads aligning to tRNA (in older versions)
[label].tRNA.log                  -   Bowtie log for CCA-trimmed reads aligning to tRNA
[label].unaligned.cca.fa          -   FASTA file containing CCA-trimmed reads that failed to align
[label].trna_for_intersect.bam    -   BAM file of CCA-trimmed reads that aligned to tRNA, converted to genomic coordinates
[label].3trf_free.bam             -   BAM file of reads aligned to genome that are not tRF
[label].3trf.bam                  -   BAM file of reads aligned to genome that are tRF

Annotation output

[label].anno                      -   Annotation of aligned reads that are not tRF
[label].3trf.struc.mapper.anno    -   tRF that annotated to structural RNA (e.g. tRNA)
[label].3trf.TE.mapper.anno       -   tRF that annotated to TE
[label].comp                      -   Length distribution of reads based on annotation (in older versions)
[label].anno.rlen.info            -   Length distribution of reads based on annotation
[label].bedgraph                  -   BEDgraph of annotated reads weighted by EM

Copying & distribution

TEsmall is part of TEToolkit suite.

TEsmall is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.

This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details.

You should have received a copy of the GNU General Public License along with TEsmall. If not, see this website.

Citation

If using the software in a publication, please cite the following:

O'Neill K, Liao WW, Patel A, Hammell MG. (2018) TEsmall Identifies Small RNAs Associated With Targeted Inhibitor Resistance in Melanoma. Front Genet. Oct 5;9:461.