diff --git a/CHANGELOG.md b/CHANGELOG.md
index 4e6a0369..d6256e72 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -2,9 +2,16 @@
 
 ## NEW FEATURES
 
-* `bd_rhapsody`:
+* `bd_rhapsody/bd_rhapsody_make_reference`: Create a reference for the BD Rhapsody pipeline (PR #75).
 
-  - `bd_rhapsody/bd_rhapsody_make_reference`: Create a reference for the BD Rhapsody pipeline (PR #75).
+* `umitools/umitools_dedup`: Deduplicate reads based on the mapping co-ordinate and the UMI attached to the read (PR #54).
+
+* `seqtk`:
+  - `seqtk/seqtk_sample`: Subsamples sequences from FASTA/Q files (PR #68).
+  - `seqtk/seqtk_subseq`: Extract the sequences (complete or subsequence) from the FASTA/FASTQ files
+                based on a provided sequence IDs or region coordinates file (PR #85).
+
+* `agat/agat_convert_sp_gff2gtf`: convert any GTF/GFF file into a proper GTF file (PR #76).
 
 ## MINOR CHANGES
 
@@ -38,14 +45,8 @@
 
 * `multiqc`: update multiple separator to `;` (PR #81).
 
-# biobox 0.1.0
-
-## BREAKING CHANGES
-
-* Change default `multiple_sep` to `;` (PR #25). This aligns with an upcoming breaking change in
-  Viash 0.9.0 in order to avoid issues with the current default separator `:` unintentionally
-  splitting up certain file paths.
 
+# biobox 0.1.0
 
 ## NEW FEATURES
 
@@ -94,21 +95,12 @@
     - `samtools/samtools_fastq`: Converts a SAM/BAM/CRAM file to FASTQ (PR #52).
     - `samtools/samtools_fastq`: Converts a SAM/BAM/CRAM file to FASTA (PR #53).
 
-
 * `falco`: A C++ drop-in replacement of FastQC to assess the quality of sequence read data (PR #43).
 
-* `seqtk/seqtk_sample`: Sample sequences from FASTA/Q(.gz) files to FASTA/Q (PR #68).
-
-* `umitools`:
-    - `umitools_dedup`: Deduplicate reads based on the mapping co-ordinate and the UMI attached to the read (PR #54).
-
 * `bedtools`:
     - `bedtools_getfasta`: extract sequences from a FASTA file for each of the
                            intervals defined in a BED/GFF/VCF file (PR #59).
 
-* `agat`:
-    - `agat_convert_sp_gff2gtf`: convert any GTF/GFF file into a proper GTF file (PR #76).
-
 ## MINOR CHANGES
 
 * Uniformize component metadata (PR #23).
@@ -129,4 +121,4 @@
 
 * Add escaping character before leading hashtag in the description field of the config file (PR #50).
 
-* Format URL in biobase/bcl_convert description (PR #55).
\ No newline at end of file
+* Format URL in biobase/bcl_convert description (PR #55).
diff --git a/src/_authors/theodoro_gasperin.yaml b/src/_authors/theodoro_gasperin.yaml
new file mode 100644
index 00000000..47af96a9
--- /dev/null
+++ b/src/_authors/theodoro_gasperin.yaml
@@ -0,0 +1,10 @@
+name: Theodoro Gasperin Terra Camargo
+info:
+  links:
+    email: theodorogtc@gmail.com
+    github: tgaspe
+    linkedin: theodoro-gasperin-terra-camargo
+  organizations:
+    - name: Data Intuitive
+      href: https://www.data-intuitive.com
+      role: Bioinformatician
diff --git a/src/seqtk/seqtk_subseq/config.vsh.yaml b/src/seqtk/seqtk_subseq/config.vsh.yaml
new file mode 100644
index 00000000..1c2e8c08
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/config.vsh.yaml
@@ -0,0 +1,78 @@
+name: seqtk_subseq
+namespace: seqtk
+description: | 
+  Extract subsequences from FASTA/Q files. Takes as input a FASTA/Q file and a name.lst (sequence ids file) or a reg.bed (genomic regions file).
+keywords: [subseq, FASTA, FASTQ]
+links:
+  repository: https://github.com/lh3/seqtk/tree/v1.4
+license: MIT
+authors:
+  - __merge__: /src/_authors/theodoro_gasperin.yaml
+    roles: [ author, maintainer ]
+
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: "--input"
+        type: file
+        direction: input
+        description: The input FASTA/Q file.
+        required: true
+        example: input.fa
+        
+      - name: "--name_list"
+        type: file
+        direction: input
+        description: | 
+          List of sequence names (name.lst) or genomic regions (reg.bed) to extract.
+        required: true
+        example: list.lst
+
+  - name: Outputs
+    arguments:
+      - name: "--output"
+        alternatives: -o
+        type: file
+        direction: output
+        description: The output FASTA/Q file.
+        required: true
+        default: output.fa
+
+  - name: Options
+    arguments:
+      - name: "--tab"
+        alternatives: -t
+        type: boolean_true
+        description: TAB delimited output.
+        
+      - name: "--strand_aware"
+        alternatives: -s
+        type: boolean_true
+        description: Strand aware.
+        
+      - name: "--sequence_line_length"
+        alternatives: -l
+        type: integer
+        description: | 
+          Sequence line length of input fasta file. Default: 0.
+        example: 0
+        
+
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+
+engines:
+  - type: docker
+    image: quay.io/biocontainers/seqtk:1.4--he4a0461_2
+    setup:
+      - type: docker
+        run: |
+          echo $(echo $(seqtk 2>&1) | sed -n 's/.*\(Version: [^ ]*\).*/\1/p') > /var/software_versions.txt
+
+runners:
+  - type: executable
+  - type: nextflow
diff --git a/src/seqtk/seqtk_subseq/help.txt b/src/seqtk/seqtk_subseq/help.txt
new file mode 100644
index 00000000..5768e4ff
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/help.txt
@@ -0,0 +1,9 @@
+```bash
+seqtk subseq
+```
+Usage:   seqtk subseq [options] <in.fa> <in.bed>|<name.list>
+Options:
+  -t       TAB delimited output
+  -s       strand aware
+  -l INT   sequence line length [0]
+Note: Use 'samtools faidx' if only a few regions are intended.
\ No newline at end of file
diff --git a/src/seqtk/seqtk_subseq/script.sh b/src/seqtk/seqtk_subseq/script.sh
new file mode 100644
index 00000000..0aceaf29
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/script.sh
@@ -0,0 +1,15 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+[[ "$par_tab" == "false" ]] && unset par_tab
+[[ "$par_strand_aware" == "false" ]] && unset par_strand_aware
+
+seqtk subseq \
+    ${par_tab:+-t} \
+    ${par_strand_aware:+-s} \
+    ${par_sequence_line_length:+-l "$par_sequence_line_length"} \
+    "$par_input" \
+    "$par_name_list" \
+    > "$par_output"
diff --git a/src/seqtk/seqtk_subseq/test.sh b/src/seqtk/seqtk_subseq/test.sh
new file mode 100644
index 00000000..f19cfa4a
--- /dev/null
+++ b/src/seqtk/seqtk_subseq/test.sh
@@ -0,0 +1,182 @@
+#!/bin/bash
+
+# exit on error
+set -e
+
+## VIASH START
+meta_executable="target/executable/seqtk/seqtk_subseq"
+meta_resources_dir="src/seqtk"
+## VIASH END
+
+# Create directories for tests
+echo "Creating Test Data..."
+mkdir test_data
+
+# Create and populate input.fasta
+cat > "test_data/input.fasta" <<EOL
+>KU562861.1
+GGAGCAGGAGAGTGTTCGAGTTCAGAGATGTCCATGGCGCCGTACGAGAAGGTGATGGATGACCTGGCCA
+AGGGGCAGCAGTTCGCGACGCAGCTGCAGGGCCTCCTCCGGGACTCCCCCAAGGCCGGCCACATCATGGA
+>GU056837.1
+CTAATTTTATTTTTTTATAATAATTATTGGAGGAACTAAAACATTAATGAAATAATAATTATCATAATTA
+TTAATTACATATTTATTAGGTATAATATTTAAGGAAAAATATATTTTATGTTAATTGTAATAATTAGAAC
+>CP097510.1
+CGATTTAGATCGGTGTAGTCAACACACATCCTCCACTTCCATTAGGCTTCTTGACGAGGACTACATTGAC
+AGCCACCGAGGGAACCGACCTCCTCAATGAAGTCAGACGCCAAGAGCCTATCAACTTCCTTCTGCACAGC
+>JAMFTS010000002.1
+CCTAAACCCTAAACCCTAAACCCCCTACAAACCTTACCCTAAACCCTAAACCCTAAACCCTAAACCCTAA
+ACCCGAAACCCTATACCCTAAACCCTAAACCCTAAACCCTAAACCCTAACCCAAACCTAATCCCTAAACC
+>MH150936.1
+TAGAAGCTAATGAAAACTTTTCCTTTACTAAAAACCGTCAAACACGGTAAGAAACGCTTTTAATCATTTC
+AAAAGCAATCCCAATAGTGGTTACATCCAAACAAAACCCATTTCTTATATTTTCTCAAAAACAGTGAGAG
+EOL
+
+# Update id.list with new entries
+cat > "test_data/id.list" <<EOL
+KU562861.1
+MH150936.1
+EOL
+
+# Create and populate reg.bed
+cat > "test_data/reg.bed" <<EOL
+KU562861.1$(echo -e "\t")10$(echo -e "\t")20$(echo -e "\t")region$(echo -e "\t")0$(echo -e "\t")+$(echo -e "\n")
+MH150936.1$(echo -e "\t")10$(echo -e "\t")20$(echo -e "\t")region$(echo -e "\t")0$(echo -e "\t")-
+EOL
+
+#########################################################################################
+# Run basic test
+mkdir test1
+cd test1
+
+echo "> Run seqtk_subseq on FASTA/Q file"
+"$meta_executable" \
+  --input "../test_data/input.fasta" \
+  --name_list "../test_data/id.list" \
+  --output "sub_sample.fq"
+
+expected_output_basic=">KU562861.1
+GGAGCAGGAGAGTGTTCGAGTTCAGAGATGTCCATGGCGCCGTACGAGAAGGTGATGGATGACCTGGCCAAGGGGCAGCAGTTCGCGACGCAGCTGCAGGGCCTCCTCCGGGACTCCCCCAAGGCCGGCCACATCATGGA
+>MH150936.1
+TAGAAGCTAATGAAAACTTTTCCTTTACTAAAAACCGTCAAACACGGTAAGAAACGCTTTTAATCATTTCAAAAGCAATCCCAATAGTGGTTACATCCAAACAAAACCCATTTCTTATATTTTCTCAAAAACAGTGAGAG"
+output_basic=$(cat sub_sample.fq)
+
+if [ "$output_basic" != "$expected_output_basic" ]; then
+  echo "Test failed"
+  echo "Expected:"
+  echo "$expected_output_basic"
+  echo "Got:"
+  echo "$output_basic"
+  exit 1
+fi
+
+#########################################################################################
+# Run reg.bed as name list input test
+cd ..
+mkdir test2
+cd test2
+
+echo "> Run seqtk_subseq on FASTA/Q file with BED file as name list"
+"$meta_executable" \
+  --input "../test_data/input.fasta" \
+  --name_list "../test_data/reg.bed" \
+  --output "sub_sample.fq"
+
+expected_output_basic=">KU562861.1:11-20
+AGTGTTCGAG
+>MH150936.1:11-20
+TGAAAACTTT"
+output_basic=$(cat sub_sample.fq)
+
+if [ "$output_basic" != "$expected_output_basic" ]; then
+  echo "Test failed"
+  echo "Expected:"
+  echo "$expected_output_basic"
+  echo "Got:"
+  echo "$output_basic"
+  exit 1
+fi
+
+#########################################################################################
+# Run tab option output test
+cd ..
+mkdir test3
+cd test3
+
+echo "> Run seqtk_subseq with TAB option"
+"$meta_executable" \
+  --tab \
+  --input "../test_data/input.fasta" \
+  --name_list "../test_data/reg.bed" \
+  --output "sub_sample.fq"
+
+expected_output_tabular=$'KU562861.1\t11\tAGTGTTCGAG\nMH150936.1\t11\tTGAAAACTTT'
+output_tabular=$(cat sub_sample.fq)
+
+if [ "$output_tabular" != "$expected_output_tabular" ]; then
+  echo "Test failed"
+  echo "Expected:"
+  echo "$expected_output_tabular"
+  echo "Got:"
+  echo "$output_tabular"
+  exit 1
+fi
+
+#########################################################################################
+# Run line option output test
+cd ..
+mkdir test4
+cd test4
+
+echo "> Run seqtk_subseq with line length option"
+"$meta_executable" \
+  --sequence_line_length 5 \
+  --input "../test_data/input.fasta" \
+  --name_list "../test_data/reg.bed" \
+  --output "sub_sample.fq"
+
+expected_output_wrapped=">KU562861.1:11-20
+AGTGT
+TCGAG
+>MH150936.1:11-20
+TGAAA
+ACTTT"
+output_wrapped=$(cat sub_sample.fq)
+
+if [ "$output_wrapped" != "$expected_output_wrapped" ]; then
+  echo "Test failed"
+  echo "Expected:"
+  echo "$expected_output_wrapped"
+  echo "Got:"
+  echo "$output_wrapped"
+  exit 1
+fi
+
+#########################################################################################
+# Run Strand Aware option output test
+cd ..
+mkdir test5
+cd test5
+
+echo "> Run seqtk_subseq with strand aware option"
+"$meta_executable" \
+  --strand_aware \
+  --input "../test_data/input.fasta" \
+  --name_list "../test_data/reg.bed" \
+  --output "sub_sample.fq"
+
+expected_output_wrapped=">KU562861.1:11-20
+AGTGTTCGAG
+>MH150936.1:11-20
+AAAGTTTTCA"
+output_wrapped=$(cat sub_sample.fq)
+
+if [ "$output_wrapped" != "$expected_output_wrapped" ]; then
+  echo "Test failed"
+  echo "Expected:"
+  echo "$expected_output_wrapped"
+  echo "Got:"
+  echo "$output_wrapped"
+  exit 1
+fi
+
+echo "All tests succeeded!"