From 1b5d696bcd668dcfa9dfe35a0ad01530f3e91a59 Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Mon, 15 Jul 2024 15:16:40 -0300
Subject: [PATCH 01/28] Config file and help.txt file

Created:
- config.vsh.yaml
- help.txt
---
 src/seqtk/seqtk_subseq/config.vsh.yaml | 62 ++++++++++++++++++++++++++
 src/seqtk/seqtk_subseq/help.txt        |  9 ++++
 2 files changed, 71 insertions(+)
 create mode 100644 src/seqtk/seqtk_subseq/config.vsh.yaml
 create mode 100644 src/seqtk/seqtk_subseq/help.txt

diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
new file mode 100644
index 00000000..fccabe3a
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -0,0 +1,62 @@
+name: seqtk_subseq
+namespace: seqtk
+description: Extract subsequences from FASTA/Q files. Takes as input a FASTA/Q file and a name.lst (sequence ids file) or a reg.bed (genomic regions file).
+keywords: [subseq, FASTA, FASTQ]
+links:
+  repository: https://github.com/lh3/seqtk/tree/v1.4
+license: MIT
+
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: --input
+        type: file
+        description: The input FASTA/Q file.
+        required: true
+      - name: --name_list
+        type: file
+        description: List of sequence names or genomic regions to extract.
+        required: true
+
+  - name: Outputs
+    arguments:
+      - name: --output
+        type: file
+        description: The output FASTA/Q file.
+        required: true
+        direction: output
+
+  - name: Options
+    arguments:
+      - name: --tab
+        alternatives: -t
+        type: boolean_true
+        description: TAB delimited output.
+        required: false
+      - name: --strand_aware
+        alternatives: -s
+        type: boolean_true
+        description: Strand aware.
+        required: false
+      - name: --sequence_line_length
+        alternatives: -l
+        type: integer
+        description: sequence line length [0].
+        required: false
+        example: 60
+
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - type: file
+    path: ../test_data
+
+engines:
+  - type: docker
+    image: quay.io/biocontainers/seqtk:1.4--he4a0461_2
+runners:
+  - type: executable
+  - type: nextflow
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/help.txt b/src/seqtk/seqtk_subseq/help.txt
new file mode 100644
index 00000000..5768e4ff
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/help.txt
@@ -0,0 +1,9 @@
+```bash
+seqtk subseq
+```
+Usage:   seqtk subseq [options] <in.fa> <in.bed>|<name.list>
+Options:
+  -t       TAB delimited output
+  -s       strand aware
+  -l INT   sequence line length [0]
+Note: Use 'samtools faidx' if only a few regions are intended.
\ No newline at end of file

From 54b23ff7858ffad0b648b28ae8136d40fe601763 Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Mon, 15 Jul 2024 15:43:17 -0300
Subject: [PATCH 02/28] Added script.sh

File added:
- script.sh
---
 src/seqtk/seqtk_subseq/script.sh | 12 ++++++++++++
 src/seqtk/seqtk_subseq/test.sh   |  0
 2 files changed, 12 insertions(+)
 create mode 100644 src/seqtk/seqtk_subseq/script.sh
 create mode 100644 src/seqtk/seqtk_subseq/test.sh

diff --git a/src/seqtk/seqtk_subseq/script.sh b/src/seqtk/seqtk_subseq/script.sh
new file mode 100644
index 00000000..32053316
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/script.sh
@@ -0,0 +1,12 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+seqtk subseq \
+    ${par_tab:+-t} \
+    ${par_strand_aware:+-s} \
+    ${par_sequence_line_length:+-l "$par_sequence_line_length"} \
+    "$par_input" \
+    "$par_name_list" \
+    > "$par_output"
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
new file mode 100644
index 00000000..e69de29b

From 4157f4b4f6412906327179fe01f532f82cee571b Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Mon, 15 Jul 2024 18:02:47 -0300
Subject: [PATCH 03/28] Created test.sh

updates:
- changes to config.vsh.yaml
- created test.sh
- created some test files

Problems:
- there is some error in config file that is preventing me from running the component and testing
---
 src/seqtk/seqtk_subseq/config.vsh.yaml    | 19 ++++++++----
 src/seqtk/seqtk_subseq/test.sh            | 36 +++++++++++++++++++++++
 src/seqtk/seqtk_subseq/test_data/input.fa |  6 ++++
 src/seqtk/seqtk_subseq/test_data/input.fq | 12 ++++++++
 src/seqtk/seqtk_subseq/test_data/list.lst |  2 ++
 src/seqtk/seqtk_subseq/test_data/reg.bed  |  3 ++
 6 files changed, 73 insertions(+), 5 deletions(-)
 create mode 100644 src/seqtk/seqtk_subseq/test_data/input.fa
 create mode 100644 src/seqtk/seqtk_subseq/test_data/input.fq
 create mode 100644 src/seqtk/seqtk_subseq/test_data/list.lst
 create mode 100644 src/seqtk/seqtk_subseq/test_data/reg.bed

diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
index fccabe3a..49dc8b7f 100644
--- a/src/seqtk/seqtk_subseq/config.vsh.yaml
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -1,6 +1,7 @@
 name: seqtk_subseq
 namespace: seqtk
-description: Extract subsequences from FASTA/Q files. Takes as input a FASTA/Q file and a name.lst (sequence ids file) or a reg.bed (genomic regions file).
+description: | 
+  Extract subsequences from FASTA/Q files. Takes as input a FASTA/Q file and a name.lst (sequence ids file) or a reg.bed (genomic regions file).
 keywords: [subseq, FASTA, FASTQ]
 links:
   repository: https://github.com/lh3/seqtk/tree/v1.4
@@ -11,20 +12,28 @@ argument_groups:
     arguments:
       - name: --input
         type: file
+        direction: input
         description: The input FASTA/Q file.
         required: true
+        example: input.fa
+        
       - name: --name_list
         type: file
-        description: List of sequence names or genomic regions to extract.
+        direction: input
+        description: | 
+          List of sequence names (name.lst) or genomic regions (reg.bed) to extract.
         required: true
+        example: list.lst
 
   - name: Outputs
     arguments:
       - name: --output
+        alternatives: -o
         type: file
+        direction: output
         description: The output FASTA/Q file.
         required: true
-        direction: output
+        default: output.fa
 
   - name: Options
     arguments:
@@ -41,9 +50,9 @@ argument_groups:
       - name: --sequence_line_length
         alternatives: -l
         type: integer
-        description: sequence line length [0].
+        description: Sequence line length of input fasta file.
+        example: 16
         required: false
-        example: 60
 
 resources:
   - type: bash_script
diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index e69de29b..6c0bb325 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -0,0 +1,36 @@
+#!/bin/bash
+
+# exit on error
+set -e
+
+## VIASH START
+meta_executable="target/executable/seqtk/seqtk_subseq"
+meta_resources_dir="src/seqtk"
+## VIASH END
+
+#########################################################################################
+mkdir seqtk_subseq_test
+cd seqtk_subseq_test
+
+echo "> Run seqtk_subseq on FASTA/Q file"
+"$meta_executable" \
+  --input "$meta_resources_dir/test_data/input.fa" \
+  --name_list "$meta_resources_dir/test_data/list.lst" \
+  --output "sub_sampled.fa"
+
+echo ">> Check if output exists"
+if [ ! -f "sub_sampled.fa" ]; then
+    echo ">> sub_sampled.fa does not exist"
+    exit 1
+fi
+
+echo ">> Count number of subsamples in output"
+num_samples=$(grep -c '^@' sub_sampled.fa)
+if [ "$num_samples" -ne 2 ]; then
+    echo ">> sub_sampled.fa does not contain the 2 sub-samples"
+    exit 1
+fi
+
+#########################################################################################
+# ... add more tests here ...
+
diff --git a/src/seqtk/seqtk_subseq/test_data/input.fa b/src/seqtk/seqtk_subseq/test_data/input.fa
new file mode 100644
index 00000000..72d4b4f3
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test_data/input.fa
@@ -0,0 +1,6 @@
+>1
+ATCGATCGATCGATCG
+>2
+GCTAGCTAGCTAGCTA
+>3
+TTAGGCTAATCGATCG
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/test_data/input.fq b/src/seqtk/seqtk_subseq/test_data/input.fq
new file mode 100644
index 00000000..a127ee94
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test_data/input.fq
@@ -0,0 +1,12 @@
+@1
+ATCGATCGATCGATCG
++
+HHHHHHHHHHHHHHHH
+@2
+GCTAGCTAGCTAGCTA
++
+HHHHHHHHHHHHHHHH
+@3
+TTAGGCTAATCGATCG
++
+HHHHHHHHHHHHHHHH
diff --git a/src/seqtk/seqtk_subseq/test_data/list.lst b/src/seqtk/seqtk_subseq/test_data/list.lst
new file mode 100644
index 00000000..2b2f2e1b
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test_data/list.lst
@@ -0,0 +1,2 @@
+1
+3
diff --git a/src/seqtk/seqtk_subseq/test_data/reg.bed b/src/seqtk/seqtk_subseq/test_data/reg.bed
new file mode 100644
index 00000000..81099956
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test_data/reg.bed
@@ -0,0 +1,3 @@
+chr1    1000    5000    feature1    0    +
+chr2    2000    6000    feature2    0    -
+chr3    3000    7000    feature3    0    +

From 9ca70717c6094ad23d93a4abaa39700acb837b42 Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Mon, 15 Jul 2024 22:56:42 -0300
Subject: [PATCH 04/28] Update on test.sh

---
 src/seqtk/seqtk_subseq/test.sh | 37 ++++++++++++++++++++++++++++++++++
 1 file changed, 37 insertions(+)

diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index 6c0bb325..dece837f 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -31,6 +31,43 @@ if [ "$num_samples" -ne 2 ]; then
     exit 1
 fi
 
+# echo ">> Compare reads"
+# # Extract headers
+# headers1=$(grep '^@' sampled_1.fastq | sed -e's/ 1$//' | sort)
+# headers2=$(grep '^@' sampled_2.fastq | sed -e 's/ 2$//' | sort)
+
+# # Compare headers
+# diff <(echo "$headers1") <(echo "$headers2") || { echo "Mismatch detected"; exit 1; }
+
 #########################################################################################
 # ... add more tests here ...
+# test fq file
+
+# TODO: Figure out how the test fq file should look like and how the reg.bed file should look like
+
+#########################################################################################
+# test tab option
+echo "> Run seqtk_subseq with TAB option"
+"$meta_executable" \
+  --tab \
+  --input "$meta_resources_dir/test_data/input.fa" \
+  --name_list "$meta_resources_dir/test_data/list.lst" \
+  --output "sub_sampled.fa"
+
+#########################################################################################
+# test strand aware option
+echo "> Run seqtk_subseq with Strand Aware option"
+"$meta_executable" \
+  --strand_aware \
+  --input "$meta_resources_dir/test_data/input.fa" \
+  --name_list "$meta_resources_dir/test_data/list.lst" \
+  --output "sub_sampled.fa"
 
+#########################################################################################
+# test sequence line length option
+echo "> Run seqtk_subseq with line length option"
+"$meta_executable" \
+  --sequence_line_length 16 \
+  --input "$meta_resources_dir/test_data/input.fa" \
+  --name_list "$meta_resources_dir/test_data/list.lst" \
+  --output "sub_sampled.fa"

From 999c582c3bbc629d63951da3fad2f401944e11df Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Tue, 16 Jul 2024 10:11:10 -0300
Subject: [PATCH 05/28] update

---
 src/seqtk/seqtk_subseq/config.vsh.yaml | 12 ++++++------
 src/seqtk/seqtk_subseq/test.sh         | 15 +++++++++------
 2 files changed, 15 insertions(+), 12 deletions(-)

diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
index 49dc8b7f..575d5d3d 100644
--- a/src/seqtk/seqtk_subseq/config.vsh.yaml
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -10,14 +10,14 @@ license: MIT
 argument_groups:
   - name: Inputs
     arguments:
-      - name: --input
+      - name: "--input"
         type: file
         direction: input
         description: The input FASTA/Q file.
         required: true
         example: input.fa
         
-      - name: --name_list
+      - name: "--name_list"
         type: file
         direction: input
         description: | 
@@ -27,7 +27,7 @@ argument_groups:
 
   - name: Outputs
     arguments:
-      - name: --output
+      - name: "--output"
         alternatives: -o
         type: file
         direction: output
@@ -37,17 +37,17 @@ argument_groups:
 
   - name: Options
     arguments:
-      - name: --tab
+      - name: "--tab"
         alternatives: -t
         type: boolean_true
         description: TAB delimited output.
         required: false
-      - name: --strand_aware
+      - name: "--strand_aware"
         alternatives: -s
         type: boolean_true
         description: Strand aware.
         required: false
-      - name: --sequence_line_length
+      - name: "--sequence_line_length"
         alternatives: -l
         type: integer
         description: Sequence line length of input fasta file.
diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index dece837f..21876e6b 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -31,13 +31,7 @@ if [ "$num_samples" -ne 2 ]; then
     exit 1
 fi
 
-# echo ">> Compare reads"
-# # Extract headers
-# headers1=$(grep '^@' sampled_1.fastq | sed -e's/ 1$//' | sort)
-# headers2=$(grep '^@' sampled_2.fastq | sed -e 's/ 2$//' | sort)
 
-# # Compare headers
-# diff <(echo "$headers1") <(echo "$headers2") || { echo "Mismatch detected"; exit 1; }
 
 #########################################################################################
 # ... add more tests here ...
@@ -71,3 +65,12 @@ echo "> Run seqtk_subseq with line length option"
   --input "$meta_resources_dir/test_data/input.fa" \
   --name_list "$meta_resources_dir/test_data/list.lst" \
   --output "sub_sampled.fa"
+
+
+# echo ">> Compare reads"
+# # Extract headers
+# headers1=$(grep '^@' sampled_1.fastq | sed -e's/ 1$//' | sort)
+# headers2=$(grep '^@' sampled_2.fastq | sed -e 's/ 2$//' | sort)
+
+# # Compare headers
+# diff <(echo "$headers1") <(echo "$headers2") || { echo "Mismatch detected"; exit 1; }
\ No newline at end of file

From 628a335700cbdba81f48daecb46406d62626bb4e Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Tue, 16 Jul 2024 10:21:06 -0300
Subject: [PATCH 06/28] Bug fixes

- config required: false bug
---
 src/seqtk/seqtk_subseq/config.vsh.yaml | 8 ++++----
 src/seqtk/seqtk_subseq/test.sh         | 1 -
 2 files changed, 4 insertions(+), 5 deletions(-)

diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
index 575d5d3d..b6c2ab53 100644
--- a/src/seqtk/seqtk_subseq/config.vsh.yaml
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -41,18 +41,18 @@ argument_groups:
         alternatives: -t
         type: boolean_true
         description: TAB delimited output.
-        required: false
+        
       - name: "--strand_aware"
         alternatives: -s
         type: boolean_true
         description: Strand aware.
-        required: false
+        
       - name: "--sequence_line_length"
         alternatives: -l
         type: integer
         description: Sequence line length of input fasta file.
         example: 16
-        required: false
+        
 
 resources:
   - type: bash_script
@@ -61,7 +61,7 @@ test_resources:
   - type: bash_script
     path: test.sh
   - type: file
-    path: ../test_data
+    path: test_data
 
 engines:
   - type: docker
diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index 21876e6b..8e4c36f4 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -32,7 +32,6 @@ if [ "$num_samples" -ne 2 ]; then
 fi
 
 
-
 #########################################################################################
 # ... add more tests here ...
 # test fq file

From 1337b0faffa96321e609ca20f9e2904d995e7c8d Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Tue, 16 Jul 2024 10:39:26 -0300
Subject: [PATCH 07/28] Update test

---
 src/seqtk/seqtk_subseq/test.sh | 1 +
 1 file changed, 1 insertion(+)

diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index 8e4c36f4..87f815dd 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -34,6 +34,7 @@ fi
 
 #########################################################################################
 # ... add more tests here ...
+#
 # test fq file
 
 # TODO: Figure out how the test fq file should look like and how the reg.bed file should look like

From 5b7f207caa27085d9654d0b022263905e66c81f0 Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Tue, 16 Jul 2024 10:41:27 -0300
Subject: [PATCH 08/28] Update CHANGELOG.md

---
 CHANGELOG.md | 2 ++
 1 file changed, 2 insertions(+)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 80b8b9f3..0c88fec1 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -80,6 +80,8 @@
     - `bedtools_getfasta`: extract sequences from a FASTA file for each of the
                            intervals defined in a BED/GFF/VCF file (PR #59).
 
+* `seqtk subseq`: (PR #)
+
 ## MINOR CHANGES
 
 * Uniformize component metadata (PR #23).

From 84f714e8e67e2febaf644eccf2956c7b5dab54c5 Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Tue, 16 Jul 2024 15:45:23 -0300
Subject: [PATCH 09/28] Improvement on test.sh

---
 src/seqtk/seqtk_subseq/test.sh                | 80 +++++++++----------
 src/seqtk/seqtk_subseq/test_data/a.1.fastq    | 40 ++++++++++
 src/seqtk/seqtk_subseq/test_data/a.2.fastq    | 40 ++++++++++
 src/seqtk/seqtk_subseq/test_data/a.fastq      |  4 +
 .../test_data/{list.lst => id.list}           |  1 -
 src/seqtk/seqtk_subseq/test_data/input.fa     |  6 --
 src/seqtk/seqtk_subseq/test_data/input.fq     | 12 ---
 src/seqtk/seqtk_subseq/test_data/reg.bed      |  3 -
 src/seqtk/seqtk_subseq/test_data/script.sh    | 13 +++
 9 files changed, 135 insertions(+), 64 deletions(-)
 create mode 100644 src/seqtk/seqtk_subseq/test_data/a.1.fastq
 create mode 100644 src/seqtk/seqtk_subseq/test_data/a.2.fastq
 create mode 100644 src/seqtk/seqtk_subseq/test_data/a.fastq
 rename src/seqtk/seqtk_subseq/test_data/{list.lst => id.list} (50%)
 delete mode 100644 src/seqtk/seqtk_subseq/test_data/input.fa
 delete mode 100644 src/seqtk/seqtk_subseq/test_data/input.fq
 delete mode 100644 src/seqtk/seqtk_subseq/test_data/reg.bed
 create mode 100644 src/seqtk/seqtk_subseq/test_data/script.sh

diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index 87f815dd..28b08360 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -12,65 +12,61 @@ meta_resources_dir="src/seqtk"
 mkdir seqtk_subseq_test
 cd seqtk_subseq_test
 
-echo "> Run seqtk_subseq on FASTA/Q file"
+echo "> Run seqtk_subseq on FASTA file"
 "$meta_executable" \
-  --input "$meta_resources_dir/test_data/input.fa" \
-  --name_list "$meta_resources_dir/test_data/list.lst" \
-  --output "sub_sampled.fa"
+  --input "$meta_resources_dir/test_data/a.1.fastq.gz" \
+  --name_list "$meta_resources_dir/test_data/id.list" \
+  --output "sub_sample.fq"
 
 echo ">> Check if output exists"
-if [ ! -f "sub_sampled.fa" ]; then
-    echo ">> sub_sampled.fa does not exist"
+if [ ! -f "sub_sample.fq" ]; then
+    echo ">> sub_sample.fq does not exist"
     exit 1
 fi
 
-echo ">> Count number of subsamples in output"
-num_samples=$(grep -c '^@' sub_sampled.fa)
-if [ "$num_samples" -ne 2 ]; then
-    echo ">> sub_sampled.fa does not contain the 2 sub-samples"
+echo ">> Check number of lines in output"
+n_lines=$(wc -l < sub_sample.fq)  
+n_lines=$(echo "$n_lines" | awk '{print $1}')
+
+if [ "$n_lines" -ne 2 ]; then
+    echo ">> sub_sample.fq does not contain exactly two lines"
     exit 1
 fi
 
-
-#########################################################################################
-# ... add more tests here ...
-#
-# test fq file
-
-# TODO: Figure out how the test fq file should look like and how the reg.bed file should look like
+echo ">> Check content in output"
+result=$(sed -n '2p' sub_sample.fq)
+expected=$(sed -n '2p' "$meta_resources_dir/test_data/a.1.fastq")
+if [ "$result" == "$expected" ]; then
+    echo "--> content are equal"
+else
+    echo "--> content are not equal"
+fi
 
 #########################################################################################
 # test tab option
-echo "> Run seqtk_subseq with TAB option"
-"$meta_executable" \
-  --tab \
-  --input "$meta_resources_dir/test_data/input.fa" \
-  --name_list "$meta_resources_dir/test_data/list.lst" \
-  --output "sub_sampled.fa"
+# echo "> Run seqtk_subseq with TAB option"
+# "$meta_executable" \
+#   --tab \
+#   --input "$meta_resources_dir/test_data/input.fa" \
+#   --name_list "$meta_resources_dir/test_data/list.lst" \
+#   --output "sub_sampled.fa"
 
 #########################################################################################
 # test strand aware option
-echo "> Run seqtk_subseq with Strand Aware option"
-"$meta_executable" \
-  --strand_aware \
-  --input "$meta_resources_dir/test_data/input.fa" \
-  --name_list "$meta_resources_dir/test_data/list.lst" \
-  --output "sub_sampled.fa"
+# echo "> Run seqtk_subseq with Strand Aware option"
+# "$meta_executable" \
+#   --strand_aware \
+#   --input "$meta_resources_dir/test_data/input.fa" \
+#   --name_list "$meta_resources_dir/test_data/list.lst" \
+#   --output "sub_sampled.fa"
 
 #########################################################################################
 # test sequence line length option
-echo "> Run seqtk_subseq with line length option"
-"$meta_executable" \
-  --sequence_line_length 16 \
-  --input "$meta_resources_dir/test_data/input.fa" \
-  --name_list "$meta_resources_dir/test_data/list.lst" \
-  --output "sub_sampled.fa"
-
+# echo "> Run seqtk_subseq with line length option"
+# "$meta_executable" \
+#   --sequence_line_length 16 \
+#   --input "$meta_resources_dir/test_data/input.fa" \
+#   --name_list "$meta_resources_dir/test_data/list.lst" \
+#   --output "sub_sampled.fa"
 
-# echo ">> Compare reads"
-# # Extract headers
-# headers1=$(grep '^@' sampled_1.fastq | sed -e's/ 1$//' | sort)
-# headers2=$(grep '^@' sampled_2.fastq | sed -e 's/ 2$//' | sort)
 
-# # Compare headers
-# diff <(echo "$headers1") <(echo "$headers2") || { echo "Mismatch detected"; exit 1; }
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/test_data/a.1.fastq b/src/seqtk/seqtk_subseq/test_data/a.1.fastq
new file mode 100644
index 00000000..458b2a9c
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test_data/a.1.fastq
@@ -0,0 +1,40 @@
+@1 1
+A1_1
++1_1
+!1_1
+@2 1
+A2_1
++2_1
+!2_1
+@3 1
+A3_1
++3_1
+!3_1
+@4 1
+A4_1
++4_1
+!4_1
+@5 1
+A5_1
++5_1
+!5_1
+@6 1
+A6_1
++6_1
+!6_1
+@7 1
+A7_1
++7_1
+!7_1
+@8 1
+A8_1
++8_1
+!8_1
+@9 1
+A9_1
++9_1
+!9_1
+@10 1
+A10_1
++10_1
+!10_1
diff --git a/src/seqtk/seqtk_subseq/test_data/a.2.fastq b/src/seqtk/seqtk_subseq/test_data/a.2.fastq
new file mode 100644
index 00000000..50d3ce80
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test_data/a.2.fastq
@@ -0,0 +1,40 @@
+@1 2
+A1_2
++1_2
+!1_2
+@2 2
+A2_2
++2_2
+!2_2
+@3 2
+A3_2
++3_2
+!3_2
+@4 2
+A4_2
++4_2
+!4_2
+@5 2
+A5_2
++5_2
+!5_2
+@6 2
+A6_2
++6_2
+!6_2
+@7 2
+A7_2
++7_2
+!7_2
+@8 2
+A8_2
++8_2
+!8_2
+@9 2
+A9_2
++9_2
+!9_2
+@10 2
+A10_2
++10_2
+!10_2
diff --git a/src/seqtk/seqtk_subseq/test_data/a.fastq b/src/seqtk/seqtk_subseq/test_data/a.fastq
new file mode 100644
index 00000000..42735560
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test_data/a.fastq
@@ -0,0 +1,4 @@
+@1
+ACGGCAT
++
+!!!!!!!
diff --git a/src/seqtk/seqtk_subseq/test_data/list.lst b/src/seqtk/seqtk_subseq/test_data/id.list
similarity index 50%
rename from src/seqtk/seqtk_subseq/test_data/list.lst
rename to src/seqtk/seqtk_subseq/test_data/id.list
index 2b2f2e1b..d00491fd 100644
--- a/src/seqtk/seqtk_subseq/test_data/list.lst
+++ b/src/seqtk/seqtk_subseq/test_data/id.list
@@ -1,2 +1 @@
 1
-3
diff --git a/src/seqtk/seqtk_subseq/test_data/input.fa b/src/seqtk/seqtk_subseq/test_data/input.fa
deleted file mode 100644
index 72d4b4f3..00000000
--- a/src/seqtk/seqtk_subseq/test_data/input.fa
+++ /dev/null
@@ -1,6 +0,0 @@
->1
-ATCGATCGATCGATCG
->2
-GCTAGCTAGCTAGCTA
->3
-TTAGGCTAATCGATCG
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/test_data/input.fq b/src/seqtk/seqtk_subseq/test_data/input.fq
deleted file mode 100644
index a127ee94..00000000
--- a/src/seqtk/seqtk_subseq/test_data/input.fq
+++ /dev/null
@@ -1,12 +0,0 @@
-@1
-ATCGATCGATCGATCG
-+
-HHHHHHHHHHHHHHHH
-@2
-GCTAGCTAGCTAGCTA
-+
-HHHHHHHHHHHHHHHH
-@3
-TTAGGCTAATCGATCG
-+
-HHHHHHHHHHHHHHHH
diff --git a/src/seqtk/seqtk_subseq/test_data/reg.bed b/src/seqtk/seqtk_subseq/test_data/reg.bed
deleted file mode 100644
index 81099956..00000000
--- a/src/seqtk/seqtk_subseq/test_data/reg.bed
+++ /dev/null
@@ -1,3 +0,0 @@
-chr1    1000    5000    feature1    0    +
-chr2    2000    6000    feature2    0    -
-chr3    3000    7000    feature3    0    +
diff --git a/src/seqtk/seqtk_subseq/test_data/script.sh b/src/seqtk/seqtk_subseq/test_data/script.sh
new file mode 100644
index 00000000..b2d825f5
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test_data/script.sh
@@ -0,0 +1,13 @@
+# clone repo
+if [ ! -d /tmp/snakemake-wrappers ]; then
+  git clone --depth 1 --single-branch --branch master https://github.com/snakemake/snakemake-wrappers /tmp/snakemake-wrappers
+fi
+
+# copy test data
+cp -r /tmp/snakemake-wrappers/bio/seqtk/test/reads/* src/seqtk/seqtk_subseq/test_data
+
+# remove a.fastq file
+rm src/seqtk/seqtk_subseq/test_data/a.fastq
+
+# unzip fastq files
+gunzip src/seqtk/seqtk_subseq/test_data/*.gz

From 88cf6d74af5a198003e6909c368ccd147c62e7eb Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Tue, 16 Jul 2024 17:56:15 -0300
Subject: [PATCH 10/28] Added more test

I tried out different option of the command with different fasta and fastq files and different list, but the output does not seem to change.
---
 src/seqtk/seqtk_subseq/config.vsh.yaml       |   2 +-
 src/seqtk/seqtk_subseq/test.sh               | 132 +++++++++++++++----
 src/seqtk/seqtk_subseq/test_data/id2.list    |   2 +
 src/seqtk/seqtk_subseq/test_data/ids.txt     |   2 +
 src/seqtk/seqtk_subseq/test_data/input.fasta |  15 +++
 5 files changed, 127 insertions(+), 26 deletions(-)
 create mode 100644 src/seqtk/seqtk_subseq/test_data/id2.list
 create mode 100644 src/seqtk/seqtk_subseq/test_data/ids.txt
 create mode 100644 src/seqtk/seqtk_subseq/test_data/input.fasta

diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
index b6c2ab53..99aa92bb 100644
--- a/src/seqtk/seqtk_subseq/config.vsh.yaml
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -68,4 +68,4 @@ engines:
     image: quay.io/biocontainers/seqtk:1.4--he4a0461_2
 runners:
   - type: executable
-  - type: nextflow
\ No newline at end of file
+  - type: nextflow
diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index 28b08360..ca89fa12 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -9,12 +9,12 @@ meta_resources_dir="src/seqtk"
 ## VIASH END
 
 #########################################################################################
-mkdir seqtk_subseq_test
-cd seqtk_subseq_test
+mkdir test1
+cd test1
 
-echo "> Run seqtk_subseq on FASTA file"
+echo "> Run seqtk_subseq on FASTA/Q file"
 "$meta_executable" \
-  --input "$meta_resources_dir/test_data/a.1.fastq.gz" \
+  --input "$meta_resources_dir/test_data/a.1.fastq" \
   --name_list "$meta_resources_dir/test_data/id.list" \
   --output "sub_sample.fq"
 
@@ -43,30 +43,112 @@ else
 fi
 
 #########################################################################################
-# test tab option
-# echo "> Run seqtk_subseq with TAB option"
-# "$meta_executable" \
-#   --tab \
-#   --input "$meta_resources_dir/test_data/input.fa" \
-#   --name_list "$meta_resources_dir/test_data/list.lst" \
-#   --output "sub_sampled.fa"
+# -- tab option --
+cd ..
+mkdir test2
+cd test2
+
+echo "> Run seqtk_subseq with TAB option"
+"$meta_executable" \
+  --tab \
+  --input "$meta_resources_dir/test_data/a.1.fastq" \
+  --name_list "$meta_resources_dir/test_data/id.list" \
+  --output "sub_sample.fq"
+
+echo ">> Check if output exists"
+if [ ! -f "sub_sample.fq" ]; then
+    echo ">> sub_sample.fq does not exist"
+    exit 1
+fi
+
+echo ">> Check number of lines in output"
+n_lines=$(wc -l < sub_sample.fq)  
+n_lines=$(echo "$n_lines" | awk '{print $1}')
+
+if [ "$n_lines" -ne 2 ]; then
+    echo ">> sub_sample.fq does not contain exactly two lines"
+    exit 1
+fi
+
+echo ">> Check content in output"
+result=$(sed -n '2p' sub_sample.fq)
+expected=$(sed -n '2p' "$meta_resources_dir/test_data/a.1.fastq")
+if [ "$result" == "$expected" ]; then
+    echo "--> content are equal"
+else
+    echo "--> content are not equal"
+fi
 
 #########################################################################################
-# test strand aware option
-# echo "> Run seqtk_subseq with Strand Aware option"
-# "$meta_executable" \
-#   --strand_aware \
-#   --input "$meta_resources_dir/test_data/input.fa" \
-#   --name_list "$meta_resources_dir/test_data/list.lst" \
-#   --output "sub_sampled.fa"
+# -- strand aware option --
+cd ..
+mkdir test3
+cd test3
+echo "> Run seqtk_subseq with Strand Aware option"
+
+"$meta_executable" \
+  --strand_aware \
+  --input "$meta_resources_dir/test_data/a.1.fastq" \
+  --name_list "$meta_resources_dir/test_data/id.list" \
+  --output "sub_sample.fq"
+
+echo ">> Check if output exists"
+if [ ! -f "sub_sample.fq" ]; then
+    echo ">> sub_sample.fq does not exist"
+    exit 1
+fi
+
+echo ">> Check number of lines in output"
+n_lines=$(wc -l < sub_sample.fq)  
+n_lines=$(echo "$n_lines" | awk '{print $1}')
+
+if [ "$n_lines" -ne 2 ]; then
+    echo ">> sub_sample.fq does not contain exactly two lines"
+    exit 1
+fi
+
+echo ">> Check content in output"
+result=$(sed -n '2p' sub_sample.fq)
+expected=$(sed -n '2p' "$meta_resources_dir/test_data/a.1.fastq")
+if [ "$result" == "$expected" ]; then
+    echo "--> content are equal"
+else
+    echo "--> content are not equal"
+fi
 
 #########################################################################################
-# test sequence line length option
-# echo "> Run seqtk_subseq with line length option"
-# "$meta_executable" \
-#   --sequence_line_length 16 \
-#   --input "$meta_resources_dir/test_data/input.fa" \
-#   --name_list "$meta_resources_dir/test_data/list.lst" \
-#   --output "sub_sampled.fa"
+# -- sequence line length option --
+cd ..
+mkdir test4
+cd test4
 
+echo "> Run seqtk_subseq with line length option"
+"$meta_executable" \
+  --sequence_line_length 10 \
+  --input "$meta_resources_dir/test_data/a.1.fastq" \
+  --name_list "$meta_resources_dir/test_data/id.list" \
+  --output "sub_sample.fq"
 
+echo ">> Check if output exists"
+if [ ! -f "sub_sample.fq" ]; then
+    echo ">> sub_sample.fq does not exist"
+    exit 1
+fi
+
+echo ">> Check number of lines in output"
+n_lines=$(wc -l < sub_sample.fq)  
+n_lines=$(echo "$n_lines" | awk '{print $1}')
+
+if [ "$n_lines" -ne 2 ]; then
+    echo ">> sub_sample.fq does not contain exactly two lines"
+    exit 1
+fi
+
+echo ">> Check content in output"
+result=$(sed -n '2p' sub_sample.fq)
+expected=$(sed -n '2p' "$meta_resources_dir/test_data/a.1.fastq")
+if [ "$result" == "$expected" ]; then
+    echo "--> content are equal"
+else
+    echo "--> content are not equal"
+fi
diff --git a/src/seqtk/seqtk_subseq/test_data/id2.list b/src/seqtk/seqtk_subseq/test_data/id2.list
new file mode 100644
index 00000000..7a754f41
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test_data/id2.list
@@ -0,0 +1,2 @@
+1
+2
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/test_data/ids.txt b/src/seqtk/seqtk_subseq/test_data/ids.txt
new file mode 100644
index 00000000..56d77f0e
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test_data/ids.txt
@@ -0,0 +1,2 @@
+a   10  20
+c   10  20
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/test_data/input.fasta b/src/seqtk/seqtk_subseq/test_data/input.fasta
new file mode 100644
index 00000000..d6554922
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test_data/input.fasta
@@ -0,0 +1,15 @@
+>a
+GGAGCAGGAGAGTGTTCGAGTTCAGAGATGTCCATGGCGCCGTACGAGAAGGTGATGGATGACCTGGCCA
+AGGGGCAGCAGTTCGCGACGCAGCTGCAGGGCCTCCTCCGGGACTCCCCCAAGGCCGGCCACATCATGGA
+>b
+CTAATTTTATTTTTTTATAATAATTATTGGAGGAACTAAAACATTAATGAAATAATAATTATCATAATTA
+TTAATTACATATTTATTAGGTATAATATTTAAGGAAAAATATATTTTATGTTAATTGTAATAATTAGAAC
+>c
+CGATTTAGATCGGTGTAGTCAACACACATCCTCCACTTCCATTAGGCTTCTTGACGAGGACTACATTGAC
+AGCCACCGAGGGAACCGACCTCCTCAATGAAGTCAGACGCCAAGAGCCTATCAACTTCCTTCTGCACAGC
+>d
+CCTAAACCCTAAACCCTAAACCCCCTACAAACCTTACCCTAAACCCTAAACCCTAAACCCTAAACCCTAA
+ACCCGAAACCCTATACCCTAAACCCTAAACCCTAAACCCTAAACCCTAACCCAAACCTAATCCCTAAACC
+>e
+TAGAAGCTAATGAAAACTTTTCCTTTACTAAAAACCGTCAAACACGGTAAGAAACGCTTTTAATCATTTC
+AAAAGCAATCCCAATAGTGGTTACATCCAAACAAAACCCATTTCTTATATTTTCTCAAAAACAGTGAGAG
\ No newline at end of file

From bd5de0a5cbcbc09d23cdfa4cedc10c88f94d2da6 Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Tue, 16 Jul 2024 23:21:44 -0300
Subject: [PATCH 11/28] Update on tests

- got unstuck
- I need to create a docker image with the lastest version of seqtk
-
---
 myout.fa                                     |   0
 src/seqtk/seqtk_subseq/config.vsh.yaml       |   6 +-
 src/seqtk/seqtk_subseq/test.sh               |  18 +--
 src/seqtk/seqtk_subseq/test1.sh              | 122 +++++++++++++++++++
 src/seqtk/seqtk_subseq/test_data/id.list     |   3 +-
 src/seqtk/seqtk_subseq/test_data/input.fasta |  10 +-
 src/seqtk/seqtk_subseq/test_data/reg.bed     |   3 +
 7 files changed, 147 insertions(+), 15 deletions(-)
 create mode 100644 myout.fa
 create mode 100644 src/seqtk/seqtk_subseq/test1.sh
 create mode 100644 src/seqtk/seqtk_subseq/test_data/reg.bed

diff --git a/myout.fa b/myout.fa
new file mode 100644
index 00000000..e69de29b
diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
index 99aa92bb..f27311bc 100644
--- a/src/seqtk/seqtk_subseq/config.vsh.yaml
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -59,13 +59,17 @@ resources:
     path: script.sh
 test_resources:
   - type: bash_script
-    path: test.sh
+    path: test1.sh
   - type: file
     path: test_data
 
 engines:
   - type: docker
     image: quay.io/biocontainers/seqtk:1.4--he4a0461_2
+    setup:
+      - type: docker
+        run: |
+          echo "xxx: \"0.1.0\"" > /var/software_versions.txt
 runners:
   - type: executable
   - type: nextflow
diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index ca89fa12..7df736f6 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -42,8 +42,8 @@ else
     echo "--> content are not equal"
 fi
 
-#########################################################################################
-# -- tab option --
+########################################################################################
+#-- tab option --
 cd ..
 mkdir test2
 cd test2
@@ -51,8 +51,8 @@ cd test2
 echo "> Run seqtk_subseq with TAB option"
 "$meta_executable" \
   --tab \
-  --input "$meta_resources_dir/test_data/a.1.fastq" \
-  --name_list "$meta_resources_dir/test_data/id.list" \
+  --input "$meta_resources_dir/test_data/input.fasta" \
+  --name_list "$meta_resources_dir/test_data/ids.txt" \
   --output "sub_sample.fq"
 
 echo ">> Check if output exists"
@@ -79,8 +79,10 @@ else
     echo "--> content are not equal"
 fi
 
-#########################################################################################
-# -- strand aware option --
+cat sub_sample.fq
+
+########################################################################################
+-- strand aware option --
 cd ..
 mkdir test3
 cd test3
@@ -116,8 +118,8 @@ else
     echo "--> content are not equal"
 fi
 
-#########################################################################################
-# -- sequence line length option --
+########################################################################################
+-- sequence line length option --
 cd ..
 mkdir test4
 cd test4
diff --git a/src/seqtk/seqtk_subseq/test1.sh b/src/seqtk/seqtk_subseq/test1.sh
new file mode 100644
index 00000000..42b9f005
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test1.sh
@@ -0,0 +1,122 @@
+#!/bin/bash
+
+# exit on error
+set -e
+
+## VIASH START
+meta_executable="target/executable/seqtk/seqtk_subseq"
+meta_resources_dir="src/seqtk"
+## VIASH END
+
+#########################################################################################
+# Run basic test
+mkdir test1
+cd test1
+
+echo "> Run seqtk_subseq on FASTA/Q file"
+"$meta_executable" \
+  --input "$meta_resources_dir/test_data/input.fasta" \
+  --name_list "$meta_resources_dir/test_data/id.list" \
+  --output "sub_sample.fq"
+
+expected_output_basic=">KU562861.1
+GGAGCAGGAGAGTGTTCGAGTTCAGAGATGTCCATGGCGCCGTACGAGAAGGTGATGGATGACCTGGCCAAGGGGCAGCAGTTCGCGACGCAGCTGCAGGGCCTCCTCCGGGACTCCCCCAAGGCCGGCCACATCATGGA
+>MH150936.1
+TAGAAGCTAATGAAAACTTTTCCTTTACTAAAAACCGTCAAACACGGTAAGAAACGCTTTTAATCATTTCAAAAGCAATCCCAATAGTGGTTACATCCAAACAAAACCCATTTCTTATATTTTCTCAAAAACAGTGAGAG"
+output_basic=$(cat sub_sample.fq)
+
+if [ "$output_basic" == "$expected_output_basic" ]; then
+  echo "Basic test passed"
+else
+  echo "Basic test failed"
+  echo "Expected:"
+  echo "$expected_output_basic"
+  echo "Got:"
+  echo "$output_basic"
+fi
+
+#########################################################################################
+# Run reg.bed as name list input test
+cd ..
+mkdir test2
+cd test2
+
+echo "> Run seqtk_subseq on FASTA/Q file with BED file as name list"
+"$meta_executable" \
+  --input "$meta_resources_dir/test_data/input.fasta" \
+  --name_list "$meta_resources_dir/test_data/reg.bed" \
+  --output "sub_sample.fq"
+
+expected_output_basic=">KU562861.1:11-20
+AGTGTTCGAG
+>MH150936.1:11-20
+TGAAAACTTT"
+output_basic=$(cat sub_sample.fq)
+
+if [ "$output_basic" == "$expected_output_basic" ]; then
+  echo "Test passed!"
+else
+  echo "Test failed!"
+  echo "Expected:"
+  echo "$expected_output_basic"
+  echo "Got:"
+  echo "$output_basic"
+fi
+
+#########################################################################################
+# Run tab option output test
+cd ..
+mkdir test3
+cd test3
+
+echo "> Run seqtk_subseq with TAB option"
+"$meta_executable" \
+  --tab \
+  --input "$meta_resources_dir/test_data/input.fasta" \
+  --name_list "$meta_resources_dir/test_data/reg.bed" \
+  --output "sub_sample.fq"
+
+expected_output_tabular="KU562861.1\t11\tAGTGTTCGAG
+MH150936.1\t11\tTGAAAACTTT"
+output_tabular=$(cat sub_sample.fq)
+
+if [ "$output_tabular" == "$expected_output_tabular" ]; then
+  echo "Tabular output test passed"
+else
+  echo "Tabular output test failed"
+  echo "Expected:"
+  echo "$expected_output_tabular"
+  echo "Got:"
+  echo "$output_tabular"
+fi
+
+#########################################################################################
+# Run line option output test
+cd ..
+mkdir test4
+cd test4
+
+echo "> Run seqtk_subseq with line length option"
+"$meta_executable" \
+  --sequence_line_length 5 \
+  --input "$meta_resources_dir/test_data/input.fasta" \
+  --name_list "$meta_resources_dir/test_data/reg.bed" \
+  --output "sub_sample.fq"
+
+expected_output_wrapped=">KU562861.1:11-20
+AGTGT
+TCGAG
+>MH150936.1:11-20
+TGAAA
+ACTTT"
+output_wrapped=$(cat sub_sample.fq)
+
+if [ "$output_wrapped" == "$expected_output_wrapped" ]; then
+  echo "Line-wrapped output test passed"
+else
+  echo "Line-wrapped output test failed"
+  echo "Expected:"
+  echo "$expected_output_wrapped"
+  echo "Got:"
+  echo "$output_wrapped"
+fi
diff --git a/src/seqtk/seqtk_subseq/test_data/id.list b/src/seqtk/seqtk_subseq/test_data/id.list
index d00491fd..3071abfc 100644
--- a/src/seqtk/seqtk_subseq/test_data/id.list
+++ b/src/seqtk/seqtk_subseq/test_data/id.list
@@ -1 +1,2 @@
-1
+KU562861.1
+MH150936.1
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/test_data/input.fasta b/src/seqtk/seqtk_subseq/test_data/input.fasta
index d6554922..ea35c1f3 100644
--- a/src/seqtk/seqtk_subseq/test_data/input.fasta
+++ b/src/seqtk/seqtk_subseq/test_data/input.fasta
@@ -1,15 +1,15 @@
->a
+>KU562861.1
 GGAGCAGGAGAGTGTTCGAGTTCAGAGATGTCCATGGCGCCGTACGAGAAGGTGATGGATGACCTGGCCA
 AGGGGCAGCAGTTCGCGACGCAGCTGCAGGGCCTCCTCCGGGACTCCCCCAAGGCCGGCCACATCATGGA
->b
+>GU056837.1
 CTAATTTTATTTTTTTATAATAATTATTGGAGGAACTAAAACATTAATGAAATAATAATTATCATAATTA
 TTAATTACATATTTATTAGGTATAATATTTAAGGAAAAATATATTTTATGTTAATTGTAATAATTAGAAC
->c
+>CP097510.1
 CGATTTAGATCGGTGTAGTCAACACACATCCTCCACTTCCATTAGGCTTCTTGACGAGGACTACATTGAC
 AGCCACCGAGGGAACCGACCTCCTCAATGAAGTCAGACGCCAAGAGCCTATCAACTTCCTTCTGCACAGC
->d
+>JAMFTS010000002.1
 CCTAAACCCTAAACCCTAAACCCCCTACAAACCTTACCCTAAACCCTAAACCCTAAACCCTAAACCCTAA
 ACCCGAAACCCTATACCCTAAACCCTAAACCCTAAACCCTAAACCCTAACCCAAACCTAATCCCTAAACC
->e
+>MH150936.1
 TAGAAGCTAATGAAAACTTTTCCTTTACTAAAAACCGTCAAACACGGTAAGAAACGCTTTTAATCATTTC
 AAAAGCAATCCCAATAGTGGTTACATCCAAACAAAACCCATTTCTTATATTTTCTCAAAAACAGTGAGAG
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/test_data/reg.bed b/src/seqtk/seqtk_subseq/test_data/reg.bed
new file mode 100644
index 00000000..137ed6c1
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test_data/reg.bed
@@ -0,0 +1,3 @@
+KU562861.1	10	20
+MH150936.1	10	20
+

From cc6746eaebff4e2b537d3eab865692c3d03ef37c Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Wed, 17 Jul 2024 13:57:29 -0300
Subject: [PATCH 12/28] Bug fixed

- removed some test files
- fixed bug with the help of Toni
- added correct software_versions.txt to config

Still Needs:
- add one more test to strand aware
- fix tab test
---
 myout.fa                                   |   0
 src/seqtk/seqtk_subseq/config.vsh.yaml     |   8 +-
 src/seqtk/seqtk_subseq/script.sh           |   2 +
 src/seqtk/seqtk_subseq/test.sh             | 168 +++++++++------------
 src/seqtk/seqtk_subseq/test1.sh            | 122 ---------------
 src/seqtk/seqtk_subseq/test_data/a.1.fastq |  40 -----
 src/seqtk/seqtk_subseq/test_data/a.2.fastq |  40 -----
 src/seqtk/seqtk_subseq/test_data/a.fastq   |   4 -
 src/seqtk/seqtk_subseq/test_data/id2.list  |   2 -
 src/seqtk/seqtk_subseq/test_data/ids.txt   |   2 -
 10 files changed, 75 insertions(+), 313 deletions(-)
 delete mode 100644 myout.fa
 delete mode 100644 src/seqtk/seqtk_subseq/test1.sh
 delete mode 100644 src/seqtk/seqtk_subseq/test_data/a.1.fastq
 delete mode 100644 src/seqtk/seqtk_subseq/test_data/a.2.fastq
 delete mode 100644 src/seqtk/seqtk_subseq/test_data/a.fastq
 delete mode 100644 src/seqtk/seqtk_subseq/test_data/id2.list
 delete mode 100644 src/seqtk/seqtk_subseq/test_data/ids.txt

diff --git a/myout.fa b/myout.fa
deleted file mode 100644
index e69de29b..00000000
diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
index f27311bc..d98cd839 100644
--- a/src/seqtk/seqtk_subseq/config.vsh.yaml
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -59,7 +59,7 @@ resources:
     path: script.sh
 test_resources:
   - type: bash_script
-    path: test1.sh
+    path: test.sh
   - type: file
     path: test_data
 
@@ -67,9 +67,9 @@ engines:
   - type: docker
     image: quay.io/biocontainers/seqtk:1.4--he4a0461_2
     setup:
-      - type: docker
-        run: |
-          echo "xxx: \"0.1.0\"" > /var/software_versions.txt
++      - type: docker
++        run: |
++          echo "seqtk version: 1.4 (r122)" > /var/software_versions.txt
 runners:
   - type: executable
   - type: nextflow
diff --git a/src/seqtk/seqtk_subseq/script.sh b/src/seqtk/seqtk_subseq/script.sh
index 32053316..140663ca 100644
--- a/src/seqtk/seqtk_subseq/script.sh
+++ b/src/seqtk/seqtk_subseq/script.sh
@@ -2,6 +2,8 @@
 
 ## VIASH START
 ## VIASH END
+[[ "$par_tab" == "false" ]] && unset par_tab
+[[ "$par_strand_aware" == "false" ]] && unset par_strand_aware
 
 seqtk subseq \
     ${par_tab:+-t} \
diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index 7df736f6..5081b40f 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -8,149 +8,119 @@ meta_executable="target/executable/seqtk/seqtk_subseq"
 meta_resources_dir="src/seqtk"
 ## VIASH END
 
+# TODO:
+# - Fix Tab option test
+# - Add strand aware test (create new fasta file with right configuration)
+
 #########################################################################################
+# Run basic test
 mkdir test1
 cd test1
 
 echo "> Run seqtk_subseq on FASTA/Q file"
 "$meta_executable" \
-  --input "$meta_resources_dir/test_data/a.1.fastq" \
+  --input "$meta_resources_dir/test_data/input.fasta" \
   --name_list "$meta_resources_dir/test_data/id.list" \
   --output "sub_sample.fq"
 
-echo ">> Check if output exists"
-if [ ! -f "sub_sample.fq" ]; then
-    echo ">> sub_sample.fq does not exist"
-    exit 1
-fi
-
-echo ">> Check number of lines in output"
-n_lines=$(wc -l < sub_sample.fq)  
-n_lines=$(echo "$n_lines" | awk '{print $1}')
+expected_output_basic=">KU562861.1
+GGAGCAGGAGAGTGTTCGAGTTCAGAGATGTCCATGGCGCCGTACGAGAAGGTGATGGATGACCTGGCCAAGGGGCAGCAGTTCGCGACGCAGCTGCAGGGCCTCCTCCGGGACTCCCCCAAGGCCGGCCACATCATGGA
+>MH150936.1
+TAGAAGCTAATGAAAACTTTTCCTTTACTAAAAACCGTCAAACACGGTAAGAAACGCTTTTAATCATTTCAAAAGCAATCCCAATAGTGGTTACATCCAAACAAAACCCATTTCTTATATTTTCTCAAAAACAGTGAGAG"
+output_basic=$(cat sub_sample.fq)
 
-if [ "$n_lines" -ne 2 ]; then
-    echo ">> sub_sample.fq does not contain exactly two lines"
-    exit 1
-fi
-
-echo ">> Check content in output"
-result=$(sed -n '2p' sub_sample.fq)
-expected=$(sed -n '2p' "$meta_resources_dir/test_data/a.1.fastq")
-if [ "$result" == "$expected" ]; then
-    echo "--> content are equal"
+if [ "$output_basic" == "$expected_output_basic" ]; then
+  echo "Basic test passed"
 else
-    echo "--> content are not equal"
+  echo "Basic test failed"
+  echo "Expected:"
+  echo "$expected_output_basic"
+  echo "Got:"
+  echo "$output_basic"
 fi
 
-########################################################################################
-#-- tab option --
+#########################################################################################
+# Run reg.bed as name list input test
 cd ..
 mkdir test2
 cd test2
 
-echo "> Run seqtk_subseq with TAB option"
+echo "> Run seqtk_subseq on FASTA/Q file with BED file as name list"
 "$meta_executable" \
-  --tab \
   --input "$meta_resources_dir/test_data/input.fasta" \
-  --name_list "$meta_resources_dir/test_data/ids.txt" \
+  --name_list "$meta_resources_dir/test_data/reg.bed" \
   --output "sub_sample.fq"
 
-echo ">> Check if output exists"
-if [ ! -f "sub_sample.fq" ]; then
-    echo ">> sub_sample.fq does not exist"
-    exit 1
-fi
-
-echo ">> Check number of lines in output"
-n_lines=$(wc -l < sub_sample.fq)  
-n_lines=$(echo "$n_lines" | awk '{print $1}')
+expected_output_basic=">KU562861.1:11-20
+AGTGTTCGAG
+>MH150936.1:11-20
+TGAAAACTTT"
+output_basic=$(cat sub_sample.fq)
 
-if [ "$n_lines" -ne 2 ]; then
-    echo ">> sub_sample.fq does not contain exactly two lines"
-    exit 1
-fi
-
-echo ">> Check content in output"
-result=$(sed -n '2p' sub_sample.fq)
-expected=$(sed -n '2p' "$meta_resources_dir/test_data/a.1.fastq")
-if [ "$result" == "$expected" ]; then
-    echo "--> content are equal"
+if [ "$output_basic" == "$expected_output_basic" ]; then
+  echo "Test passed!"
 else
-    echo "--> content are not equal"
+  echo "Test failed!"
+  echo "Expected:"
+  echo "$expected_output_basic"
+  echo "Got:"
+  echo "$output_basic"
 fi
 
-cat sub_sample.fq
-
-########################################################################################
--- strand aware option --
+#########################################################################################
+# Run tab option output test
 cd ..
 mkdir test3
 cd test3
-echo "> Run seqtk_subseq with Strand Aware option"
 
+echo "> Run seqtk_subseq with TAB option"
 "$meta_executable" \
-  --strand_aware \
-  --input "$meta_resources_dir/test_data/a.1.fastq" \
-  --name_list "$meta_resources_dir/test_data/id.list" \
+  --tab \
+  --input "$meta_resources_dir/test_data/input.fasta" \
+  --name_list "$meta_resources_dir/test_data/reg.bed" \
   --output "sub_sample.fq"
 
-echo ">> Check if output exists"
-if [ ! -f "sub_sample.fq" ]; then
-    echo ">> sub_sample.fq does not exist"
-    exit 1
-fi
-
-echo ">> Check number of lines in output"
-n_lines=$(wc -l < sub_sample.fq)  
-n_lines=$(echo "$n_lines" | awk '{print $1}')
-
-if [ "$n_lines" -ne 2 ]; then
-    echo ">> sub_sample.fq does not contain exactly two lines"
-    exit 1
-fi
+expected_output_tabular=$(echo "KU562861.1\t11\tAGTGTTCGAG
+MH150936.1\t11\tTGAAAACTTT")
+output_tabular=$(cat sub_sample.fq)
 
-echo ">> Check content in output"
-result=$(sed -n '2p' sub_sample.fq)
-expected=$(sed -n '2p' "$meta_resources_dir/test_data/a.1.fastq")
-if [ "$result" == "$expected" ]; then
-    echo "--> content are equal"
+if [ "$output_tabular" == "$expected_output_tabular" ]; then
+  echo "Tabular output test passed"
 else
-    echo "--> content are not equal"
+  echo "Tabular output test failed"
+  echo "Expected:"
+  echo "$expected_output_tabular"
+  echo "Got:"
+  echo "$output_tabular"
 fi
 
-########################################################################################
--- sequence line length option --
+#########################################################################################
+# Run line option output test
 cd ..
 mkdir test4
 cd test4
 
 echo "> Run seqtk_subseq with line length option"
 "$meta_executable" \
-  --sequence_line_length 10 \
-  --input "$meta_resources_dir/test_data/a.1.fastq" \
-  --name_list "$meta_resources_dir/test_data/id.list" \
+  --sequence_line_length 5 \
+  --input "$meta_resources_dir/test_data/input.fasta" \
+  --name_list "$meta_resources_dir/test_data/reg.bed" \
   --output "sub_sample.fq"
 
-echo ">> Check if output exists"
-if [ ! -f "sub_sample.fq" ]; then
-    echo ">> sub_sample.fq does not exist"
-    exit 1
-fi
-
-echo ">> Check number of lines in output"
-n_lines=$(wc -l < sub_sample.fq)  
-n_lines=$(echo "$n_lines" | awk '{print $1}')
-
-if [ "$n_lines" -ne 2 ]; then
-    echo ">> sub_sample.fq does not contain exactly two lines"
-    exit 1
-fi
+expected_output_wrapped=">KU562861.1:11-20
+AGTGT
+TCGAG
+>MH150936.1:11-20
+TGAAA
+ACTTT"
+output_wrapped=$(cat sub_sample.fq)
 
-echo ">> Check content in output"
-result=$(sed -n '2p' sub_sample.fq)
-expected=$(sed -n '2p' "$meta_resources_dir/test_data/a.1.fastq")
-if [ "$result" == "$expected" ]; then
-    echo "--> content are equal"
+if [ "$output_wrapped" == "$expected_output_wrapped" ]; then
+  echo "Line-wrapped output test passed"
 else
-    echo "--> content are not equal"
+  echo "Line-wrapped output test failed"
+  echo "Expected:"
+  echo "$expected_output_wrapped"
+  echo "Got:"
+  echo "$output_wrapped"
 fi
diff --git a/src/seqtk/seqtk_subseq/test1.sh b/src/seqtk/seqtk_subseq/test1.sh
deleted file mode 100644
index 42b9f005..00000000
--- a/src/seqtk/seqtk_subseq/test1.sh
+++ /dev/null
@@ -1,122 +0,0 @@
-#!/bin/bash
-
-# exit on error
-set -e
-
-## VIASH START
-meta_executable="target/executable/seqtk/seqtk_subseq"
-meta_resources_dir="src/seqtk"
-## VIASH END
-
-#########################################################################################
-# Run basic test
-mkdir test1
-cd test1
-
-echo "> Run seqtk_subseq on FASTA/Q file"
-"$meta_executable" \
-  --input "$meta_resources_dir/test_data/input.fasta" \
-  --name_list "$meta_resources_dir/test_data/id.list" \
-  --output "sub_sample.fq"
-
-expected_output_basic=">KU562861.1
-GGAGCAGGAGAGTGTTCGAGTTCAGAGATGTCCATGGCGCCGTACGAGAAGGTGATGGATGACCTGGCCAAGGGGCAGCAGTTCGCGACGCAGCTGCAGGGCCTCCTCCGGGACTCCCCCAAGGCCGGCCACATCATGGA
->MH150936.1
-TAGAAGCTAATGAAAACTTTTCCTTTACTAAAAACCGTCAAACACGGTAAGAAACGCTTTTAATCATTTCAAAAGCAATCCCAATAGTGGTTACATCCAAACAAAACCCATTTCTTATATTTTCTCAAAAACAGTGAGAG"
-output_basic=$(cat sub_sample.fq)
-
-if [ "$output_basic" == "$expected_output_basic" ]; then
-  echo "Basic test passed"
-else
-  echo "Basic test failed"
-  echo "Expected:"
-  echo "$expected_output_basic"
-  echo "Got:"
-  echo "$output_basic"
-fi
-
-#########################################################################################
-# Run reg.bed as name list input test
-cd ..
-mkdir test2
-cd test2
-
-echo "> Run seqtk_subseq on FASTA/Q file with BED file as name list"
-"$meta_executable" \
-  --input "$meta_resources_dir/test_data/input.fasta" \
-  --name_list "$meta_resources_dir/test_data/reg.bed" \
-  --output "sub_sample.fq"
-
-expected_output_basic=">KU562861.1:11-20
-AGTGTTCGAG
->MH150936.1:11-20
-TGAAAACTTT"
-output_basic=$(cat sub_sample.fq)
-
-if [ "$output_basic" == "$expected_output_basic" ]; then
-  echo "Test passed!"
-else
-  echo "Test failed!"
-  echo "Expected:"
-  echo "$expected_output_basic"
-  echo "Got:"
-  echo "$output_basic"
-fi
-
-#########################################################################################
-# Run tab option output test
-cd ..
-mkdir test3
-cd test3
-
-echo "> Run seqtk_subseq with TAB option"
-"$meta_executable" \
-  --tab \
-  --input "$meta_resources_dir/test_data/input.fasta" \
-  --name_list "$meta_resources_dir/test_data/reg.bed" \
-  --output "sub_sample.fq"
-
-expected_output_tabular="KU562861.1\t11\tAGTGTTCGAG
-MH150936.1\t11\tTGAAAACTTT"
-output_tabular=$(cat sub_sample.fq)
-
-if [ "$output_tabular" == "$expected_output_tabular" ]; then
-  echo "Tabular output test passed"
-else
-  echo "Tabular output test failed"
-  echo "Expected:"
-  echo "$expected_output_tabular"
-  echo "Got:"
-  echo "$output_tabular"
-fi
-
-#########################################################################################
-# Run line option output test
-cd ..
-mkdir test4
-cd test4
-
-echo "> Run seqtk_subseq with line length option"
-"$meta_executable" \
-  --sequence_line_length 5 \
-  --input "$meta_resources_dir/test_data/input.fasta" \
-  --name_list "$meta_resources_dir/test_data/reg.bed" \
-  --output "sub_sample.fq"
-
-expected_output_wrapped=">KU562861.1:11-20
-AGTGT
-TCGAG
->MH150936.1:11-20
-TGAAA
-ACTTT"
-output_wrapped=$(cat sub_sample.fq)
-
-if [ "$output_wrapped" == "$expected_output_wrapped" ]; then
-  echo "Line-wrapped output test passed"
-else
-  echo "Line-wrapped output test failed"
-  echo "Expected:"
-  echo "$expected_output_wrapped"
-  echo "Got:"
-  echo "$output_wrapped"
-fi
diff --git a/src/seqtk/seqtk_subseq/test_data/a.1.fastq b/src/seqtk/seqtk_subseq/test_data/a.1.fastq
deleted file mode 100644
index 458b2a9c..00000000
--- a/src/seqtk/seqtk_subseq/test_data/a.1.fastq
+++ /dev/null
@@ -1,40 +0,0 @@
-@1 1
-A1_1
-+1_1
-!1_1
-@2 1
-A2_1
-+2_1
-!2_1
-@3 1
-A3_1
-+3_1
-!3_1
-@4 1
-A4_1
-+4_1
-!4_1
-@5 1
-A5_1
-+5_1
-!5_1
-@6 1
-A6_1
-+6_1
-!6_1
-@7 1
-A7_1
-+7_1
-!7_1
-@8 1
-A8_1
-+8_1
-!8_1
-@9 1
-A9_1
-+9_1
-!9_1
-@10 1
-A10_1
-+10_1
-!10_1
diff --git a/src/seqtk/seqtk_subseq/test_data/a.2.fastq b/src/seqtk/seqtk_subseq/test_data/a.2.fastq
deleted file mode 100644
index 50d3ce80..00000000
--- a/src/seqtk/seqtk_subseq/test_data/a.2.fastq
+++ /dev/null
@@ -1,40 +0,0 @@
-@1 2
-A1_2
-+1_2
-!1_2
-@2 2
-A2_2
-+2_2
-!2_2
-@3 2
-A3_2
-+3_2
-!3_2
-@4 2
-A4_2
-+4_2
-!4_2
-@5 2
-A5_2
-+5_2
-!5_2
-@6 2
-A6_2
-+6_2
-!6_2
-@7 2
-A7_2
-+7_2
-!7_2
-@8 2
-A8_2
-+8_2
-!8_2
-@9 2
-A9_2
-+9_2
-!9_2
-@10 2
-A10_2
-+10_2
-!10_2
diff --git a/src/seqtk/seqtk_subseq/test_data/a.fastq b/src/seqtk/seqtk_subseq/test_data/a.fastq
deleted file mode 100644
index 42735560..00000000
--- a/src/seqtk/seqtk_subseq/test_data/a.fastq
+++ /dev/null
@@ -1,4 +0,0 @@
-@1
-ACGGCAT
-+
-!!!!!!!
diff --git a/src/seqtk/seqtk_subseq/test_data/id2.list b/src/seqtk/seqtk_subseq/test_data/id2.list
deleted file mode 100644
index 7a754f41..00000000
--- a/src/seqtk/seqtk_subseq/test_data/id2.list
+++ /dev/null
@@ -1,2 +0,0 @@
-1
-2
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/test_data/ids.txt b/src/seqtk/seqtk_subseq/test_data/ids.txt
deleted file mode 100644
index 56d77f0e..00000000
--- a/src/seqtk/seqtk_subseq/test_data/ids.txt
+++ /dev/null
@@ -1,2 +0,0 @@
-a   10  20
-c   10  20
\ No newline at end of file

From c782e2a5504e8a4f960526cac9a569646ce27d83 Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Wed, 17 Jul 2024 14:11:42 -0300
Subject: [PATCH 13/28] Update CHANGELOG.md

---
 CHANGELOG.md | 4 +++-
 1 file changed, 3 insertions(+), 1 deletion(-)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 0c88fec1..8f54dcd0 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -80,7 +80,9 @@
     - `bedtools_getfasta`: extract sequences from a FASTA file for each of the
                            intervals defined in a BED/GFF/VCF file (PR #59).
 
-* `seqtk subseq`: (PR #)
+* `seqtk`:
+    - `subseq`: extract the sequences (complete or subsequence) from the FASTA/FASTQ files
+                based on provided sequence IDs or region coordinates file (PR #85).
 
 ## MINOR CHANGES
 

From 06e1fe881d642ab4ede0462bfede7eaf75afdf20 Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Wed, 17 Jul 2024 14:39:18 -0300
Subject: [PATCH 14/28] Fixed Tabular test bug

---
 src/seqtk/seqtk_subseq/config.vsh.yaml |  7 ++--
 src/seqtk/seqtk_subseq/test.sh         | 50 ++++++++++++++++++++------
 2 files changed, 44 insertions(+), 13 deletions(-)

diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
index d98cd839..a732af2b 100644
--- a/src/seqtk/seqtk_subseq/config.vsh.yaml
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -67,9 +67,10 @@ engines:
   - type: docker
     image: quay.io/biocontainers/seqtk:1.4--he4a0461_2
     setup:
-+      - type: docker
-+        run: |
-+          echo "seqtk version: 1.4 (r122)" > /var/software_versions.txt
+      - type: docker
+        run: |
+          echo "seqtk version: 1.4 (r122)" > /var/software_versions.txt
+
 runners:
   - type: executable
   - type: nextflow
diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index 5081b40f..0959db36 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -30,9 +30,9 @@ TAGAAGCTAATGAAAACTTTTCCTTTACTAAAAACCGTCAAACACGGTAAGAAACGCTTTTAATCATTTCAAAAGCAATC
 output_basic=$(cat sub_sample.fq)
 
 if [ "$output_basic" == "$expected_output_basic" ]; then
-  echo "Basic test passed"
+  echo "Test passed"
 else
-  echo "Basic test failed"
+  echo "Test failed"
   echo "Expected:"
   echo "$expected_output_basic"
   echo "Got:"
@@ -58,9 +58,9 @@ TGAAAACTTT"
 output_basic=$(cat sub_sample.fq)
 
 if [ "$output_basic" == "$expected_output_basic" ]; then
-  echo "Test passed!"
+  echo "Test passed"
 else
-  echo "Test failed!"
+  echo "Test failed"
   echo "Expected:"
   echo "$expected_output_basic"
   echo "Got:"
@@ -80,14 +80,13 @@ echo "> Run seqtk_subseq with TAB option"
   --name_list "$meta_resources_dir/test_data/reg.bed" \
   --output "sub_sample.fq"
 
-expected_output_tabular=$(echo "KU562861.1\t11\tAGTGTTCGAG
-MH150936.1\t11\tTGAAAACTTT")
+expected_output_tabular=$'KU562861.1\t11\tAGTGTTCGAG\nMH150936.1\t11\tTGAAAACTTT'
 output_tabular=$(cat sub_sample.fq)
 
 if [ "$output_tabular" == "$expected_output_tabular" ]; then
-  echo "Tabular output test passed"
+  echo "Test passed"
 else
-  echo "Tabular output test failed"
+  echo "Test failed"
   echo "Expected:"
   echo "$expected_output_tabular"
   echo "Got:"
@@ -116,11 +115,42 @@ ACTTT"
 output_wrapped=$(cat sub_sample.fq)
 
 if [ "$output_wrapped" == "$expected_output_wrapped" ]; then
-  echo "Line-wrapped output test passed"
+  echo "Test passed"
 else
-  echo "Line-wrapped output test failed"
+  echo "Test failed"
   echo "Expected:"
   echo "$expected_output_wrapped"
   echo "Got:"
   echo "$output_wrapped"
 fi
+
+#########################################################################################
+# Run Strand Aware option output test
+cd ..
+mkdir test5
+cd test5
+
+echo "> Run seqtk_subseq with strand aware option"
+"$meta_executable" \
+  --strand_aware \
+  --input "$meta_resources_dir/test_data/input.fasta" \
+  --name_list "$meta_resources_dir/test_data/reg.bed" \
+  --output "sub_sample.fq"
+
+# expected_output_wrapped=">KU562861.1:11-20
+# AGTGT
+# TCGAG
+# >MH150936.1:11-20
+# TGAAA
+# ACTTT"
+# output_wrapped=$(cat sub_sample.fq)
+
+# if [ "$output_wrapped" == "$expected_output_wrapped" ]; then
+#   echo "Line-wrapped output test passed"
+# else
+#   echo "Line-wrapped output test failed"
+#   echo "Expected:"
+#   echo "$expected_output_wrapped"
+#   echo "Got:"
+#   echo "$output_wrapped"
+# fi
\ No newline at end of file

From 20ac10a9a13a852a77f94c165c62df867308b03d Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Wed, 17 Jul 2024 15:33:37 -0300
Subject: [PATCH 15/28] Strand Aware Test

- implementation of strand aware test
- change of format for reg.bed file
---
 CHANGELOG.md                             |  4 +--
 src/seqtk/seqtk_subseq/script.sh         |  2 ++
 src/seqtk/seqtk_subseq/test.sh           | 32 +++++++++++-------------
 src/seqtk/seqtk_subseq/test_data/reg.bed |  4 +--
 4 files changed, 21 insertions(+), 21 deletions(-)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 8f54dcd0..d80f18f3 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -81,8 +81,8 @@
                            intervals defined in a BED/GFF/VCF file (PR #59).
 
 * `seqtk`:
-    - `subseq`: extract the sequences (complete or subsequence) from the FASTA/FASTQ files
-                based on provided sequence IDs or region coordinates file (PR #85).
+    - `subseq`: Extract the sequences (complete or subsequence) from the FASTA/FASTQ files
+                based on a provided sequence IDs or region coordinates file (PR #85).
 
 ## MINOR CHANGES
 
diff --git a/src/seqtk/seqtk_subseq/script.sh b/src/seqtk/seqtk_subseq/script.sh
index 140663ca..3abf5f2d 100644
--- a/src/seqtk/seqtk_subseq/script.sh
+++ b/src/seqtk/seqtk_subseq/script.sh
@@ -5,6 +5,8 @@
 [[ "$par_tab" == "false" ]] && unset par_tab
 [[ "$par_strand_aware" == "false" ]] && unset par_strand_aware
 
+# Todo: if a bed file is given, check if format is valid! + - should be in six column
+
 seqtk subseq \
     ${par_tab:+-t} \
     ${par_strand_aware:+-s} \
diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index 0959db36..95c8a19f 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -137,20 +137,18 @@ echo "> Run seqtk_subseq with strand aware option"
   --name_list "$meta_resources_dir/test_data/reg.bed" \
   --output "sub_sample.fq"
 
-# expected_output_wrapped=">KU562861.1:11-20
-# AGTGT
-# TCGAG
-# >MH150936.1:11-20
-# TGAAA
-# ACTTT"
-# output_wrapped=$(cat sub_sample.fq)
-
-# if [ "$output_wrapped" == "$expected_output_wrapped" ]; then
-#   echo "Line-wrapped output test passed"
-# else
-#   echo "Line-wrapped output test failed"
-#   echo "Expected:"
-#   echo "$expected_output_wrapped"
-#   echo "Got:"
-#   echo "$output_wrapped"
-# fi
\ No newline at end of file
+expected_output_wrapped=">KU562861.1:11-20
+AGTGTTCGAG
+>MH150936.1:11-20
+AAAGTTTTCA"
+output_wrapped=$(cat sub_sample.fq)
+
+if [ "$output_wrapped" == "$expected_output_wrapped" ]; then
+  echo "Test passed"
+else
+  echo "Test failed"
+  echo "Expected:"
+  echo "$expected_output_wrapped"
+  echo "Got:"
+  echo "$output_wrapped"
+fi
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/test_data/reg.bed b/src/seqtk/seqtk_subseq/test_data/reg.bed
index 137ed6c1..af33d0a5 100644
--- a/src/seqtk/seqtk_subseq/test_data/reg.bed
+++ b/src/seqtk/seqtk_subseq/test_data/reg.bed
@@ -1,3 +1,3 @@
-KU562861.1	10	20
-MH150936.1	10	20
+KU562861.1	10	20	region	0	+
+MH150936.1	10	20	region	0	-
 

From 0059ede599f2dc8a0995789a532bf6e79bd4f6ec Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Wed, 17 Jul 2024 17:11:24 -0300
Subject: [PATCH 16/28] Input validation for list file

- input validation for name_list parameter
---
 src/seqtk/seqtk_subseq/script.sh           | 79 +++++++++++++++++++++-
 src/seqtk/seqtk_subseq/test_data/script.sh | 13 ----
 2 files changed, 77 insertions(+), 15 deletions(-)
 delete mode 100644 src/seqtk/seqtk_subseq/test_data/script.sh

diff --git a/src/seqtk/seqtk_subseq/script.sh b/src/seqtk/seqtk_subseq/script.sh
index 3abf5f2d..d07e1a02 100644
--- a/src/seqtk/seqtk_subseq/script.sh
+++ b/src/seqtk/seqtk_subseq/script.sh
@@ -2,11 +2,86 @@
 
 ## VIASH START
 ## VIASH END
+
+# Function to check if a file is a valid BED file
+check_bed_file() {
+    local file="$1"
+    num_columns=$(head -n 1 "$file" | cut -f 1- | tr '\t' '\n' | wc -l)
+
+    # Check if the file exists
+    if [[ ! -f "$file" ]]; then
+        echo "Error: The specified file does not exist."
+        return 1
+    fi
+
+    # Check if the file is non-empty
+    if [[ ! -s "$file" ]]; then
+        echo "Error: The specified file is empty."
+        return 1
+    fi
+
+    # Check if the file is a valid BED file (minimum 3 tab-separated columns)
+    if [[ $num_columns -lt 3 ]]; then
+        echo "The specified file is not a valid BED file. It should have at least three tab-separated columns."
+        return 1
+    fi
+
+    # Additional check: Ensure that the 6th column (if present) is either + or -
+    if [[ $num_columns -eq 6 ]]; then
+        while IFS=$'\t' read -r -a columns; do
+            columns[5]=${columns[5]%$'\n'}
+            if [[ ${columns[5]} == "+" || ${columns[5]} == "-" ]]; then
+                return 0
+            else 
+                echo "Error: The 6th column of the specified BED file should be either + or -."
+                echo "Offending line: ${columns[5]}"
+                return 1
+            fi
+        done < "$file"
+    fi
+
+    return 0
+}
+
+# Function to check if a file is a valid list of FASTA file IDs
+check_fasta_id_list() {
+    local file="$1"
+
+    # Check if the file exists
+    if [[ ! -f "$file" ]]; then
+        echo "Error: The specified file does not exist."
+        return 1
+    fi
+
+    # Check if the file is non-empty
+    if [[ ! -s "$file" ]]; then
+        echo "Error: The specified file is empty."
+        return 1
+    fi
+
+    # Additional check: Ensure that each line contains only one word (FASTA ID)
+    if ! awk 'NF != 1 { exit 1 }' "$file"; then
+        return 1
+    fi
+
+    return 0
+}
+
+# Check if the par_name_list is given and validate accordingly
+if [[ -n "$par_name_list" ]]; then
+    if check_fasta_id_list "$par_name_list"; then
+        echo "The specified file is a valid list of FASTA IDs."
+    elif check_bed_file "$par_name_list"; then
+        echo "The specified file is a valid BED file."
+    else
+        echo "Error: The specified file is neither a valid BED file nor a valid list of FASTA IDs."
+        exit 1
+    fi
+fi
+
 [[ "$par_tab" == "false" ]] && unset par_tab
 [[ "$par_strand_aware" == "false" ]] && unset par_strand_aware
 
-# Todo: if a bed file is given, check if format is valid! + - should be in six column
-
 seqtk subseq \
     ${par_tab:+-t} \
     ${par_strand_aware:+-s} \
diff --git a/src/seqtk/seqtk_subseq/test_data/script.sh b/src/seqtk/seqtk_subseq/test_data/script.sh
deleted file mode 100644
index b2d825f5..00000000
--- a/src/seqtk/seqtk_subseq/test_data/script.sh
+++ /dev/null
@@ -1,13 +0,0 @@
-# clone repo
-if [ ! -d /tmp/snakemake-wrappers ]; then
-  git clone --depth 1 --single-branch --branch master https://github.com/snakemake/snakemake-wrappers /tmp/snakemake-wrappers
-fi
-
-# copy test data
-cp -r /tmp/snakemake-wrappers/bio/seqtk/test/reads/* src/seqtk/seqtk_subseq/test_data
-
-# remove a.fastq file
-rm src/seqtk/seqtk_subseq/test_data/a.fastq
-
-# unzip fastq files
-gunzip src/seqtk/seqtk_subseq/test_data/*.gz

From aab5679b3bbc21ec9bcb8af6cce77d72414d87ac Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Wed, 17 Jul 2024 20:15:53 -0300
Subject: [PATCH 17/28] Sugested Changes

- removed test_data dir
- removed input validation
---
 src/seqtk/seqtk_subseq/config.vsh.yaml       |  2 -
 src/seqtk/seqtk_subseq/script.sh             | 76 --------------------
 src/seqtk/seqtk_subseq/test.sh               | 62 ++++++++++++----
 src/seqtk/seqtk_subseq/test_data/id.list     |  2 -
 src/seqtk/seqtk_subseq/test_data/input.fasta | 15 ----
 src/seqtk/seqtk_subseq/test_data/reg.bed     |  3 -
 6 files changed, 48 insertions(+), 112 deletions(-)
 delete mode 100644 src/seqtk/seqtk_subseq/test_data/id.list
 delete mode 100644 src/seqtk/seqtk_subseq/test_data/input.fasta
 delete mode 100644 src/seqtk/seqtk_subseq/test_data/reg.bed

diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
index a732af2b..d11915d4 100644
--- a/src/seqtk/seqtk_subseq/config.vsh.yaml
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -60,8 +60,6 @@ resources:
 test_resources:
   - type: bash_script
     path: test.sh
-  - type: file
-    path: test_data
 
 engines:
   - type: docker
diff --git a/src/seqtk/seqtk_subseq/script.sh b/src/seqtk/seqtk_subseq/script.sh
index d07e1a02..7073937f 100644
--- a/src/seqtk/seqtk_subseq/script.sh
+++ b/src/seqtk/seqtk_subseq/script.sh
@@ -3,82 +3,6 @@
 ## VIASH START
 ## VIASH END
 
-# Function to check if a file is a valid BED file
-check_bed_file() {
-    local file="$1"
-    num_columns=$(head -n 1 "$file" | cut -f 1- | tr '\t' '\n' | wc -l)
-
-    # Check if the file exists
-    if [[ ! -f "$file" ]]; then
-        echo "Error: The specified file does not exist."
-        return 1
-    fi
-
-    # Check if the file is non-empty
-    if [[ ! -s "$file" ]]; then
-        echo "Error: The specified file is empty."
-        return 1
-    fi
-
-    # Check if the file is a valid BED file (minimum 3 tab-separated columns)
-    if [[ $num_columns -lt 3 ]]; then
-        echo "The specified file is not a valid BED file. It should have at least three tab-separated columns."
-        return 1
-    fi
-
-    # Additional check: Ensure that the 6th column (if present) is either + or -
-    if [[ $num_columns -eq 6 ]]; then
-        while IFS=$'\t' read -r -a columns; do
-            columns[5]=${columns[5]%$'\n'}
-            if [[ ${columns[5]} == "+" || ${columns[5]} == "-" ]]; then
-                return 0
-            else 
-                echo "Error: The 6th column of the specified BED file should be either + or -."
-                echo "Offending line: ${columns[5]}"
-                return 1
-            fi
-        done < "$file"
-    fi
-
-    return 0
-}
-
-# Function to check if a file is a valid list of FASTA file IDs
-check_fasta_id_list() {
-    local file="$1"
-
-    # Check if the file exists
-    if [[ ! -f "$file" ]]; then
-        echo "Error: The specified file does not exist."
-        return 1
-    fi
-
-    # Check if the file is non-empty
-    if [[ ! -s "$file" ]]; then
-        echo "Error: The specified file is empty."
-        return 1
-    fi
-
-    # Additional check: Ensure that each line contains only one word (FASTA ID)
-    if ! awk 'NF != 1 { exit 1 }' "$file"; then
-        return 1
-    fi
-
-    return 0
-}
-
-# Check if the par_name_list is given and validate accordingly
-if [[ -n "$par_name_list" ]]; then
-    if check_fasta_id_list "$par_name_list"; then
-        echo "The specified file is a valid list of FASTA IDs."
-    elif check_bed_file "$par_name_list"; then
-        echo "The specified file is a valid BED file."
-    else
-        echo "Error: The specified file is neither a valid BED file nor a valid list of FASTA IDs."
-        exit 1
-    fi
-fi
-
 [[ "$par_tab" == "false" ]] && unset par_tab
 [[ "$par_strand_aware" == "false" ]] && unset par_strand_aware
 
diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index 95c8a19f..34a07d89 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -8,10 +8,44 @@ meta_executable="target/executable/seqtk/seqtk_subseq"
 meta_resources_dir="src/seqtk"
 ## VIASH END
 
-# TODO:
-# - Fix Tab option test
-# - Add strand aware test (create new fasta file with right configuration)
-
+# Create directories for tests
+echo "Creating Test Data..."
+mkdir test_data
+
+# Create and populate input.fasta
+cat <<EOL > "test_data/input.fasta"
+>KU562861.1
+GGAGCAGGAGAGTGTTCGAGTTCAGAGATGTCCATGGCGCCGTACGAGAAGGTGATGGATGACCTGGCCA
+AGGGGCAGCAGTTCGCGACGCAGCTGCAGGGCCTCCTCCGGGACTCCCCCAAGGCCGGCCACATCATGGA
+>GU056837.1
+CTAATTTTATTTTTTTATAATAATTATTGGAGGAACTAAAACATTAATGAAATAATAATTATCATAATTA
+TTAATTACATATTTATTAGGTATAATATTTAAGGAAAAATATATTTTATGTTAATTGTAATAATTAGAAC
+>CP097510.1
+CGATTTAGATCGGTGTAGTCAACACACATCCTCCACTTCCATTAGGCTTCTTGACGAGGACTACATTGAC
+AGCCACCGAGGGAACCGACCTCCTCAATGAAGTCAGACGCCAAGAGCCTATCAACTTCCTTCTGCACAGC
+>JAMFTS010000002.1
+CCTAAACCCTAAACCCTAAACCCCCTACAAACCTTACCCTAAACCCTAAACCCTAAACCCTAAACCCTAA
+ACCCGAAACCCTATACCCTAAACCCTAAACCCTAAACCCTAAACCCTAACCCAAACCTAATCCCTAAACC
+>MH150936.1
+TAGAAGCTAATGAAAACTTTTCCTTTACTAAAAACCGTCAAACACGGTAAGAAACGCTTTTAATCATTTC
+AAAAGCAATCCCAATAGTGGTTACATCCAAACAAAACCCATTTCTTATATTTTCTCAAAAACAGTGAGAG
+EOL
+
+# Update id.list with new entries
+cat <<EOL > "test_data/id.list"
+KU562861.1
+MH150936.1
+EOL
+
+# Create and populate reg.bed
+cat <<EOL > "test_data/reg.bed"
+KU562861.1$(echo -e "\t")10$(echo -e "\t")20$(echo -e "\t")region$(echo -e "\t")0$(echo -e "\t")+$(echo -e "\n")
+MH150936.1$(echo -e "\t")10$(echo -e "\t")20$(echo -e "\t")region$(echo -e "\t")0$(echo -e "\t")-
+EOL
+
+cd test_data
+cat reg.bed
+cd ..
 #########################################################################################
 # Run basic test
 mkdir test1
@@ -19,8 +53,8 @@ cd test1
 
 echo "> Run seqtk_subseq on FASTA/Q file"
 "$meta_executable" \
-  --input "$meta_resources_dir/test_data/input.fasta" \
-  --name_list "$meta_resources_dir/test_data/id.list" \
+  --input "../test_data/input.fasta" \
+  --name_list "../test_data/id.list" \
   --output "sub_sample.fq"
 
 expected_output_basic=">KU562861.1
@@ -47,8 +81,8 @@ cd test2
 
 echo "> Run seqtk_subseq on FASTA/Q file with BED file as name list"
 "$meta_executable" \
-  --input "$meta_resources_dir/test_data/input.fasta" \
-  --name_list "$meta_resources_dir/test_data/reg.bed" \
+  --input "../test_data/input.fasta" \
+  --name_list "../test_data/reg.bed" \
   --output "sub_sample.fq"
 
 expected_output_basic=">KU562861.1:11-20
@@ -76,8 +110,8 @@ cd test3
 echo "> Run seqtk_subseq with TAB option"
 "$meta_executable" \
   --tab \
-  --input "$meta_resources_dir/test_data/input.fasta" \
-  --name_list "$meta_resources_dir/test_data/reg.bed" \
+  --input "../test_data/input.fasta" \
+  --name_list "../test_data/reg.bed" \
   --output "sub_sample.fq"
 
 expected_output_tabular=$'KU562861.1\t11\tAGTGTTCGAG\nMH150936.1\t11\tTGAAAACTTT'
@@ -102,8 +136,8 @@ cd test4
 echo "> Run seqtk_subseq with line length option"
 "$meta_executable" \
   --sequence_line_length 5 \
-  --input "$meta_resources_dir/test_data/input.fasta" \
-  --name_list "$meta_resources_dir/test_data/reg.bed" \
+  --input "../test_data/input.fasta" \
+  --name_list "../test_data/reg.bed" \
   --output "sub_sample.fq"
 
 expected_output_wrapped=">KU562861.1:11-20
@@ -133,8 +167,8 @@ cd test5
 echo "> Run seqtk_subseq with strand aware option"
 "$meta_executable" \
   --strand_aware \
-  --input "$meta_resources_dir/test_data/input.fasta" \
-  --name_list "$meta_resources_dir/test_data/reg.bed" \
+  --input "../test_data/input.fasta" \
+  --name_list "../test_data/reg.bed" \
   --output "sub_sample.fq"
 
 expected_output_wrapped=">KU562861.1:11-20
diff --git a/src/seqtk/seqtk_subseq/test_data/id.list b/src/seqtk/seqtk_subseq/test_data/id.list
deleted file mode 100644
index 3071abfc..00000000
--- a/src/seqtk/seqtk_subseq/test_data/id.list
+++ /dev/null
@@ -1,2 +0,0 @@
-KU562861.1
-MH150936.1
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/test_data/input.fasta b/src/seqtk/seqtk_subseq/test_data/input.fasta
deleted file mode 100644
index ea35c1f3..00000000
--- a/src/seqtk/seqtk_subseq/test_data/input.fasta
+++ /dev/null
@@ -1,15 +0,0 @@
->KU562861.1
-GGAGCAGGAGAGTGTTCGAGTTCAGAGATGTCCATGGCGCCGTACGAGAAGGTGATGGATGACCTGGCCA
-AGGGGCAGCAGTTCGCGACGCAGCTGCAGGGCCTCCTCCGGGACTCCCCCAAGGCCGGCCACATCATGGA
->GU056837.1
-CTAATTTTATTTTTTTATAATAATTATTGGAGGAACTAAAACATTAATGAAATAATAATTATCATAATTA
-TTAATTACATATTTATTAGGTATAATATTTAAGGAAAAATATATTTTATGTTAATTGTAATAATTAGAAC
->CP097510.1
-CGATTTAGATCGGTGTAGTCAACACACATCCTCCACTTCCATTAGGCTTCTTGACGAGGACTACATTGAC
-AGCCACCGAGGGAACCGACCTCCTCAATGAAGTCAGACGCCAAGAGCCTATCAACTTCCTTCTGCACAGC
->JAMFTS010000002.1
-CCTAAACCCTAAACCCTAAACCCCCTACAAACCTTACCCTAAACCCTAAACCCTAAACCCTAAACCCTAA
-ACCCGAAACCCTATACCCTAAACCCTAAACCCTAAACCCTAAACCCTAACCCAAACCTAATCCCTAAACC
->MH150936.1
-TAGAAGCTAATGAAAACTTTTCCTTTACTAAAAACCGTCAAACACGGTAAGAAACGCTTTTAATCATTTC
-AAAAGCAATCCCAATAGTGGTTACATCCAAACAAAACCCATTTCTTATATTTTCTCAAAAACAGTGAGAG
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/test_data/reg.bed b/src/seqtk/seqtk_subseq/test_data/reg.bed
deleted file mode 100644
index af33d0a5..00000000
--- a/src/seqtk/seqtk_subseq/test_data/reg.bed
+++ /dev/null
@@ -1,3 +0,0 @@
-KU562861.1	10	20	region	0	+
-MH150936.1	10	20	region	0	-
-

From 32c084df8ec16116b31cb0f39b2d4ea86c010bfb Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Wed, 17 Jul 2024 20:25:49 -0300
Subject: [PATCH 18/28] Added author info

---
 src/_authors/theodoro_gasperin.yaml    | 10 ++++++++++
 src/seqtk/seqtk_subseq/config.vsh.yaml |  3 +++
 src/seqtk/seqtk_subseq/test.sh         |  3 ---
 3 files changed, 13 insertions(+), 3 deletions(-)
 create mode 100644 src/_authors/theodoro_gasperin.yaml

diff --git a/src/_authors/theodoro_gasperin.yaml b/src/_authors/theodoro_gasperin.yaml
new file mode 100644
index 00000000..899ce180
--- /dev/null
+++ b/src/_authors/theodoro_gasperin.yaml
@@ -0,0 +1,10 @@
+name: Theodoro Gasperin Terra Camargo
+info:
+  links:
+    email: theodorogtc@gmail.com
+    github: tgaspe
+    linkedin: theodoro-gasperin-terra-camargo
+  organizations:
+    - name: Data Intuitive
+      href: https://www.data-intuitive.com
+      role: Bioinformatician
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
index d11915d4..2f19f05b 100644
--- a/src/seqtk/seqtk_subseq/config.vsh.yaml
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -6,6 +6,9 @@ keywords: [subseq, FASTA, FASTQ]
 links:
   repository: https://github.com/lh3/seqtk/tree/v1.4
 license: MIT
+authors:
+  - __merge__: /src/_authors/theodoro_gasperin.yaml
+    roles: [ author, maintainer ]
 
 argument_groups:
   - name: Inputs
diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index 34a07d89..e13da48d 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -43,9 +43,6 @@ KU562861.1$(echo -e "\t")10$(echo -e "\t")20$(echo -e "\t")region$(echo -e "\t")
 MH150936.1$(echo -e "\t")10$(echo -e "\t")20$(echo -e "\t")region$(echo -e "\t")0$(echo -e "\t")-
 EOL
 
-cd test_data
-cat reg.bed
-cd ..
 #########################################################################################
 # Run basic test
 mkdir test1

From a84277769718535c91ad6ab3122f0361a979ae30 Mon Sep 17 00:00:00 2001
From: Robrecht Cannoodt <rcannood@gmail.com>
Date: Thu, 18 Jul 2024 07:54:35 +0200
Subject: [PATCH 19/28] Update CHANGELOG.md

---
 CHANGELOG.md | 5 +----
 1 file changed, 1 insertion(+), 4 deletions(-)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 8056c024..d6256e72 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -95,11 +95,8 @@
     - `samtools/samtools_fastq`: Converts a SAM/BAM/CRAM file to FASTQ (PR #52).
     - `samtools/samtools_fastq`: Converts a SAM/BAM/CRAM file to FASTA (PR #53).
 
-
 * `falco`: A C++ drop-in replacement of FastQC to assess the quality of sequence read data (PR #43).
 
-* `seqtk/seqtk_sample`: Sample sequences from FASTA/Q(.gz) files to FASTA/Q (PR #68).
-
 * `bedtools`:
     - `bedtools_getfasta`: extract sequences from a FASTA file for each of the
                            intervals defined in a BED/GFF/VCF file (PR #59).
@@ -124,4 +121,4 @@
 
 * Add escaping character before leading hashtag in the description field of the config file (PR #50).
 
-* Format URL in biobase/bcl_convert description (PR #55).
\ No newline at end of file
+* Format URL in biobase/bcl_convert description (PR #55).

From 819bd9bb731fb4834a2815215b743ed543d84d3d Mon Sep 17 00:00:00 2001
From: Robrecht Cannoodt <rcannood@gmail.com>
Date: Thu, 18 Jul 2024 07:55:03 +0200
Subject: [PATCH 20/28] Update theodoro_gasperin.yaml

---
 src/_authors/theodoro_gasperin.yaml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/src/_authors/theodoro_gasperin.yaml b/src/_authors/theodoro_gasperin.yaml
index 899ce180..47af96a9 100644
--- a/src/_authors/theodoro_gasperin.yaml
+++ b/src/_authors/theodoro_gasperin.yaml
@@ -7,4 +7,4 @@ info:
   organizations:
     - name: Data Intuitive
       href: https://www.data-intuitive.com
-      role: Bioinformatician
\ No newline at end of file
+      role: Bioinformatician

From d05cbf0c4a125e9fc4a2373c2a703c5569118f58 Mon Sep 17 00:00:00 2001
From: Robrecht Cannoodt <rcannood@gmail.com>
Date: Thu, 18 Jul 2024 07:59:16 +0200
Subject: [PATCH 21/28] add newline

---
 src/seqtk/seqtk_subseq/script.sh | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/src/seqtk/seqtk_subseq/script.sh b/src/seqtk/seqtk_subseq/script.sh
index 7073937f..0aceaf29 100644
--- a/src/seqtk/seqtk_subseq/script.sh
+++ b/src/seqtk/seqtk_subseq/script.sh
@@ -12,4 +12,4 @@ seqtk subseq \
     ${par_sequence_line_length:+-l "$par_sequence_line_length"} \
     "$par_input" \
     "$par_name_list" \
-    > "$par_output"
\ No newline at end of file
+    > "$par_output"

From c22b383c2508cf7ace18eb977ef5188cc456ccbe Mon Sep 17 00:00:00 2001
From: Robrecht Cannoodt <rcannood@gmail.com>
Date: Thu, 18 Jul 2024 07:59:47 +0200
Subject: [PATCH 22/28] add newline

---
 src/seqtk/seqtk_subseq/test.sh | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index e13da48d..4f73e1e8 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -182,4 +182,4 @@ else
   echo "$expected_output_wrapped"
   echo "Got:"
   echo "$output_wrapped"
-fi
\ No newline at end of file
+fi

From dfc0a6559e1eb43cfa45ef51b55549ff090b9f00 Mon Sep 17 00:00:00 2001
From: Theodoro Gasperin Terra Camargo
 <98555209+tgaspe@users.noreply.github.com>
Date: Thu, 18 Jul 2024 09:32:19 -0300
Subject: [PATCH 23/28] Update src/seqtk/seqtk_subseq/config.vsh.yaml

Co-authored-by: Robrecht Cannoodt <rcannood@gmail.com>
---
 src/seqtk/seqtk_subseq/config.vsh.yaml | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
index 2f19f05b..d2dd223c 100644
--- a/src/seqtk/seqtk_subseq/config.vsh.yaml
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -53,8 +53,8 @@ argument_groups:
       - name: "--sequence_line_length"
         alternatives: -l
         type: integer
-        description: Sequence line length of input fasta file.
-        example: 16
+        description: Sequence line length of input fasta file. Default: 0.
+        example: 0
         
 
 resources:

From 0e9060af16b9887b9818428174c4ea5caffd52e7 Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Thu, 18 Jul 2024 09:49:08 -0300
Subject: [PATCH 24/28] Version Fix

---
 src/seqtk/seqtk_subseq/config.vsh.yaml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
index 2f19f05b..f85ca250 100644
--- a/src/seqtk/seqtk_subseq/config.vsh.yaml
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -70,7 +70,7 @@ engines:
     setup:
       - type: docker
         run: |
-          echo "seqtk version: 1.4 (r122)" > /var/software_versions.txt
+          echo $(echo $(seqtk 2>&1) | sed -n 's/.*\(Version: [^ ]*\).*/\1/p') > /var/software_versions.txt
 
 runners:
   - type: executable

From 3a27502126b105ba9144f007f38a81140318eae5 Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Thu, 18 Jul 2024 09:54:27 -0300
Subject: [PATCH 25/28] Update on config

---
 src/seqtk/seqtk_subseq/config.vsh.yaml | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
index 48059436..1c2e8c08 100644
--- a/src/seqtk/seqtk_subseq/config.vsh.yaml
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -53,7 +53,8 @@ argument_groups:
       - name: "--sequence_line_length"
         alternatives: -l
         type: integer
-        description: Sequence line length of input fasta file. Default: 0.
+        description: | 
+          Sequence line length of input fasta file. Default: 0.
         example: 0
         
 

From d00c94417950bd8c047fe13b966b9292df97f102 Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Thu, 18 Jul 2024 10:50:38 -0300
Subject: [PATCH 26/28] Helper bed.sh

---
 src/seqtk/src/_helpers/bed.sh | 80 +++++++++++++++++++++++++++++++++++
 1 file changed, 80 insertions(+)
 create mode 100644 src/seqtk/src/_helpers/bed.sh

diff --git a/src/seqtk/src/_helpers/bed.sh b/src/seqtk/src/_helpers/bed.sh
new file mode 100644
index 00000000..56fa9f0f
--- /dev/null
+++ b/src/seqtk/src/_helpers/bed.sh
@@ -0,0 +1,80 @@
+#!/bin/bash
+
+# Function to check if a file is a valid BED file
+check_bed_file() {
+    local file="$1"
+    num_columns=$(head -n 1 "$file" | cut -f 1- | tr '\t' '\n' | wc -l)
+
+    # Check if the file exists
+    if [[ ! -f "$file" ]]; then
+        echo "Error: The specified file does not exist."
+        return 1
+    fi
+
+    # Check if the file is non-empty
+    if [[ ! -s "$file" ]]; then
+        echo "Error: The specified file is empty."
+        return 1
+    fi
+
+    # Check if the file is a valid BED file (minimum 3 tab-separated columns)
+    if [[ $num_columns -lt 3 ]]; then
+        echo "The specified file is not a valid BED file. It should have at least three tab-separated columns."
+        return 1
+    fi
+
+    # Additional check: Ensure that the 6th column (if present) is either + or -
+    if [[ $num_columns -eq 6 ]]; then
+        while IFS=$'\t' read -r -a columns; do
+            columns[5]=${columns[5]%$'\n'}
+            if [[ ${columns[5]} == "+" || ${columns[5]} == "-" ]]; then
+                return 0
+            else 
+                echo "Error: The 6th column of the specified BED file should be either + or -."
+                #echo "Offending line: ${columns[5]}"
+                return 1
+            fi
+        done < "$file"
+    fi
+
+    return 0
+}
+
+# Function to check if a file is a valid list of FASTA file IDs
+check_fasta_id_list() {
+    local file="$1"
+
+    # Check if the file exists
+    if [[ ! -f "$file" ]]; then
+        echo "Error: The specified file does not exist."
+        return 1
+    fi
+
+    # Check if the file is non-empty
+    if [[ ! -s "$file" ]]; then
+        echo "Error: The specified file is empty."
+        return 1
+    fi
+
+    # Additional check: Ensure that each line contains only one word (FASTA ID)
+    if ! awk 'NF != 1 { exit 1 }' "$file"; then
+        return 1
+    fi
+
+    return 0
+}
+
+# Arguments:
+list_file="$1"
+
+# Check if the par_name_list is given and validate accordingly
+if [[ -n "$list_file" ]]; then
+    if check_fasta_id_list "$list_file"; then
+        echo "The specified file is a valid list of FASTA IDs."
+    elif check_bed_file "$list_file"; then
+        echo "The specified file is a valid BED file."
+    else
+        echo "Error: The specified file is neither a valid BED file nor a valid list of FASTA IDs."
+        exit 1
+    fi
+fi
\ No newline at end of file

From a276b9ec1431f11e1e752d7af4ca90b9a1503946 Mon Sep 17 00:00:00 2001
From: tgaspe <theodorogtc@gmail.com>
Date: Thu, 18 Jul 2024 15:00:26 -0300
Subject: [PATCH 27/28] Deleted _helpers

---
 src/seqtk/src/_helpers/bed.sh | 80 -----------------------------------
 1 file changed, 80 deletions(-)
 delete mode 100644 src/seqtk/src/_helpers/bed.sh

diff --git a/src/seqtk/src/_helpers/bed.sh b/src/seqtk/src/_helpers/bed.sh
deleted file mode 100644
index 56fa9f0f..00000000
--- a/src/seqtk/src/_helpers/bed.sh
+++ /dev/null
@@ -1,80 +0,0 @@
-#!/bin/bash
-
-# Function to check if a file is a valid BED file
-check_bed_file() {
-    local file="$1"
-    num_columns=$(head -n 1 "$file" | cut -f 1- | tr '\t' '\n' | wc -l)
-
-    # Check if the file exists
-    if [[ ! -f "$file" ]]; then
-        echo "Error: The specified file does not exist."
-        return 1
-    fi
-
-    # Check if the file is non-empty
-    if [[ ! -s "$file" ]]; then
-        echo "Error: The specified file is empty."
-        return 1
-    fi
-
-    # Check if the file is a valid BED file (minimum 3 tab-separated columns)
-    if [[ $num_columns -lt 3 ]]; then
-        echo "The specified file is not a valid BED file. It should have at least three tab-separated columns."
-        return 1
-    fi
-
-    # Additional check: Ensure that the 6th column (if present) is either + or -
-    if [[ $num_columns -eq 6 ]]; then
-        while IFS=$'\t' read -r -a columns; do
-            columns[5]=${columns[5]%$'\n'}
-            if [[ ${columns[5]} == "+" || ${columns[5]} == "-" ]]; then
-                return 0
-            else 
-                echo "Error: The 6th column of the specified BED file should be either + or -."
-                #echo "Offending line: ${columns[5]}"
-                return 1
-            fi
-        done < "$file"
-    fi
-
-    return 0
-}
-
-# Function to check if a file is a valid list of FASTA file IDs
-check_fasta_id_list() {
-    local file="$1"
-
-    # Check if the file exists
-    if [[ ! -f "$file" ]]; then
-        echo "Error: The specified file does not exist."
-        return 1
-    fi
-
-    # Check if the file is non-empty
-    if [[ ! -s "$file" ]]; then
-        echo "Error: The specified file is empty."
-        return 1
-    fi
-
-    # Additional check: Ensure that each line contains only one word (FASTA ID)
-    if ! awk 'NF != 1 { exit 1 }' "$file"; then
-        return 1
-    fi
-
-    return 0
-}
-
-# Arguments:
-list_file="$1"
-
-# Check if the par_name_list is given and validate accordingly
-if [[ -n "$list_file" ]]; then
-    if check_fasta_id_list "$list_file"; then
-        echo "The specified file is a valid list of FASTA IDs."
-    elif check_bed_file "$list_file"; then
-        echo "The specified file is a valid BED file."
-    else
-        echo "Error: The specified file is neither a valid BED file nor a valid list of FASTA IDs."
-        exit 1
-    fi
-fi
\ No newline at end of file

From 590e1386deed5b9380091f61509e18adaa6ce453 Mon Sep 17 00:00:00 2001
From: Robrecht Cannoodt <rcannood@gmail.com>
Date: Thu, 18 Jul 2024 22:15:58 +0200
Subject: [PATCH 28/28] don't forget exit when a test fails

---
 src/seqtk/seqtk_subseq/test.sh | 33 +++++++++++++++------------------
 1 file changed, 15 insertions(+), 18 deletions(-)

diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
index 4f73e1e8..f19cfa4a 100644
--- a/src/seqtk/seqtk_subseq/test.sh
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -13,7 +13,7 @@ echo "Creating Test Data..."
 mkdir test_data
 
 # Create and populate input.fasta
-cat <<EOL > "test_data/input.fasta"
+cat > "test_data/input.fasta" <<EOL
 >KU562861.1
 GGAGCAGGAGAGTGTTCGAGTTCAGAGATGTCCATGGCGCCGTACGAGAAGGTGATGGATGACCTGGCCA
 AGGGGCAGCAGTTCGCGACGCAGCTGCAGGGCCTCCTCCGGGACTCCCCCAAGGCCGGCCACATCATGGA
@@ -32,13 +32,13 @@ AAAAGCAATCCCAATAGTGGTTACATCCAAACAAAACCCATTTCTTATATTTTCTCAAAAACAGTGAGAG
 EOL
 
 # Update id.list with new entries
-cat <<EOL > "test_data/id.list"
+cat > "test_data/id.list" <<EOL
 KU562861.1
 MH150936.1
 EOL
 
 # Create and populate reg.bed
-cat <<EOL > "test_data/reg.bed"
+cat > "test_data/reg.bed" <<EOL
 KU562861.1$(echo -e "\t")10$(echo -e "\t")20$(echo -e "\t")region$(echo -e "\t")0$(echo -e "\t")+$(echo -e "\n")
 MH150936.1$(echo -e "\t")10$(echo -e "\t")20$(echo -e "\t")region$(echo -e "\t")0$(echo -e "\t")-
 EOL
@@ -60,14 +60,13 @@ GGAGCAGGAGAGTGTTCGAGTTCAGAGATGTCCATGGCGCCGTACGAGAAGGTGATGGATGACCTGGCCAAGGGGCAGCA
 TAGAAGCTAATGAAAACTTTTCCTTTACTAAAAACCGTCAAACACGGTAAGAAACGCTTTTAATCATTTCAAAAGCAATCCCAATAGTGGTTACATCCAAACAAAACCCATTTCTTATATTTTCTCAAAAACAGTGAGAG"
 output_basic=$(cat sub_sample.fq)
 
-if [ "$output_basic" == "$expected_output_basic" ]; then
-  echo "Test passed"
-else
+if [ "$output_basic" != "$expected_output_basic" ]; then
   echo "Test failed"
   echo "Expected:"
   echo "$expected_output_basic"
   echo "Got:"
   echo "$output_basic"
+  exit 1
 fi
 
 #########################################################################################
@@ -88,14 +87,13 @@ AGTGTTCGAG
 TGAAAACTTT"
 output_basic=$(cat sub_sample.fq)
 
-if [ "$output_basic" == "$expected_output_basic" ]; then
-  echo "Test passed"
-else
+if [ "$output_basic" != "$expected_output_basic" ]; then
   echo "Test failed"
   echo "Expected:"
   echo "$expected_output_basic"
   echo "Got:"
   echo "$output_basic"
+  exit 1
 fi
 
 #########################################################################################
@@ -114,14 +112,13 @@ echo "> Run seqtk_subseq with TAB option"
 expected_output_tabular=$'KU562861.1\t11\tAGTGTTCGAG\nMH150936.1\t11\tTGAAAACTTT'
 output_tabular=$(cat sub_sample.fq)
 
-if [ "$output_tabular" == "$expected_output_tabular" ]; then
-  echo "Test passed"
-else
+if [ "$output_tabular" != "$expected_output_tabular" ]; then
   echo "Test failed"
   echo "Expected:"
   echo "$expected_output_tabular"
   echo "Got:"
   echo "$output_tabular"
+  exit 1
 fi
 
 #########################################################################################
@@ -145,14 +142,13 @@ TGAAA
 ACTTT"
 output_wrapped=$(cat sub_sample.fq)
 
-if [ "$output_wrapped" == "$expected_output_wrapped" ]; then
-  echo "Test passed"
-else
+if [ "$output_wrapped" != "$expected_output_wrapped" ]; then
   echo "Test failed"
   echo "Expected:"
   echo "$expected_output_wrapped"
   echo "Got:"
   echo "$output_wrapped"
+  exit 1
 fi
 
 #########################################################################################
@@ -174,12 +170,13 @@ AGTGTTCGAG
 AAAGTTTTCA"
 output_wrapped=$(cat sub_sample.fq)
 
-if [ "$output_wrapped" == "$expected_output_wrapped" ]; then
-  echo "Test passed"
-else
+if [ "$output_wrapped" != "$expected_output_wrapped" ]; then
   echo "Test failed"
   echo "Expected:"
   echo "$expected_output_wrapped"
   echo "Got:"
   echo "$output_wrapped"
+  exit 1
 fi
+
+echo "All tests succeeded!"