-
Notifications
You must be signed in to change notification settings - Fork 27
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge branch 'main' into add-dev-container
- Loading branch information
Showing
8 changed files
with
435 additions
and
361 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
|
@@ -23,9 +23,9 @@ interactions: | |
Content-Type: | ||
- text/plain; charset=utf-8 | ||
Date: | ||
- Wed, 26 Jun 2024 11:58:42 GMT | ||
- Tue, 05 Nov 2024 04:24:17 GMT | ||
Server: | ||
- Werkzeug/2.2.2 Python/3.10.4 | ||
- Werkzeug/2.2.3 Python/3.10.12 | ||
status: | ||
code: 200 | ||
message: OK | ||
|
@@ -53,9 +53,9 @@ interactions: | |
Content-Type: | ||
- text/plain; charset=utf-8 | ||
Date: | ||
- Wed, 26 Jun 2024 11:58:42 GMT | ||
- Tue, 05 Nov 2024 04:24:17 GMT | ||
Server: | ||
- Werkzeug/2.2.2 Python/3.10.4 | ||
- Werkzeug/2.2.3 Python/3.10.12 | ||
status: | ||
code: 200 | ||
message: OK | ||
|
@@ -83,9 +83,9 @@ interactions: | |
Content-Type: | ||
- text/plain; charset=utf-8 | ||
Date: | ||
- Wed, 26 Jun 2024 11:58:42 GMT | ||
- Tue, 05 Nov 2024 04:24:17 GMT | ||
Server: | ||
- Werkzeug/2.2.2 Python/3.10.4 | ||
- Werkzeug/2.2.3 Python/3.10.12 | ||
status: | ||
code: 200 | ||
message: OK | ||
|
@@ -113,9 +113,9 @@ interactions: | |
Content-Type: | ||
- text/plain; charset=utf-8 | ||
Date: | ||
- Wed, 26 Jun 2024 11:58:42 GMT | ||
- Tue, 05 Nov 2024 04:24:17 GMT | ||
Server: | ||
- Werkzeug/2.2.2 Python/3.10.4 | ||
- Werkzeug/2.2.3 Python/3.10.12 | ||
status: | ||
code: 200 | ||
message: OK | ||
|
@@ -143,9 +143,9 @@ interactions: | |
Content-Type: | ||
- text/plain; charset=utf-8 | ||
Date: | ||
- Wed, 26 Jun 2024 11:58:42 GMT | ||
- Tue, 05 Nov 2024 04:24:17 GMT | ||
Server: | ||
- Werkzeug/2.2.2 Python/3.10.4 | ||
- Werkzeug/2.2.3 Python/3.10.12 | ||
status: | ||
code: 200 | ||
message: OK | ||
|
@@ -164,9 +164,13 @@ interactions: | |
uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000013.11&rettype=fasta&seq_start=32316467&seq_stop=32316467&tool=bioutils&[email protected] | ||
response: | ||
body: | ||
string: !!binary | | ||
H4sIAAAAAAAAALLzc443AAJDYz1DQytjI2NDMxMzc10YQ8EjPzdfoTixIDM1r1ghOaMIyC3Oz01V | ||
MDTWUXAPcs4wttArMDRRCCjKzE0sqlRwLC5OzU3KqeRy5OICAAAA//8DABNU0u5bAAAA | ||
string: '>NC_000013.11:32316467-32316467 Homo sapiens chromosome 13, GRCh38.p14 | ||
Primary Assembly | ||
A | ||
' | ||
headers: | ||
Access-Control-Allow-Origin: | ||
- '*' | ||
|
@@ -183,28 +187,28 @@ interactions: | |
Content-Type: | ||
- text/plain | ||
Date: | ||
- Wed, 26 Jun 2024 11:58:42 GMT | ||
- Tue, 05 Nov 2024 04:24:17 GMT | ||
Keep-Alive: | ||
- timeout=4, max=40 | ||
NCBI-PHID: | ||
- D0BDC04CDF84FC0500004C64A04EB157.1.1.m_5 | ||
- 322C9169F7233CA500008001A2F50B2E.1.1.m_5 | ||
NCBI-SID: | ||
- 449331F7EE6FB74F_EC24SID | ||
- D84C9681EF2B137C_78C5SID | ||
Referrer-Policy: | ||
- origin-when-cross-origin | ||
Server: | ||
- Finatra | ||
Set-Cookie: | ||
- ncbi_sid=449331F7EE6FB74F_EC24SID; domain=.nih.gov; path=/; expires=Thu, 26 | ||
Jun 2025 11:58:42 GMT | ||
- ncbi_sid=D84C9681EF2B137C_78C5SID; domain=.nih.gov; path=/; expires=Wed, 05 | ||
Nov 2025 04:24:17 GMT | ||
Strict-Transport-Security: | ||
- max-age=31536000; includeSubDomains; preload | ||
Transfer-Encoding: | ||
- chunked | ||
X-RateLimit-Limit: | ||
- '3' | ||
X-RateLimit-Remaining: | ||
- '1' | ||
- '2' | ||
X-UA-Compatible: | ||
- IE=Edge | ||
X-XSS-Protection: | ||
|
@@ -229,10 +233,13 @@ interactions: | |
uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000013.11&rettype=fasta&seq_start=32316467&seq_stop=32316487&tool=bioutils&[email protected] | ||
response: | ||
body: | ||
string: !!binary | | ||
H4sIAAAAAAAAALLzc443AAJDYz1DQytjI2NDMxMzc10Iw8JcwSM/N1+hOLEgMzWvWCE5owjILc7P | ||
TVUwNNZRcA9yzjC20CswNFEIKMrMTSyqVHAsLk7NTcqp5HIMCXF3dwxxdnZ0dHQHQXcgk4sLAAAA | ||
//8DAG14V2hvAAAA | ||
string: '>NC_000013.11:32316467-32316487 Homo sapiens chromosome 13, GRCh38.p14 | ||
Primary Assembly | ||
ATTGGATCCAAAGAGAGGCCA | ||
' | ||
headers: | ||
Access-Control-Allow-Origin: | ||
- '*' | ||
|
@@ -249,20 +256,20 @@ interactions: | |
Content-Type: | ||
- text/plain | ||
Date: | ||
- Wed, 26 Jun 2024 11:58:42 GMT | ||
- Tue, 05 Nov 2024 04:24:18 GMT | ||
Keep-Alive: | ||
- timeout=4, max=40 | ||
NCBI-PHID: | ||
- D0BDC04CDF84FC0500005164A2D62050.1.1.m_5 | ||
- D0BD5FC90C0C9E5500003D05FA009012.1.1.m_5 | ||
NCBI-SID: | ||
- 522413927AFDEB32_BA92SID | ||
- 5A70B3B62676069A_B554SID | ||
Referrer-Policy: | ||
- origin-when-cross-origin | ||
Server: | ||
- Finatra | ||
Set-Cookie: | ||
- ncbi_sid=522413927AFDEB32_BA92SID; domain=.nih.gov; path=/; expires=Thu, 26 | ||
Jun 2025 11:58:42 GMT | ||
- ncbi_sid=5A70B3B62676069A_B554SID; domain=.nih.gov; path=/; expires=Wed, 05 | ||
Nov 2025 04:24:18 GMT | ||
Strict-Transport-Security: | ||
- max-age=31536000; includeSubDomains; preload | ||
Transfer-Encoding: | ||
|
Oops, something went wrong.