diff --git a/src/cutadapt/config.vsh.yaml b/src/cutadapt/config.vsh.yaml
new file mode 100644
index 00000000..a62f0aa9
--- /dev/null
+++ b/src/cutadapt/config.vsh.yaml
@@ -0,0 +1,463 @@
+name: cutadapt
+description: |
+  Cutadapt removes adapter sequences from high-throughput sequencing reads.
+keywords: [RNA-seq, scRNA-seq, high-throughput]
+links:
+  homepage: https://cutadapt.readthedocs.io
+  documentation: https://cutadapt.readthedocs.io
+  repository: https://github.com/marcelm/cutadapt
+references:
+  doi: 10.14806/ej.17.1.200
+license: MIT
+argument_groups:
+  ####################################################################
+  - name: Specify Adapters for R1
+    arguments:
+      - name: --adapter
+        alternatives: [-a]
+        type: string
+        multiple: true
+        description: |
+          Sequence of an adapter ligated to the 3' end (paired data:
+          of the first read). The adapter and subsequent bases are
+          trimmed. If a '$' character is appended ('anchoring'), the
+          adapter is only found if it is a suffix of the read.
+        required: false
+      - name: --front
+        alternatives: [-g]
+        type: string
+        multiple: true
+        description: |
+          Sequence of an adapter ligated to the 5' end (paired data:
+          of the first read). The adapter and any preceding bases
+          are trimmed. Partial matches at the 5' end are allowed. If
+          a '^' character is prepended ('anchoring'), the adapter is
+          only found if it is a prefix of the read.
+        required: false
+      - name: --anywhere
+        alternatives: [-b]
+        type: string
+        multiple: true
+        description: |
+          Sequence of an adapter that may be ligated to the 5' or 3'
+          end (paired data: of the first read). Both types of
+          matches as described under -a and -g are allowed. If the
+          first base of the read is part of the match, the behavior
+          is as with -g, otherwise as with -a. This option is mostly
+          for rescuing failed library preparations - do not use if
+          you know which end your adapter was ligated to!
+        required: false
+
+  ####################################################################
+  - name: Specify Adapters using Fasta files for R1
+    arguments:
+      - name: --adapter_fasta
+        type: file
+        multiple: true
+        description: |
+          Fasta file containing sequences of an adapter ligated to the 3' end (paired data:
+          of the first read). The adapter and subsequent bases are
+          trimmed. If a '$' character is appended ('anchoring'), the
+          adapter is only found if it is a suffix of the read.
+        required: false
+      - name: --front_fasta
+        type: file
+        description: |
+          Fasta file containing sequences of an adapter ligated to the 5' end (paired data:
+          of the first read). The adapter and any preceding bases
+          are trimmed. Partial matches at the 5' end are allowed. If
+          a '^' character is prepended ('anchoring'), the adapter is
+          only found if it is a prefix of the read.
+        required: false
+      - name: --anywhere_fasta
+        type: file
+        description: |
+          Fasta file containing sequences of an adapter that may be ligated to the 5' or 3'
+          end (paired data: of the first read). Both types of
+          matches as described under -a and -g are allowed. If the
+          first base of the read is part of the match, the behavior
+          is as with -g, otherwise as with -a. This option is mostly
+          for rescuing failed library preparations - do not use if
+          you know which end your adapter was ligated to!
+        required: false
+
+  ####################################################################
+  - name: Specify Adapters for R2
+    arguments:
+      - name: --adapter_r2
+        alternatives: [-A]
+        type: string
+        multiple: true
+        description: |
+          Sequence of an adapter ligated to the 3' end (paired data:
+          of the first read). The adapter and subsequent bases are
+          trimmed. If a '$' character is appended ('anchoring'), the
+          adapter is only found if it is a suffix of the read.
+        required: false
+      - name: --front_r2
+        alternatives: [-G]
+        type: string
+        multiple: true
+        description: |
+          Sequence of an adapter ligated to the 5' end (paired data:
+          of the first read). The adapter and any preceding bases
+          are trimmed. Partial matches at the 5' end are allowed. If
+          a '^' character is prepended ('anchoring'), the adapter is
+          only found if it is a prefix of the read.
+        required: false
+      - name: --anywhere_r2
+        alternatives: [-B]
+        type: string
+        multiple: true
+        description: |
+          Sequence of an adapter that may be ligated to the 5' or 3'
+          end (paired data: of the first read). Both types of
+          matches as described under -a and -g are allowed. If the
+          first base of the read is part of the match, the behavior
+          is as with -g, otherwise as with -a. This option is mostly
+          for rescuing failed library preparations - do not use if
+          you know which end your adapter was ligated to!
+        required: false
+
+  ####################################################################
+  - name: Specify Adapters using Fasta files for R2
+    arguments:
+      - name: --adapter_r2_fasta
+        type: file
+        description: |
+          Fasta file containing sequences of an adapter ligated to the 3' end (paired data:
+          of the first read). The adapter and subsequent bases are
+          trimmed. If a '$' character is appended ('anchoring'), the
+          adapter is only found if it is a suffix of the read.
+        required: false
+      - name: --front_r2_fasta
+        type: file
+        description: |
+          Fasta file containing sequences of an adapter ligated to the 5' end (paired data:
+          of the first read). The adapter and any preceding bases
+          are trimmed. Partial matches at the 5' end are allowed. If
+          a '^' character is prepended ('anchoring'), the adapter is
+          only found if it is a prefix of the read.
+        required: false
+      - name: --anywhere_r2_fasta
+        type: file
+        description: |
+          Fasta file containing sequences of an adapter that may be ligated to the 5' or 3'
+          end (paired data: of the first read). Both types of
+          matches as described under -a and -g are allowed. If the
+          first base of the read is part of the match, the behavior
+          is as with -g, otherwise as with -a. This option is mostly
+          for rescuing failed library preparations - do not use if
+          you know which end your adapter was ligated to!
+        required: false
+
+  ####################################################################
+  - name: Paired-end options
+    arguments:
+      - name: --pair_adapters
+        type: boolean_true
+        description: |
+          Treat adapters given with -a/-A etc. as pairs. Either both
+          or none are removed from each read pair.
+      - name: --pair_filter
+        type: string
+        choices: [any, both, first]
+        description: |
+          Which of the reads in a paired-end read have to match the
+          filtering criterion in order for the pair to be filtered.
+      - name: --interleaved
+        type: boolean_true
+        description: |
+          Read and/or write interleaved paired-end reads.
+
+  ####################################################################
+  - name: Input parameters
+    arguments:
+      - name: --input
+        type: file
+        required: true
+        description: |
+          Input fastq file for single-end reads or R1 for paired-end reads.
+      - name: --input_r2
+        type: file
+        required: false
+        description: |
+          Input fastq file for R2 in the case of paired-end reads.
+      - name: --error_rate
+        alternatives: [-E, --errors]
+        type: double
+        description: |
+          Maximum allowed error rate (if 0 <= E < 1), or absolute
+          number of errors for full-length adapter match (if E is an
+          integer >= 1). Error rate = no. of errors divided by
+          length of matching region. Default: 0.1 (10%).
+        example: 0.1
+      - name: --no_indels
+        type: boolean_false
+        description: |
+          Allow only mismatches in alignments.
+
+      - name: --times
+        type: integer
+        alternatives: [-n]
+        description: |
+          Remove up to COUNT adapters from each read. Default: 1.
+        example: 1
+      - name: --overlap
+        alternatives: [-O]
+        type: integer
+        description: |
+          Require MINLENGTH overlap between read and adapter for an
+          adapter to be found. The default is 3.
+        example: 3
+      - name: --match_read_wildcards
+        type: boolean_true
+        description: |
+          Interpret IUPAC wildcards in reads.
+      - name: --no_match_adapter_wildcards
+        type: boolean_false
+        description: |
+          Do not interpret IUPAC wildcards in adapters.
+      - name: --action
+        type: string
+        choices:
+          - trim
+          - retain
+          - mask
+          - lowercase
+          - none
+        description: |
+          What to do if a match was found. trim: trim adapter and
+          up- or downstream sequence; retain: trim, but retain
+          adapter; mask: replace with 'N' characters; lowercase:
+          convert to lowercase; none: leave unchanged.
+          The default is trim.
+        example: trim
+      - name: --revcomp
+        alternatives: [--rc]
+        type: boolean_true
+        description: |
+          Check both the read and its reverse complement for adapter
+          matches. If match is on reverse-complemented version,
+          output that one.
+
+  ####################################################################
+  - name: Read modifications
+    arguments:
+      - name: --cut
+        alternatives: [-u]
+        type: integer
+        multiple: true
+        description: |
+          Remove LEN bases from each read (or R1 if paired; use --cut_r2
+          option for R2). If LEN is positive, remove bases from the
+          beginning. If LEN is negative, remove bases from the end.
+          Can be used twice if LENs have different signs. Applied
+          *before* adapter trimming.
+      - name: --cut_r2
+        type: integer
+        multiple: true
+        description: |
+          Remove LEN bases from each read (for R2). If LEN is positive, remove bases from the
+          beginning. If LEN is negative, remove bases from the end.
+          Can be used twice if LENs have different signs. Applied
+          *before* adapter trimming.
+      - name: --nextseq_trim
+        type: string
+        description: |
+          NextSeq-specific quality trimming (each read). Trims also
+          dark cycles appearing as high-quality G bases.
+      - name: --quality_cutoff
+        alternatives: [-q]
+        type: string
+        description: |
+          Trim low-quality bases from 5' and/or 3' ends of each read
+          before adapter removal. Applied to both reads if data is
+          paired. If one value is given, only the 3' end is trimmed.
+          If two comma-separated cutoffs are given, the 5' end is
+          trimmed with the first cutoff, the 3' end with the second.
+      - name: --quality_cutoff_r2
+        alternatives: [-Q]
+        type: string
+        description: |
+          Quality-trimming cutoff for R2. Default: same as for R1
+      - name: --quality_base
+        type: integer
+        description: |
+          Assume that quality values in FASTQ are encoded as
+          ascii(quality + N). This needs to be set to 64 for some
+          old Illumina FASTQ files. The default is 33.
+        example: 33
+      - name: --poly_a
+        type: boolean_true
+        description: Trim poly-A tails
+      - name: --length
+        alternatives: [-l]
+        type: integer
+        description: |
+          Shorten reads to LENGTH. Positive values remove bases at
+          the end while negative ones remove bases at the beginning.
+          This and the following modifications are applied after
+          adapter trimming.
+      - name: --trim_n
+        type: boolean_true
+        description: Trim N's on ends of reads.
+      - name: --length_tag
+        type: string
+        description: |
+          Search for TAG followed by a decimal number in the
+          description field of the read. Replace the decimal number
+          with the correct length of the trimmed read. For example,
+          use --length-tag 'length=' to correct fields like
+          'length=123'.
+        example: "length="
+      - name: --strip_suffix
+        type: string
+        description: |
+          Remove this suffix from read names if present. Can be
+          given multiple times.
+      - name: --prefix
+        alternatives: [-x]
+        type: string
+        description: |
+          Add this prefix to read names. Use {name} to insert the
+          name of the matching adapter.
+      - name: --suffix
+        alternatives: [-y]
+        type: string
+        description: |
+          Add this suffix to read names; can also include {name}
+      - name: --rename
+        type: string
+        description: |
+          Rename reads using TEMPLATE containing variables such as
+          {id}, {adapter_name} etc. (see documentation)
+      - name: --zero_cap
+        alternatives: [-z]
+        type: boolean_true
+        description: Change negative quality values to zero.
+
+  ####################################################################
+  - name: Filtering of processed reads
+    description: |
+      Filters are applied after above read modifications. Paired-end reads are
+      always discarded pairwise (see also --pair_filter).
+    arguments:
+      - name: --minimum_length
+        alternatives: [-m]
+        type: string
+        description: |
+          Discard reads shorter than LEN. Default is 0.
+          When trimming paired-end reads, the minimum lengths for R1 and R2 can be specified separately by separating them with a colon (:).
+          If the colon syntax is not used, the same minimum length applies to both reads, as discussed above.
+          Also, one of the values can be omitted to impose no restrictions.
+          For example, with -m 17:, the length of R1 must be at least 17, but the length of R2 is ignored.
+        example: "0"
+      - name: --maximum_length
+        alternatives: [-M]
+        type: string
+        description: |
+          Discard reads longer than LEN. Default: no limit.
+          For paired reads, see the remark for --minimum_length
+      - name: --max_n
+        type: string
+        description: |
+          Discard reads with more than COUNT 'N' bases. If COUNT is
+          a number between 0 and 1, it is interpreted as a fraction
+          of the read length.
+      - name: --max_expected_errors
+        alternatives: [--max_ee]
+        type: long
+        description: |
+          Discard reads whose expected number of errors (computed
+          from quality values) exceeds ERRORS.
+      - name: --max_average_error_rate
+        alternatives: [--max_aer]
+        type: long
+        description: |
+          as --max_expected_errors (see above), but divided by
+          length to account for reads of varying length.
+      - name: --discard_trimmed
+        alternatives: [--discard]
+        type: boolean_true
+        description: |
+          Discard reads that contain an adapter. Use also -O to
+          avoid discarding too many randomly matching reads.
+      - name: --discard_untrimmed
+        alternatives: [--trimmed_only]
+        type: boolean_true
+        description: |
+          Discard reads that do not contain an adapter.
+      - name: --discard_casava
+        type: boolean_true
+        description: |
+          Discard reads that did not pass CASAVA filtering (header
+          has :Y:).
+
+  ####################################################################
+  - name: Output parameters
+    arguments:
+      - name: --report
+        type: string
+        choices: [full, minimal]
+        description: |
+          Which type of report to print: 'full' (default) or 'minimal'.
+        example: full
+      - name: --json
+        type: boolean_true
+        description: |
+          Write report in JSON format to this file.
+      - name: --output
+        type: file
+        description: |
+          Glob pattern for matching the expected output files.
+          Should include `$output_dir`.
+        example: "fastq/*_001.fast[a,q]"
+        direction: output
+        required: true
+        must_exist: true
+        multiple: true
+      - name: --fasta
+        type: boolean_true
+        description: |
+          Output FASTA to standard output even on FASTQ input.
+      - name: --info_file
+        type: boolean_true
+        description: |
+          Write information about each read and its adapter matches
+          into info.txt in the output directory.
+          See the documentation for the file format.
+      # - name: -Z
+      # - name: --rest_file
+      # - name: --wildcard-file
+      # - name: --too_short_output
+      # - name: --too_long_output
+      # - name: --untrimmed_output
+      # - name: --untrimmed_paired_output
+      # - name: too_short_paired_output
+      # - name: too_long_paired_output
+  - name: Debug
+    arguments:
+      - type: boolean_true
+        name: --debug
+        description: Print debug information
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+
+engines:
+  - type: docker
+    image: python:3.12
+    setup:
+      - type: python
+        pip:
+          - cutadapt
+      - type: docker
+        run: |
+          cutadapt --version | sed 's/\(.*\)/cutadapt: "\1"/' > /var/software_versions.txt
+runners:
+  - type: executable
+  - type: nextflow
diff --git a/src/cutadapt/help.txt b/src/cutadapt/help.txt
new file mode 100644
index 00000000..2280c3e2
--- /dev/null
+++ b/src/cutadapt/help.txt
@@ -0,0 +1,218 @@
+cutadapt version 4.6
+
+Copyright (C) 2010 Marcel Martin <marcel.martin@scilifelab.se> and contributors
+
+Cutadapt removes adapter sequences from high-throughput sequencing reads.
+
+Usage:
+    cutadapt -a ADAPTER [options] [-o output.fastq] input.fastq
+
+For paired-end reads:
+    cutadapt -a ADAPT1 -A ADAPT2 [options] -o out1.fastq -p out2.fastq in1.fastq in2.fastq
+
+Replace "ADAPTER" with the actual sequence of your 3' adapter. IUPAC wildcard
+characters are supported. All reads from input.fastq will be written to
+output.fastq with the adapter sequence removed. Adapter matching is
+error-tolerant. Multiple adapter sequences can be given (use further -a
+options), but only the best-matching adapter will be removed.
+
+Input may also be in FASTA format. Compressed input and output is supported and
+auto-detected from the file name (.gz, .xz, .bz2). Use the file name '-' for
+standard input/output. Without the -o option, output is sent to standard output.
+
+Citation:
+
+Marcel Martin. Cutadapt removes adapter sequences from high-throughput
+sequencing reads. EMBnet.Journal, 17(1):10-12, May 2011.
+http://dx.doi.org/10.14806/ej.17.1.200
+
+Run "cutadapt --help" to see all command-line options.
+See https://cutadapt.readthedocs.io/ for full documentation.
+
+Options:
+  -h, --help            Show this help message and exit
+  --version             Show version number and exit
+  --debug               Print debug log. Use twice to also print DP matrices
+  -j CORES, --cores CORES
+                        Number of CPU cores to use. Use 0 to auto-detect. Default:
+                        1
+
+Finding adapters:
+  Parameters -a, -g, -b specify adapters to be removed from each read (or from
+  R1 if data is paired-end. If specified multiple times, only the best matching
+  adapter is trimmed (but see the --times option). Use notation 'file:FILE' to
+  read adapter sequences from a FASTA file.
+
+  -a ADAPTER, --adapter ADAPTER
+                        Sequence of an adapter ligated to the 3' end (paired data:
+                        of the first read). The adapter and subsequent bases are
+                        trimmed. If a '$' character is appended ('anchoring'), the
+                        adapter is only found if it is a suffix of the read.
+  -g ADAPTER, --front ADAPTER
+                        Sequence of an adapter ligated to the 5' end (paired data:
+                        of the first read). The adapter and any preceding bases
+                        are trimmed. Partial matches at the 5' end are allowed. If
+                        a '^' character is prepended ('anchoring'), the adapter is
+                        only found if it is a prefix of the read.
+  -b ADAPTER, --anywhere ADAPTER
+                        Sequence of an adapter that may be ligated to the 5' or 3'
+                        end (paired data: of the first read). Both types of
+                        matches as described under -a and -g are allowed. If the
+                        first base of the read is part of the match, the behavior
+                        is as with -g, otherwise as with -a. This option is mostly
+                        for rescuing failed library preparations - do not use if
+                        you know which end your adapter was ligated to!
+  -e E, --error-rate E, --errors E
+                        Maximum allowed error rate (if 0 <= E < 1), or absolute
+                        number of errors for full-length adapter match (if E is an
+                        integer >= 1). Error rate = no. of errors divided by
+                        length of matching region. Default: 0.1 (10%)
+  --no-indels           Allow only mismatches in alignments. Default: allow both
+                        mismatches and indels
+  -n COUNT, --times COUNT
+                        Remove up to COUNT adapters from each read. Default: 1
+  -O MINLENGTH, --overlap MINLENGTH
+                        Require MINLENGTH overlap between read and adapter for an
+                        adapter to be found. Default: 3
+  --match-read-wildcards
+                        Interpret IUPAC wildcards in reads. Default: False
+  -N, --no-match-adapter-wildcards
+                        Do not interpret IUPAC wildcards in adapters.
+  --action {trim,retain,mask,lowercase,none}
+                        What to do if a match was found. trim: trim adapter and
+                        up- or downstream sequence; retain: trim, but retain
+                        adapter; mask: replace with 'N' characters; lowercase:
+                        convert to lowercase; none: leave unchanged. Default: trim
+  --rc, --revcomp       Check both the read and its reverse complement for adapter
+                        matches. If match is on reverse-complemented version,
+                        output that one. Default: check only read
+
+Additional read modifications:
+  -u LEN, --cut LEN     Remove LEN bases from each read (or R1 if paired; use -U
+                        option for R2). If LEN is positive, remove bases from the
+                        beginning. If LEN is negative, remove bases from the end.
+                        Can be used twice if LENs have different signs. Applied
+                        *before* adapter trimming.
+  --nextseq-trim 3'CUTOFF
+                        NextSeq-specific quality trimming (each read). Trims also
+                        dark cycles appearing as high-quality G bases.
+  -q [5'CUTOFF,]3'CUTOFF, --quality-cutoff [5'CUTOFF,]3'CUTOFF
+                        Trim low-quality bases from 5' and/or 3' ends of each read
+                        before adapter removal. Applied to both reads if data is
+                        paired. If one value is given, only the 3' end is trimmed.
+                        If two comma-separated cutoffs are given, the 5' end is
+                        trimmed with the first cutoff, the 3' end with the second.
+  --quality-base N      Assume that quality values in FASTQ are encoded as
+                        ascii(quality + N). This needs to be set to 64 for some
+                        old Illumina FASTQ files. Default: 33
+  --poly-a              Trim poly-A tails
+  --length LENGTH, -l LENGTH
+                        Shorten reads to LENGTH. Positive values remove bases at
+                        the end while negative ones remove bases at the beginning.
+                        This and the following modifications are applied after
+                        adapter trimming.
+  --trim-n              Trim N's on ends of reads.
+  --length-tag TAG      Search for TAG followed by a decimal number in the
+                        description field of the read. Replace the decimal number
+                        with the correct length of the trimmed read. For example,
+                        use --length-tag 'length=' to correct fields like
+                        'length=123'.
+  --strip-suffix STRIP_SUFFIX
+                        Remove this suffix from read names if present. Can be
+                        given multiple times.
+  -x PREFIX, --prefix PREFIX
+                        Add this prefix to read names. Use {name} to insert the
+                        name of the matching adapter.
+  -y SUFFIX, --suffix SUFFIX
+                        Add this suffix to read names; can also include {name}
+  --rename TEMPLATE     Rename reads using TEMPLATE containing variables such as
+                        {id}, {adapter_name} etc. (see documentation)
+  --zero-cap, -z        Change negative quality values to zero.
+
+Filtering of processed reads:
+  Filters are applied after above read modifications. Paired-end reads are
+  always discarded pairwise (see also --pair-filter).
+
+  -m LEN[:LEN2], --minimum-length LEN[:LEN2]
+                        Discard reads shorter than LEN. Default: 0
+  -M LEN[:LEN2], --maximum-length LEN[:LEN2]
+                        Discard reads longer than LEN. Default: no limit
+  --max-n COUNT         Discard reads with more than COUNT 'N' bases. If COUNT is
+                        a number between 0 and 1, it is interpreted as a fraction
+                        of the read length.
+  --max-expected-errors ERRORS, --max-ee ERRORS
+                        Discard reads whose expected number of errors (computed
+                        from quality values) exceeds ERRORS.
+  --max-average-error-rate ERROR_RATE, --max-aer ERROR_RATE
+                        as --max-expected-errors (see above), but divided by
+                        length to account for reads of varying length.
+  --discard-trimmed, --discard
+                        Discard reads that contain an adapter. Use also -O to
+                        avoid discarding too many randomly matching reads.
+  --discard-untrimmed, --trimmed-only
+                        Discard reads that do not contain an adapter.
+  --discard-casava      Discard reads that did not pass CASAVA filtering (header
+                        has :Y:).
+
+Output:
+  --quiet               Print only error messages.
+  --report {full,minimal}
+                        Which type of report to print: 'full' or 'minimal'.
+                        Default: full
+  --json FILE           Dump report in JSON format to FILE
+  -o FILE, --output FILE
+                        Write trimmed reads to FILE. FASTQ or FASTA format is
+                        chosen depending on input. Summary report is sent to
+                        standard output. Use '{name}' for demultiplexing (see
+                        docs). Default: write to standard output
+  --fasta               Output FASTA to standard output even on FASTQ input.
+  -Z                    Use compression level 1 for gzipped output files (faster,
+                        but uses more space)
+  --info-file FILE      Write information about each read and its adapter matches
+                        into FILE. See the documentation for the file format.
+  -r FILE, --rest-file FILE
+                        When the adapter matches in the middle of a read, write
+                        the rest (after the adapter) to FILE.
+  --wildcard-file FILE  When the adapter has N wildcard bases, write adapter bases
+                        matching wildcard positions to FILE. (Inaccurate with
+                        indels.)
+  --too-short-output FILE
+                        Write reads that are too short (according to length
+                        specified by -m) to FILE. Default: discard reads
+  --too-long-output FILE
+                        Write reads that are too long (according to length
+                        specified by -M) to FILE. Default: discard reads
+  --untrimmed-output FILE
+                        Write reads that do not contain any adapter to FILE.
+                        Default: output to same file as trimmed reads
+
+Paired-end options:
+  The -A/-G/-B/-U/-Q options work like their lowercase counterparts, but are
+  applied to R2 (second read in pair)
+
+  -A ADAPTER            3' adapter to be removed from R2
+  -G ADAPTER            5' adapter to be removed from R2
+  -B ADAPTER            5'/3 adapter to be removed from R2
+  -U LENGTH             Remove LENGTH bases from R2
+  -Q [5'CUTOFF,]3'CUTOFF
+                        Quality-trimming cutoff for R2. Default: same as for R1
+  -p FILE, --paired-output FILE
+                        Write R2 to FILE.
+  --pair-adapters       Treat adapters given with -a/-A etc. as pairs. Either both
+                        or none are removed from each read pair.
+  --pair-filter {any,both,first}
+                        Which of the reads in a paired-end read have to match the
+                        filtering criterion in order for the pair to be filtered.
+                        Default: any
+  --interleaved         Read and/or write interleaved paired-end reads.
+  --untrimmed-paired-output FILE
+                        Write second read in a pair to this FILE when no adapter
+                        was found. Use with --untrimmed-output. Default: output to
+                        same file as trimmed reads
+  --too-short-paired-output FILE
+                        Write second read in a pair to this file if pair is too
+                        short.
+  --too-long-paired-output FILE
+                        Write second read in a pair to this file if pair is too
+                        long.
+
diff --git a/src/cutadapt/script.sh b/src/cutadapt/script.sh
new file mode 100644
index 00000000..5e1f9e30
--- /dev/null
+++ b/src/cutadapt/script.sh
@@ -0,0 +1,237 @@
+#!/bin/bash
+
+## VIASH START
+par_adapter='AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;GGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
+par_input='src/cutadapt/test_data/se/a.fastq'
+par_report='full'
+par_json='false'
+par_fasta='false'
+par_info_file='false'
+par_debug='true'
+## VIASH END
+
+function debug {
+  [[ "$par_debug" == "true" ]] && echo "DEBUG: $@"
+}
+
+output_dir=$(dirname $par_output)
+[[ ! -d $output_dir ]] && mkdir -p $output_dir
+
+# Init
+###########################################################
+
+echo ">> Paired-end data or not?"
+
+mode=""
+if [[ -z $par_input_r2 ]]; then
+  mode="se"
+  echo "  Single end"
+  input="$par_input"
+else
+  echo "  Paired end"
+  mode="pe"
+  input="$par_input $par_input_r2"
+fi
+
+# Adapter arguments
+#   - paired and single-end
+#   - string and fasta
+###########################################################
+
+function add_flags {
+  local arg=$1
+  local flag=$2
+  local prefix=$3
+  [[ -z $prefix ]] && prefix=""
+
+  # This function should not be called if the input is empty
+  # but check for it just in case
+  if [[ -z $arg ]]; then
+    return
+  fi
+
+  local output=""
+  IFS=';' read -r -a array <<< "$arg"
+  for a in "${array[@]}"; do
+    output="$output $flag $prefix$a"
+  done
+  echo $output
+}
+
+debug ">> Parsing arguments dealing with adapters"
+adapter_args=$(echo \
+  ${par_adapter:+$(add_flags "$par_adapter" "--adapter")} \
+  ${par_adapter_fasta:+$(add_flags "$par_adapter_fasta" "--adapter" "file:")} \
+  ${par_front:+$(add_flags "$par_front" "--front")} \
+  ${par_front_fasta:+$(add_flags "$par_front_fasta" "--front" "file:")} \
+  ${par_anywhere:+$(add_flags "$par_anywhere" "--anywhere")} \
+  ${par_anywhere_fasta:+$(add_flags "$par_anywhere_fasta" "--anywhere" "file:")} \
+  ${par_adapter_r2:+$(add_flags "$par_adapter_r2" "-A")} \
+  ${par_adapter_fasta_r2:+$(add_flags "$par_adapter_fasta_r2" "-A" "file:")} \
+  ${par_front_r2:+$(add_flags "$par_front_r2" "-G")} \
+  ${par_front_fasta_r2:+$(add_flags "$par_front_fasta_r2" "-G" "file:")} \
+  ${par_anywhere_r2:+$(add_flags "$par_anywhere_r2" "-B")} \
+  ${par_anywhere_fasta_r2:+$(add_flags "$par_anywhere_fasta_r2" "-B" "file:")} \
+)
+
+debug "Arguments to cutadapt:"
+debug "$adapter_args"
+debug
+
+# Paired-end options
+###########################################################
+echo ">> Parsing arguments for paired-end reads"
+[[ "$par_pair_adapters" == "false" ]] && unset par_pair_adapters
+[[ "$par_interleaved" == "false" ]] && unset par_interleaved
+
+paired_args=$(echo \
+  ${par_pair_adapters:+--pair-adapters} \
+  ${par_pair_filter:+--pair-filter "${par_pair_filter}"} \
+  ${par_interleaved:+--interleaved}
+)
+debug "Arguments to cutadapt:"
+debug $paired_args
+debug
+
+# Input arguments 
+###########################################################
+echo ">> Parsing input arguments"
+[[ "$par_no_indels" == "true" ]] && unset par_no_indels
+[[ "$par_match_read_wildcards" == "false" ]] && unset par_match_read_wildcards
+[[ "$par_no_match_adapter_wildcards" == "true" ]] && unset par_no_match_adapter_wildcards
+[[ "$par_revcomp" == "false" ]] && unset par_revcomp
+
+input_args=$(echo \
+  ${par_error_rate:+--error-rate "${par_error_rate}"} \
+  ${par_no_indels:+--no-indels} \
+  ${par_times:+--times "${par_times}"} \
+  ${par_overlap:+--overlap "${par_overlap}"} \
+  ${par_match_read_wildcards:+--match-read-wildcards} \
+  ${par_no_match_adapter_wildcards:+--no-match-adapter-wildcards} \
+  ${par_action:+--action "${par_action}"} \
+  ${par_revcomp:+--revcomp} \
+)
+debug "Arguments to cutadapt:"
+debug $input_args
+debug
+
+# Read modifications
+###########################################################
+echo ">> Parsing read modification arguments"
+[[ "$par_poly_a" == "false" ]] && unset par_poly_a
+[[ "$par_trim_n" == "false" ]] && unset par_trim_n
+[[ "$par_zero_cap" == "false" ]] && unset par_zero_cap
+
+mod_args=$(echo \
+  ${par_cut:+--cut "${par_cut}"} \
+  ${par_cut_r2:+--cut_r2 "${par_cut_r2}"} \
+  ${par_nextseq_trim:+--nextseq-trim "${par_nextseq_trim}"} \
+  ${par_quality_cutoff:+--quality-cutoff "${par_quality_cutoff}"} \
+  ${par_quality_cutoff_r2:+--quality-cutoff_r2 "${par_quality_cutoff_r2}"} \
+  ${par_quality_base:+--quality-base "${par_quality_base}"} \
+  ${par_poly_a:+--poly-a} \
+  ${par_length:+--length "${par_length}"} \
+  ${par_trim_n:+--trim-n} \
+  ${par_length_tag:+--length-tag "${par_length_tag}"} \
+  ${par_strip_suffix:+--strip-suffix "${par_strip_suffix}"} \
+  ${par_prefix:+--prefix "${par_prefix}"} \
+  ${par_suffix:+--suffix "${par_suffix}"} \
+  ${par_rename:+--rename "${par_rename}"} \
+  ${par_zero_cap:+--zero-cap} \
+)
+debug "Arguments to cutadapt:"
+debug $mod_args
+debug
+
+# Filtering of processed reads arguments
+###########################################################
+echo ">> Filtering of processed reads arguments"
+[[ "$par_discard_trimmed" == "false" ]] && unset par_discard_trimmed
+[[ "$par_discard_untrimmed" == "false" ]] && unset par_discard_untrimmed
+[[ "$par_discard_casava" == "false" ]] && unset par_discard_casava
+
+# Parse and transform the minimum and maximum length arguments
+[[ -z $par_minimum_length   ]]
+
+filter_args=$(echo \
+  ${par_minimum_length:+--minimum-length "${par_minimum_length}"} \
+  ${par_maximum_length:+--maximum-length "${par_maximum_length}"} \
+  ${par_max_n:+--max-n "${par_max_n}"} \
+  ${par_max_expected_errors:+--max-expected-errors "${par_max_expected_errors}"} \
+  ${par_max_average_error_rate:+--max-average-error-rate "${par_max_average_error_rate}"} \
+  ${par_discard_trimmed:+--discard-trimmed} \
+  ${par_discard_untrimmed:+--discard-untrimmed} \
+  ${par_discard_casava:+--discard-casava} \
+)
+debug "Arguments to cutadapt:"
+debug $filter_args
+debug
+
+# Optional output arguments
+###########################################################
+echo ">> Optional arguments"
+[[ "$par_json" == "false" ]] && unset par_json
+[[ "$par_fasta" == "false" ]] && unset par_fasta
+[[ "$par_info_file" == "false" ]] && unset par_info_file
+
+optional_output_args=$(echo \
+  ${par_report:+--report "${par_report}"} \
+  ${par_json:+--json "report.json"} \
+  ${par_fasta:+--fasta} \
+  ${par_info_file:+--info-file "info.txt"} \
+)
+
+debug "Arguments to cutadapt:"
+debug $optional_output_args
+debug
+
+# Output arguments
+# We write the output to a directory rather than
+# individual files.
+###########################################################
+
+if [[ -z $par_fasta ]]; then
+  ext="fastq"
+else
+  ext="fasta"
+fi
+
+if [ $mode = "se" ]; then
+  output_args=$(echo \
+    --output "$output_dir/{name}_001.$ext" \
+  )
+else
+  output_args=$(echo \
+    --output "$output_dir/{name}_R1_001.$ext" \
+    --paired-output "$output_dir/{name}_R2_001.$ext" \
+  )
+fi
+
+debug "Arguments to cutadapt:"
+debug $output_args
+debug
+
+# Full CLI
+# Set the --cores argument to 0 unless meta_cpus is set
+###########################################################
+echo ">> Running cutadapt"
+par_cpus=0
+[[ ! -z $meta_cpus ]] && par_cpus=$meta_cpus
+
+cli=$(echo \
+  $input \
+  $adapter_args \
+  $paired_args \
+  $input_args \
+  $mod_args \
+  $filter_args \
+  $optional_output_args \
+  $output_args \
+  --cores $par_cpus
+)
+
+debug ">> Full CLI to be run:"
+debug cutadapt $cli | sed -e 's/--/\r\n  --/g'
+debug
+
+cutadapt $cli
diff --git a/src/cutadapt/test.sh b/src/cutadapt/test.sh
new file mode 100644
index 00000000..eff997d7
--- /dev/null
+++ b/src/cutadapt/test.sh
@@ -0,0 +1,256 @@
+#!/bin/bash
+
+set -e
+
+#############################################
+# helper functions
+assert_file_exists() {
+  [ -f "$1" ] || (echo "File '$1' does not exist" && exit 1)
+}
+assert_file_doesnt_exist() {
+  [ ! -f "$1" ] || (echo "File '$1' exists but shouldn't" && exit 1)
+}
+assert_file_empty() {
+  [ ! -s "$1" ] || (echo "File '$1' is not empty but should be" && exit 1)
+}
+assert_file_not_empty() {
+  [ -s "$1" ] || (echo "File '$1' is empty but shouldn't be" && exit 1)
+}
+assert_file_contains() {
+  grep -q "$2" "$1" || (echo "File '$1' does not contain '$2'" && exit 1)
+}
+assert_file_not_contains() {
+  grep -q "$2" "$1" && (echo "File '$1' contains '$2' but shouldn't" && exit 1)
+}
+
+#############################################
+mkdir test_multiple_output
+cd test_multiple_output
+
+echo "#############################################"
+echo "> Run cutadapt with multiple outputs"
+
+cat > example.fa <<'EOF'
+>read1
+MYSEQUENCEADAPTER
+>read2
+MYSEQUENCEADAP
+>read3
+MYSEQUENCEADAPTERSOMETHINGELSE
+>read4
+MYSEQUENCEADABTER
+>read5
+MYSEQUENCEADAPTR
+>read6
+MYSEQUENCEADAPPTER
+>read7
+ADAPTERMYSEQUENCE
+>read8
+PTERMYSEQUENCE
+>read9
+SOMETHINGADAPTERMYSEQUENCE
+EOF
+
+"$meta_executable" \
+  --report minimal \
+  --output "out_test/*.fasta" \
+  --adapter ADAPTER \
+  --input example.fa \
+  --fasta \
+  --no_match_adapter_wildcards \
+  --json
+
+echo ">> Checking output"
+assert_file_exists "report.json"
+assert_file_exists "out_test/1_001.fasta"
+assert_file_exists "out_test/unknown_001.fasta"
+
+cd ..
+echo
+
+#############################################
+mkdir test_simple_single_end
+cd test_simple_single_end
+
+echo "#############################################"
+echo "> Run cutadapt on single-end data"
+
+cat > example.fa <<'EOF'
+>read1
+MYSEQUENCEADAPTER
+>read2
+MYSEQUENCEADAP
+>read3
+MYSEQUENCEADAPTERSOMETHINGELSE
+>read4
+MYSEQUENCEADABTER
+>read5
+MYSEQUENCEADAPTR
+>read6
+MYSEQUENCEADAPPTER
+>read7
+ADAPTERMYSEQUENCE
+>read8
+PTERMYSEQUENCE
+>read9
+SOMETHINGADAPTERMYSEQUENCE
+EOF
+
+"$meta_executable" \
+  --report minimal \
+  --output "out_test1/*.fasta" \
+  --adapter ADAPTER \
+  --input example.fa \
+  --fasta \
+  --no_match_adapter_wildcards \
+  --json
+
+echo ">> Checking output"
+assert_file_exists "report.json"
+assert_file_exists "out_test1/1_001.fasta"
+assert_file_exists "out_test1/unknown_001.fasta"
+
+echo ">> Check if output is empty"
+assert_file_not_empty "report.json"
+assert_file_not_empty "out_test1/1_001.fasta"
+assert_file_not_empty "out_test1/unknown_001.fasta"
+
+echo ">> Check contents"
+for i in 1 2 3 7 9; do
+  assert_file_contains "out_test1/1_001.fasta" ">read$i"
+done
+for i in 4 5 6 8; do
+  assert_file_contains "out_test1/unknown_001.fasta" ">read$i"
+done
+
+cd ..
+echo
+
+#############################################
+mkdir test_multiple_single_end
+cd test_multiple_single_end
+
+echo "#############################################"
+echo "> Run with a combination of inputs"
+
+cat > example.fa <<'EOF'
+>read1
+ACGTACGTACGTAAAAA
+>read2
+ACGTACGTACGTCCCCC
+>read3
+ACGTACGTACGTGGGGG
+>read4
+ACGTACGTACGTTTTTT
+EOF
+
+cat > adapters1.fasta <<'EOF'
+>adapter1
+CCCCC
+EOF
+
+cat > adapters2.fasta <<'EOF'
+>adapter2
+GGGGG
+EOF
+
+"$meta_executable" \
+  --report minimal \
+  --output "out_test2/*.fasta" \
+  --adapter AAAAA \
+  --adapter_fasta adapters1.fasta \
+  --adapter_fasta adapters2.fasta \
+  --input example.fa \
+  --fasta \
+  --json
+
+echo ">> Checking output"
+assert_file_exists "report.json"
+assert_file_exists "out_test2/1_001.fasta"
+assert_file_exists "out_test2/adapter1_001.fasta"
+assert_file_exists "out_test2/adapter2_001.fasta"
+assert_file_exists "out_test2/unknown_001.fasta"
+
+echo ">> Check if output is empty"
+assert_file_not_empty "report.json"
+assert_file_not_empty "out_test2/1_001.fasta"
+assert_file_not_empty "out_test2/adapter1_001.fasta"
+assert_file_not_empty "out_test2/adapter2_001.fasta"
+assert_file_not_empty "out_test2/unknown_001.fasta"
+
+echo ">> Check contents"
+assert_file_contains "out_test2/1_001.fasta" ">read1"
+assert_file_contains "out_test2/adapter1_001.fasta" ">read2"
+assert_file_contains "out_test2/adapter2_001.fasta" ">read3"
+assert_file_contains "out_test2/unknown_001.fasta" ">read4"
+
+cd ..
+echo
+
+#############################################
+mkdir test_simple_paired_end
+cd test_simple_paired_end
+
+echo "#############################################"
+echo "> Run cutadapt on paired-end data"
+
+cat > example_R1.fastq <<'EOF'
+@read1
+ACGTACGTACGTAAAAA
++
+IIIIIIIIIIIIIIIII
+@read2
+ACGTACGTACGTCCCCC
++
+IIIIIIIIIIIIIIIII
+EOF
+
+cat > example_R2.fastq <<'EOF'
+@read1
+ACGTACGTACGTGGGGG
++
+IIIIIIIIIIIIIIIII
+@read2
+ACGTACGTACGTTTTTT
++
+IIIIIIIIIIIIIIIII
+EOF
+
+"$meta_executable" \
+  --report minimal \
+  --output "out_test3/*.fastq" \
+  --adapter AAAAA \
+  --adapter_r2 GGGGG \
+  --input example_R1.fastq \
+  --input_r2 example_R2.fastq \
+  --quality_cutoff 20 \
+  --json \
+  ---cpus 1
+
+echo ">> Checking output"
+assert_file_exists "report.json"
+assert_file_exists "out_test3/1_R1_001.fastq"
+assert_file_exists "out_test3/1_R2_001.fastq"
+assert_file_exists "out_test3/unknown_R1_001.fastq"
+assert_file_exists "out_test3/unknown_R2_001.fastq"
+
+echo ">> Check if output is empty"
+assert_file_not_empty "report.json"
+assert_file_not_empty "out_test3/1_R1_001.fastq"
+assert_file_not_empty "out_test3/1_R2_001.fastq"
+assert_file_not_empty "out_test3/unknown_R1_001.fastq"
+
+echo ">> Check contents"
+assert_file_contains "out_test3/1_R1_001.fastq" "@read1"
+assert_file_contains "out_test3/1_R2_001.fastq" "@read1"
+assert_file_contains "out_test3/unknown_R1_001.fastq" "@read2"
+assert_file_contains "out_test3/unknown_R2_001.fastq" "@read2"
+
+cd ..
+echo
+
+#############################################
+
+echo "#############################################"
+echo "> Test successful"
+