From 38f586bec0ac9e4312b016e29c3aa0bd53f292b2 Mon Sep 17 00:00:00 2001
From: emmarousseau <emmarou1@icloud.com>
Date: Thu, 11 Apr 2024 11:04:14 +0100
Subject: [PATCH 1/6] initial commit dedup

---
 CHANGELOG.md                                  |   3 +
 src/umi_tools/umi_tools_dedup/config.vsh.yaml | 279 ++++++++++++++++++
 src/umi_tools/umi_tools_dedup/help.txt        |  13 +
 src/umi_tools/umi_tools_dedup/script.sh       |  65 ++++
 src/umi_tools/umi_tools_dedup/test.sh         |  49 +++
 5 files changed, 409 insertions(+)
 create mode 100644 src/umi_tools/umi_tools_dedup/config.vsh.yaml
 create mode 100644 src/umi_tools/umi_tools_dedup/help.txt
 create mode 100644 src/umi_tools/umi_tools_dedup/script.sh
 create mode 100644 src/umi_tools/umi_tools_dedup/test.sh

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 4fd7f001..1bef9345 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -39,6 +39,9 @@
     - `samtools/flagstat`: Counts the number of alignments in SAM/BAM/CRAM files for each FLAG type (PR #31).
     - `samtools/idxstats`: Reports alignment summary statistics for a SAM/BAM/CRAM file (PR #32).
 
+* `umi_tools`:
+    - `umi_tools/umi_tools_dedup`: Deduplicate reads based on the mapping co-ordinate and the UMI attached to the read (PR #).
+    
 ## MAJOR CHANGES
 
 ## MINOR CHANGES
diff --git a/src/umi_tools/umi_tools_dedup/config.vsh.yaml b/src/umi_tools/umi_tools_dedup/config.vsh.yaml
new file mode 100644
index 00000000..75306541
--- /dev/null
+++ b/src/umi_tools/umi_tools_dedup/config.vsh.yaml
@@ -0,0 +1,279 @@
+name: umi_tool_dedup
+namespace: umi_tools
+description: |
+  Deduplicate reads based on the mapping co-ordinate and the UMI attached to the read.
+keywords: [umi_tools, deduplication, dedup]
+links:
+  homepage: https://umi-tools.readthedocs.io/en/latest/
+  documentation: [ https://umi-tools.readthedocs.io/en/latest/reference/dedup.html,
+                   https://umi-tools.readthedocs.io/en/latest/common_options.html#common-options ]
+  repository: https://github.com/CGATOxford/UMI-tools
+references: 
+  doi: 10.1101/gr.209601.116
+license: MIT
+
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: --input
+        alternatives: -I
+        type: file
+        description: Input BAM or SAM file. Use --in_sam to specify SAM format.
+        required: true
+      - name: --in_sam
+        type: boolean_true
+        description: |
+          By default, inputs are assumed to be in BAM format. Use this options 
+          to specify the use of SAM format for input.
+      - name: --bai
+        type: file
+        description: BAM index
+      - name: --get_output_stats
+        type: boolean
+        description: Whether or not to generate output stats. 
+      - name: --random_seed
+        type: integer
+        description: |
+          Random seed to initialize number generator with.
+        default: none
+
+  - name: Outputs
+    arguments:
+      - name: --output
+        alternatives: -S
+        type: file
+        description: Deduplicated BAM file
+        required: true
+        direction: output
+      - name: --out_sam
+        type: boolean_true
+        description: |
+          By default, outputa are written in BAM format. Use this options to 
+          specify the use of SAM format for output.
+      - name: --paired
+        type: boolean_true
+        description: |
+          BAM is paired end - output both read pairs. This will also force the
+          use of the template length to determine reads with the same mapping
+          coordinates.
+      - name: --output_stats
+        type: file
+        description: Directory containing UMI based deduplication statistics files
+        direction: output
+      - name: --extract_umi_method
+        type: string
+        description: |
+          Specify the method by which the barcodes were encoded in the read.
+          The options are: [read_id, tag, umis].
+        default: read_id
+      - name: --umi_tag
+        type: string
+        description: |
+          The tag containing the UMI sequence. 
+          This is only required if the extract_umi_method is set to tag.
+      - name: --umi_separator
+        type: string
+        description: |
+          The separator used to separate the UMI from the read sequence. 
+          This is only required if the extract_umi_method is set to id_read.
+        default: '_'
+      - name: --umi_tag_split
+        type: string
+        description: |
+          Separate the UMI in tag by <SPLIT> and take the first element.
+      - name: --umi_tag_delimiter
+        type: string
+        description: |
+          Separate the UMI in by <DELIMITER> and concatenate the elements
+      - name: --cell_tag
+        type: string
+        description: |
+          The tag containing the cell barcode sequence. 
+          This is only required if the extract_umi_method is set to tag.
+      - name: --cell_tag_split
+        type: string
+        description: |
+          Separate the cell barcode in tag by <SPLIT> and take the first element.
+      - name: --cell_tag_delimiter
+        type: string
+        description: |
+          Separate the cell barcode in by <DELIMITER> and concatenate the elements
+  
+  - name: Grouping Options
+    arguments:    
+      - name: --method
+        type: string
+        description: |
+          The method to use for grouping reads. The options are: 
+          [unique, percentile, cluster, adjacency, directional].
+        default: directional
+      - name: --edit_distance_threshold
+        type: integer
+        description: |
+          For the adjacency and cluster methods the threshold for the edit 
+          distance to connect two UMIs in the network can be increased. The 
+          default value of 1 works best unless the UMI is very long (>14bp).
+        default: 1
+      - name: --spliced_is_unique
+        type: boolean_true
+        description: |
+          Causes two reads that start in the same position on the same strand
+          and having the same UMI to be considered unique if one is spliced 
+          and the other is not. (Uses the ‘N’ cigar operation to test for splicing).
+      - name: --soft_clip_threshold
+        type: integer
+        description: |
+          Mappers that soft clip will sometimes do so rather than mapping a
+          spliced read if there is only a small overhang over the exon junction.
+          By setting this option, you can treat reads with at least this many
+          bases soft-clipped at the 3’ end as spliced.
+        default: 4
+      - name: --multimapping_detection_method
+        type: string
+        description: |
+          If the sam/bam contains tags to identify multimapping reads, you can
+          specify for use when selecting the best read at a given loci. Supported
+          tags are “NH”, “X0” and “XT”. If not specified, the read with the highest
+          mapping quality will be selected.
+      - name: --read_length
+        type: integer
+        description: |
+          Use the read length as a criteria when deduping, for e.g sRNA-Seq.
+  
+  - name: Single-cell RNA-Seq Options
+    arguments:
+      - name: --per_gene
+        type: boolean_true
+        description: |
+          Reads will be grouped together if they have the same gene. This is useful
+          if your library prep generates PCR duplicates with non identical alignment
+          positions such as CEL-Seq. Note this option is hardcoded to be on with the
+          count command. I.e counting is always performed per-gene. Must be combined
+          with either --gene_tag or --per_contig option.
+      - name: --gene_tag
+        type: string
+        description: |
+          Deduplicate per gene. The gene information is encoded in the bam read tag
+          specified.
+      - name: --assigned_status_tag
+        type: string
+        description: |
+          BAM tag which describes whether a read is assigned to a gene. Defaults to
+          the same value as given for --gene_tag.
+      - name: --skip_tags_regex
+        type: string
+        description: |
+          Use in conjunction with the --assigned_status_tag option to skip any reads
+          where the tag matches this regex. Default ("^[__|Unassigned]") matches
+          anything which starts with “__” or “Unassigned”.
+      - name: --per_contig
+        type: boolean_true
+        description: |
+          Deduplicate per contig (field 3 in BAM; RNAME). All reads with the same
+          contig will be considered to have the same alignment position. This is
+          useful if you have aligned to a reference transcriptome with one
+          transcript per gene. If you have aligned to a transcriptome with more
+          than one transcript per gene, you can supply a map between transcripts
+          and gene using the --gene_transcript_map option.
+      - name: --gene_transcript_map
+        type: file
+        description: |
+          A file containing a mapping between gene names and transcript names.
+          The file should be tab separated with the gene name in the first column
+          and the transcript name in the second column.
+      - name: --per_cell
+        type: boolean_true
+        description: |
+          Reads will only be grouped together if they have the same cell barcode.
+          Can be combined with --per_gene.
+  
+  - name: SAM/BAM Options
+    arguments:
+      - name: --mapping_quality
+        type: integer
+        description: |
+          Minimium mapping quality (MAPQ) for a read to be retained.
+        default: 0
+      - name: --unmapped_reads
+        type: string
+        description: |
+          How unmapped reads should be handled. 
+          The options are:
+          "discard": Discard all unmapped reads.
+          "use":     If read2 is unmapped, deduplicate using read1 only. 
+                     Requires --paired.
+          "output":  Output unmapped reads/read pairs without UMI 
+                     grouping/deduplication. Only available in umi_tools group.
+        default: discard
+      - name: --chimeric_pairs
+        type: string
+        description: |
+          How chimeric pairs should be handled. 
+          The options are:
+          "discard": Discard all chimeric read pairs.
+          "use":     Deduplicate using read1 only.
+          "output":  Output chimeric pairs without UMI grouping/deduplication. 
+                     Only available in umi_tools group.
+        default: use
+      - name: --unapired_reads
+        type: string
+        description: |
+          How unpaired reads should be handled. 
+          The options are:
+          "discard": Discard all unpaired reads.
+          "use":     Deduplicate using read1 only.
+          "output":  Output unpaired reads without UMI grouping/deduplication. 
+                     Only available in umi_tools group.
+        default: use
+      - name: --ignore_umi
+        type: boolean_true
+        description: |
+          Ignore the UMI and group reads using mapping coordinates only.
+      - name: --subset
+        type: boolean_true
+        description: |
+          Only consider a fraction of the reads, chosen at random. This is useful
+          for doing saturation analyses.
+      - name: --chrom
+        type: string
+        description: |
+          Only consider a single chromosome. This is useful for debugging/testing 
+          purposes.
+  
+  - name: Group/Dedup Options
+    arguments:
+      - name: --no_sort_output
+        type: boolean_true
+        description: |
+          By default, output is sorted. This involves the use of a temporary unsorted
+          file (saved in --temp-dir). Use this option to turn off sorting.
+      - name: --buffer_whole_contig
+        type: boolean_true
+        description: |
+          Forces dedup to parse an entire contig before yielding any reads for
+          deduplication. This is the only way to absolutely guarantee that all reads
+          with the same start position are grouped together for deduplication since
+          dedup uses the start position of the read, not the alignment coordinate on
+          which the reads are sorted. However, by default, dedup reads for another
+          1000bp before outputting read groups which will avoid any reads being missed
+          with short read sequencing (<1000bp).
+
+
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - type: file
+    path: test_data
+engines:
+  - type: docker
+    image: quay.io/biocontainers/umi_tools:1.1.5--py39hf95cd2a_1
+    setup:
+      - type: docker
+        run: |
+            umi_tools -v | sed 's/ version//g' > /var/software_versions.txt
+runners:
+- type: executable
+- type: nextflow
\ No newline at end of file
diff --git a/src/umi_tools/umi_tools_dedup/help.txt b/src/umi_tools/umi_tools_dedup/help.txt
new file mode 100644
index 00000000..d3c8fa44
--- /dev/null
+++ b/src/umi_tools/umi_tools_dedup/help.txt
@@ -0,0 +1,13 @@
+```
+umi_tools dedup
+```
+
+dedup - Deduplicate reads using UMI and mapping coordinates
+
+Usage: umi_tools dedup [OPTIONS] [--stdin=IN_BAM] [--stdout=OUT_BAM]
+
+       note: If --stdout is ommited, standard out is output. To
+             generate a valid BAM file on standard out, please
+             redirect log with --log=LOGFILE or --log2stderr 
+
+For full UMI-tools documentation, see https://umi-tools.readthedocs.io/en/latest/
\ No newline at end of file
diff --git a/src/umi_tools/umi_tools_dedup/script.sh b/src/umi_tools/umi_tools_dedup/script.sh
new file mode 100644
index 00000000..57c01258
--- /dev/null
+++ b/src/umi_tools/umi_tools_dedup/script.sh
@@ -0,0 +1,65 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+set -e
+
+test_dir="${metal_executable}/test_data"
+
+[[ "$par_paired" == "false" ]] && unset par_paired
+[[ "$par_in_sam" == "false" ]] && unset par_in_sam
+[[ "$par_out_sam" == "false" ]] && unset par_out_sam
+[[ "$par_spliced_is_unique" == "false" ]] && unset par_spliced_is_unique
+[[ "$par_per_gene" == "false" ]] && unset par_per_gene
+[[ "$par_per_contig" == "false" ]] && unset par_per_contig
+[[ "$par_per_cell" == "false" ]] && unset par_per_cell
+[[ "$par_no_sort_output" == "false" ]] && unset par_no_sort_output
+[[ "$par_buffer_whole_contig" == "false" ]] && unset par_buffer_whole_contig
+[[ "$par_ignore_umi" == "false" ]] && unset par_ignore_umi
+[[ "$par_subset" == "false" ]] && unset par_subset
+
+
+$(which umi_tools) dedup \
+    -I "$par_input" \
+    ${par_in_sam:+--in-sam} \
+    ${par_bai:+--bai "$par_bai"} \
+    ${par_get_output_stats:+--get-output-stats} \
+    ${par_random_seed:+--random-seed "$par_random_seed"} \
+    -S "$par_output" \
+    ${par_out_sam:+--out-sam} \
+    ${par_paired:+--paired} \
+    ${par_output_stats:+--output-stats "$par_output_stats"} \
+    ${par_extract_umi_method:+--extract-umi-method "$par_extract_umi_method"} \
+    ${par_umi_tag:+--umi-tag "$par_umi_tag"} \
+    ${par_umi_separator:+--umi-separator "$par_umi_separator"} \
+    ${par_umi_tag_split:+--umi-tag-split "$par_umi_tag_split"} \
+    ${par_umi_tag_delimiter:+--umi-tag-delimiter "$par_umi_tag_delimiter"} \
+    ${par_cell_tag:+--cell-tag "$par_cell_tag"} \
+    ${par_cell_tag_split:+--cell-tag-split "$par_cell_tag_split"} \
+    ${par_cell_tag_delimiter:+--cell-tag-delimiter "$par_cell_tag_delimiter"} \
+    ${par_method:+--method "$par_method"} \
+    ${par_edit_distance_threshold:+--edit-distance-threshold "$par_edit_distance_threshold"} \
+    ${par_spliced_is_unique:+--spliced-is-unique} \
+    ${par_soft_clip_threshold:+--soft-clip-threshold "$par_soft_clip_threshold"} \
+    ${par_multimapping_detection_method:+--multimapping-detection-method "$par_multimapping_detection_method"} \
+    ${par_read_length:+--read-length "$par_read_length"} \
+    ${par_per_gene:+--per-gene} \
+    ${par_gene_tag:+--gene-tag "$par_gene_tag"} \
+    ${par_assigned_status_tag:+--assigned-status-tag "$par_assigned_status_tag"} \
+    ${par_skip_tags_regex:+--skip-tags-regex "$par_skip_tags_regex"} \
+    ${par_per_contig:+--per-contig}
+    ${par_gene_transcript_map:+--gene-transcript-map "$par_gene_transcript_map"} \
+    ${par_per_cell:+--per-cell} \
+    ${par_mapping_quality:+--mapping-quality "$par_mapping_quality"} \
+    ${par_unmapped_reads:+--unmapped-reads "$par_unmapped_reads"} \
+    ${par_chimeric_pairs:+--chimeric-pairs "$par_chimeric_pairs"} \
+    ${par_unapired_reads:+--unapired-reads "$par_unapired_reads"} \
+    ${par_ignore_umi:+--ignore-umi} \
+    ${par_subset:+--subset} \
+    ${par_chrom:+--chrom "$par_chrom"} \
+    ${par_no_sort_output:+--no-sort-output} \
+    ${par_buffer_whole_contig:+--buffer-whole-contig}
+
+
+exit 0
\ No newline at end of file
diff --git a/src/umi_tools/umi_tools_dedup/test.sh b/src/umi_tools/umi_tools_dedup/test.sh
new file mode 100644
index 00000000..1459ec08
--- /dev/null
+++ b/src/umi_tools/umi_tools_dedup/test.sh
@@ -0,0 +1,49 @@
+#!/bin/bash
+
+test_dir="${meta_resources_dir}/test_data"
+echo ">>> Testing $meta_functionality_name"
+
+"$meta_executable" \
+  --bam "$test_dir/a.sorted.bam" \
+  --bai "$test_dir/a.sorted.bam.bai" \
+  --output "$test_dir/a.sorted.idxstats"
+
+echo ">>> Checking whether output exists"
+[ ! -f "$test_dir/a.sorted.idxstats" ] && echo "File 'a.sorted.idxstats' does not exist!" && exit 1
+
+echo ">>> Checking whether output is non-empty"
+[ ! -s "$test_dir/a.sorted.idxstats" ] && echo "File 'a.sorted.idxstats' is empty!" && exit 1
+
+echo ">>> Checking whether output is correct"
+diff "$test_dir/a.sorted.idxstats" "$test_dir/a_ref.sorted.idxstats" || \
+    (echo "Output file a.sorted.idxstats does not match expected output" && exit 1)
+
+rm "$test_dir/a.sorted.idxstats"
+
+############################################################################################
+
+echo ">>> Testing $meta_functionality_name with singletons in the input"
+
+"$meta_executable" \
+  --bam "$test_dir/test.paired_end.sorted.bam" \
+  --bai "$test_dir/test.paired_end.sorted.bam.bai" \
+  --output "$test_dir/test.paired_end.sorted.idxstats"
+
+echo ">>> Checking whether output exists"
+[ ! -f "$test_dir/test.paired_end.sorted.idxstats" ] && \
+    echo "File 'test.paired_end.sorted.idxstats' does not exist!" && exit 1
+
+echo ">>> Checking whether output is non-empty"
+[ ! -s "$test_dir/test.paired_end.sorted.idxstats" ] && \
+    echo "File 'test.paired_end.sorted.idxstats' is empty!" && exit 1
+
+echo ">>> Checking whether output is correct"
+diff "$test_dir/test.paired_end.sorted.idxstats" "$test_dir/test_ref.paired_end.sorted.idxstats" || \
+    (echo "Output file test.paired_end.sorted.idxstats does not match expected output" && exit 1)
+
+rm "$test_dir/test.paired_end.sorted.idxstats"
+
+############################################################################################
+
+echo "All tests succeeded!"
+exit 0
\ No newline at end of file

From 2c269682620a407803e528652198646435ef2c03 Mon Sep 17 00:00:00 2001
From: emmarousseau <emmarou1@icloud.com>
Date: Thu, 11 Apr 2024 11:38:57 +0100
Subject: [PATCH 2/6] Revert "initial commit dedup"

This reverts commit 38f586bec0ac9e4312b016e29c3aa0bd53f292b2.
---
 CHANGELOG.md                                  |   3 -
 src/umi_tools/umi_tools_dedup/config.vsh.yaml | 279 ------------------
 src/umi_tools/umi_tools_dedup/help.txt        |  13 -
 src/umi_tools/umi_tools_dedup/script.sh       |  65 ----
 src/umi_tools/umi_tools_dedup/test.sh         |  49 ---
 5 files changed, 409 deletions(-)
 delete mode 100644 src/umi_tools/umi_tools_dedup/config.vsh.yaml
 delete mode 100644 src/umi_tools/umi_tools_dedup/help.txt
 delete mode 100644 src/umi_tools/umi_tools_dedup/script.sh
 delete mode 100644 src/umi_tools/umi_tools_dedup/test.sh

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 1bef9345..4fd7f001 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -39,9 +39,6 @@
     - `samtools/flagstat`: Counts the number of alignments in SAM/BAM/CRAM files for each FLAG type (PR #31).
     - `samtools/idxstats`: Reports alignment summary statistics for a SAM/BAM/CRAM file (PR #32).
 
-* `umi_tools`:
-    - `umi_tools/umi_tools_dedup`: Deduplicate reads based on the mapping co-ordinate and the UMI attached to the read (PR #).
-    
 ## MAJOR CHANGES
 
 ## MINOR CHANGES
diff --git a/src/umi_tools/umi_tools_dedup/config.vsh.yaml b/src/umi_tools/umi_tools_dedup/config.vsh.yaml
deleted file mode 100644
index 75306541..00000000
--- a/src/umi_tools/umi_tools_dedup/config.vsh.yaml
+++ /dev/null
@@ -1,279 +0,0 @@
-name: umi_tool_dedup
-namespace: umi_tools
-description: |
-  Deduplicate reads based on the mapping co-ordinate and the UMI attached to the read.
-keywords: [umi_tools, deduplication, dedup]
-links:
-  homepage: https://umi-tools.readthedocs.io/en/latest/
-  documentation: [ https://umi-tools.readthedocs.io/en/latest/reference/dedup.html,
-                   https://umi-tools.readthedocs.io/en/latest/common_options.html#common-options ]
-  repository: https://github.com/CGATOxford/UMI-tools
-references: 
-  doi: 10.1101/gr.209601.116
-license: MIT
-
-argument_groups:
-  - name: Inputs
-    arguments:
-      - name: --input
-        alternatives: -I
-        type: file
-        description: Input BAM or SAM file. Use --in_sam to specify SAM format.
-        required: true
-      - name: --in_sam
-        type: boolean_true
-        description: |
-          By default, inputs are assumed to be in BAM format. Use this options 
-          to specify the use of SAM format for input.
-      - name: --bai
-        type: file
-        description: BAM index
-      - name: --get_output_stats
-        type: boolean
-        description: Whether or not to generate output stats. 
-      - name: --random_seed
-        type: integer
-        description: |
-          Random seed to initialize number generator with.
-        default: none
-
-  - name: Outputs
-    arguments:
-      - name: --output
-        alternatives: -S
-        type: file
-        description: Deduplicated BAM file
-        required: true
-        direction: output
-      - name: --out_sam
-        type: boolean_true
-        description: |
-          By default, outputa are written in BAM format. Use this options to 
-          specify the use of SAM format for output.
-      - name: --paired
-        type: boolean_true
-        description: |
-          BAM is paired end - output both read pairs. This will also force the
-          use of the template length to determine reads with the same mapping
-          coordinates.
-      - name: --output_stats
-        type: file
-        description: Directory containing UMI based deduplication statistics files
-        direction: output
-      - name: --extract_umi_method
-        type: string
-        description: |
-          Specify the method by which the barcodes were encoded in the read.
-          The options are: [read_id, tag, umis].
-        default: read_id
-      - name: --umi_tag
-        type: string
-        description: |
-          The tag containing the UMI sequence. 
-          This is only required if the extract_umi_method is set to tag.
-      - name: --umi_separator
-        type: string
-        description: |
-          The separator used to separate the UMI from the read sequence. 
-          This is only required if the extract_umi_method is set to id_read.
-        default: '_'
-      - name: --umi_tag_split
-        type: string
-        description: |
-          Separate the UMI in tag by <SPLIT> and take the first element.
-      - name: --umi_tag_delimiter
-        type: string
-        description: |
-          Separate the UMI in by <DELIMITER> and concatenate the elements
-      - name: --cell_tag
-        type: string
-        description: |
-          The tag containing the cell barcode sequence. 
-          This is only required if the extract_umi_method is set to tag.
-      - name: --cell_tag_split
-        type: string
-        description: |
-          Separate the cell barcode in tag by <SPLIT> and take the first element.
-      - name: --cell_tag_delimiter
-        type: string
-        description: |
-          Separate the cell barcode in by <DELIMITER> and concatenate the elements
-  
-  - name: Grouping Options
-    arguments:    
-      - name: --method
-        type: string
-        description: |
-          The method to use for grouping reads. The options are: 
-          [unique, percentile, cluster, adjacency, directional].
-        default: directional
-      - name: --edit_distance_threshold
-        type: integer
-        description: |
-          For the adjacency and cluster methods the threshold for the edit 
-          distance to connect two UMIs in the network can be increased. The 
-          default value of 1 works best unless the UMI is very long (>14bp).
-        default: 1
-      - name: --spliced_is_unique
-        type: boolean_true
-        description: |
-          Causes two reads that start in the same position on the same strand
-          and having the same UMI to be considered unique if one is spliced 
-          and the other is not. (Uses the ‘N’ cigar operation to test for splicing).
-      - name: --soft_clip_threshold
-        type: integer
-        description: |
-          Mappers that soft clip will sometimes do so rather than mapping a
-          spliced read if there is only a small overhang over the exon junction.
-          By setting this option, you can treat reads with at least this many
-          bases soft-clipped at the 3’ end as spliced.
-        default: 4
-      - name: --multimapping_detection_method
-        type: string
-        description: |
-          If the sam/bam contains tags to identify multimapping reads, you can
-          specify for use when selecting the best read at a given loci. Supported
-          tags are “NH”, “X0” and “XT”. If not specified, the read with the highest
-          mapping quality will be selected.
-      - name: --read_length
-        type: integer
-        description: |
-          Use the read length as a criteria when deduping, for e.g sRNA-Seq.
-  
-  - name: Single-cell RNA-Seq Options
-    arguments:
-      - name: --per_gene
-        type: boolean_true
-        description: |
-          Reads will be grouped together if they have the same gene. This is useful
-          if your library prep generates PCR duplicates with non identical alignment
-          positions such as CEL-Seq. Note this option is hardcoded to be on with the
-          count command. I.e counting is always performed per-gene. Must be combined
-          with either --gene_tag or --per_contig option.
-      - name: --gene_tag
-        type: string
-        description: |
-          Deduplicate per gene. The gene information is encoded in the bam read tag
-          specified.
-      - name: --assigned_status_tag
-        type: string
-        description: |
-          BAM tag which describes whether a read is assigned to a gene. Defaults to
-          the same value as given for --gene_tag.
-      - name: --skip_tags_regex
-        type: string
-        description: |
-          Use in conjunction with the --assigned_status_tag option to skip any reads
-          where the tag matches this regex. Default ("^[__|Unassigned]") matches
-          anything which starts with “__” or “Unassigned”.
-      - name: --per_contig
-        type: boolean_true
-        description: |
-          Deduplicate per contig (field 3 in BAM; RNAME). All reads with the same
-          contig will be considered to have the same alignment position. This is
-          useful if you have aligned to a reference transcriptome with one
-          transcript per gene. If you have aligned to a transcriptome with more
-          than one transcript per gene, you can supply a map between transcripts
-          and gene using the --gene_transcript_map option.
-      - name: --gene_transcript_map
-        type: file
-        description: |
-          A file containing a mapping between gene names and transcript names.
-          The file should be tab separated with the gene name in the first column
-          and the transcript name in the second column.
-      - name: --per_cell
-        type: boolean_true
-        description: |
-          Reads will only be grouped together if they have the same cell barcode.
-          Can be combined with --per_gene.
-  
-  - name: SAM/BAM Options
-    arguments:
-      - name: --mapping_quality
-        type: integer
-        description: |
-          Minimium mapping quality (MAPQ) for a read to be retained.
-        default: 0
-      - name: --unmapped_reads
-        type: string
-        description: |
-          How unmapped reads should be handled. 
-          The options are:
-          "discard": Discard all unmapped reads.
-          "use":     If read2 is unmapped, deduplicate using read1 only. 
-                     Requires --paired.
-          "output":  Output unmapped reads/read pairs without UMI 
-                     grouping/deduplication. Only available in umi_tools group.
-        default: discard
-      - name: --chimeric_pairs
-        type: string
-        description: |
-          How chimeric pairs should be handled. 
-          The options are:
-          "discard": Discard all chimeric read pairs.
-          "use":     Deduplicate using read1 only.
-          "output":  Output chimeric pairs without UMI grouping/deduplication. 
-                     Only available in umi_tools group.
-        default: use
-      - name: --unapired_reads
-        type: string
-        description: |
-          How unpaired reads should be handled. 
-          The options are:
-          "discard": Discard all unpaired reads.
-          "use":     Deduplicate using read1 only.
-          "output":  Output unpaired reads without UMI grouping/deduplication. 
-                     Only available in umi_tools group.
-        default: use
-      - name: --ignore_umi
-        type: boolean_true
-        description: |
-          Ignore the UMI and group reads using mapping coordinates only.
-      - name: --subset
-        type: boolean_true
-        description: |
-          Only consider a fraction of the reads, chosen at random. This is useful
-          for doing saturation analyses.
-      - name: --chrom
-        type: string
-        description: |
-          Only consider a single chromosome. This is useful for debugging/testing 
-          purposes.
-  
-  - name: Group/Dedup Options
-    arguments:
-      - name: --no_sort_output
-        type: boolean_true
-        description: |
-          By default, output is sorted. This involves the use of a temporary unsorted
-          file (saved in --temp-dir). Use this option to turn off sorting.
-      - name: --buffer_whole_contig
-        type: boolean_true
-        description: |
-          Forces dedup to parse an entire contig before yielding any reads for
-          deduplication. This is the only way to absolutely guarantee that all reads
-          with the same start position are grouped together for deduplication since
-          dedup uses the start position of the read, not the alignment coordinate on
-          which the reads are sorted. However, by default, dedup reads for another
-          1000bp before outputting read groups which will avoid any reads being missed
-          with short read sequencing (<1000bp).
-
-
-resources:
-  - type: bash_script
-    path: script.sh
-test_resources:
-  - type: bash_script
-    path: test.sh
-  - type: file
-    path: test_data
-engines:
-  - type: docker
-    image: quay.io/biocontainers/umi_tools:1.1.5--py39hf95cd2a_1
-    setup:
-      - type: docker
-        run: |
-            umi_tools -v | sed 's/ version//g' > /var/software_versions.txt
-runners:
-- type: executable
-- type: nextflow
\ No newline at end of file
diff --git a/src/umi_tools/umi_tools_dedup/help.txt b/src/umi_tools/umi_tools_dedup/help.txt
deleted file mode 100644
index d3c8fa44..00000000
--- a/src/umi_tools/umi_tools_dedup/help.txt
+++ /dev/null
@@ -1,13 +0,0 @@
-```
-umi_tools dedup
-```
-
-dedup - Deduplicate reads using UMI and mapping coordinates
-
-Usage: umi_tools dedup [OPTIONS] [--stdin=IN_BAM] [--stdout=OUT_BAM]
-
-       note: If --stdout is ommited, standard out is output. To
-             generate a valid BAM file on standard out, please
-             redirect log with --log=LOGFILE or --log2stderr 
-
-For full UMI-tools documentation, see https://umi-tools.readthedocs.io/en/latest/
\ No newline at end of file
diff --git a/src/umi_tools/umi_tools_dedup/script.sh b/src/umi_tools/umi_tools_dedup/script.sh
deleted file mode 100644
index 57c01258..00000000
--- a/src/umi_tools/umi_tools_dedup/script.sh
+++ /dev/null
@@ -1,65 +0,0 @@
-#!/bin/bash
-
-## VIASH START
-## VIASH END
-
-set -e
-
-test_dir="${metal_executable}/test_data"
-
-[[ "$par_paired" == "false" ]] && unset par_paired
-[[ "$par_in_sam" == "false" ]] && unset par_in_sam
-[[ "$par_out_sam" == "false" ]] && unset par_out_sam
-[[ "$par_spliced_is_unique" == "false" ]] && unset par_spliced_is_unique
-[[ "$par_per_gene" == "false" ]] && unset par_per_gene
-[[ "$par_per_contig" == "false" ]] && unset par_per_contig
-[[ "$par_per_cell" == "false" ]] && unset par_per_cell
-[[ "$par_no_sort_output" == "false" ]] && unset par_no_sort_output
-[[ "$par_buffer_whole_contig" == "false" ]] && unset par_buffer_whole_contig
-[[ "$par_ignore_umi" == "false" ]] && unset par_ignore_umi
-[[ "$par_subset" == "false" ]] && unset par_subset
-
-
-$(which umi_tools) dedup \
-    -I "$par_input" \
-    ${par_in_sam:+--in-sam} \
-    ${par_bai:+--bai "$par_bai"} \
-    ${par_get_output_stats:+--get-output-stats} \
-    ${par_random_seed:+--random-seed "$par_random_seed"} \
-    -S "$par_output" \
-    ${par_out_sam:+--out-sam} \
-    ${par_paired:+--paired} \
-    ${par_output_stats:+--output-stats "$par_output_stats"} \
-    ${par_extract_umi_method:+--extract-umi-method "$par_extract_umi_method"} \
-    ${par_umi_tag:+--umi-tag "$par_umi_tag"} \
-    ${par_umi_separator:+--umi-separator "$par_umi_separator"} \
-    ${par_umi_tag_split:+--umi-tag-split "$par_umi_tag_split"} \
-    ${par_umi_tag_delimiter:+--umi-tag-delimiter "$par_umi_tag_delimiter"} \
-    ${par_cell_tag:+--cell-tag "$par_cell_tag"} \
-    ${par_cell_tag_split:+--cell-tag-split "$par_cell_tag_split"} \
-    ${par_cell_tag_delimiter:+--cell-tag-delimiter "$par_cell_tag_delimiter"} \
-    ${par_method:+--method "$par_method"} \
-    ${par_edit_distance_threshold:+--edit-distance-threshold "$par_edit_distance_threshold"} \
-    ${par_spliced_is_unique:+--spliced-is-unique} \
-    ${par_soft_clip_threshold:+--soft-clip-threshold "$par_soft_clip_threshold"} \
-    ${par_multimapping_detection_method:+--multimapping-detection-method "$par_multimapping_detection_method"} \
-    ${par_read_length:+--read-length "$par_read_length"} \
-    ${par_per_gene:+--per-gene} \
-    ${par_gene_tag:+--gene-tag "$par_gene_tag"} \
-    ${par_assigned_status_tag:+--assigned-status-tag "$par_assigned_status_tag"} \
-    ${par_skip_tags_regex:+--skip-tags-regex "$par_skip_tags_regex"} \
-    ${par_per_contig:+--per-contig}
-    ${par_gene_transcript_map:+--gene-transcript-map "$par_gene_transcript_map"} \
-    ${par_per_cell:+--per-cell} \
-    ${par_mapping_quality:+--mapping-quality "$par_mapping_quality"} \
-    ${par_unmapped_reads:+--unmapped-reads "$par_unmapped_reads"} \
-    ${par_chimeric_pairs:+--chimeric-pairs "$par_chimeric_pairs"} \
-    ${par_unapired_reads:+--unapired-reads "$par_unapired_reads"} \
-    ${par_ignore_umi:+--ignore-umi} \
-    ${par_subset:+--subset} \
-    ${par_chrom:+--chrom "$par_chrom"} \
-    ${par_no_sort_output:+--no-sort-output} \
-    ${par_buffer_whole_contig:+--buffer-whole-contig}
-
-
-exit 0
\ No newline at end of file
diff --git a/src/umi_tools/umi_tools_dedup/test.sh b/src/umi_tools/umi_tools_dedup/test.sh
deleted file mode 100644
index 1459ec08..00000000
--- a/src/umi_tools/umi_tools_dedup/test.sh
+++ /dev/null
@@ -1,49 +0,0 @@
-#!/bin/bash
-
-test_dir="${meta_resources_dir}/test_data"
-echo ">>> Testing $meta_functionality_name"
-
-"$meta_executable" \
-  --bam "$test_dir/a.sorted.bam" \
-  --bai "$test_dir/a.sorted.bam.bai" \
-  --output "$test_dir/a.sorted.idxstats"
-
-echo ">>> Checking whether output exists"
-[ ! -f "$test_dir/a.sorted.idxstats" ] && echo "File 'a.sorted.idxstats' does not exist!" && exit 1
-
-echo ">>> Checking whether output is non-empty"
-[ ! -s "$test_dir/a.sorted.idxstats" ] && echo "File 'a.sorted.idxstats' is empty!" && exit 1
-
-echo ">>> Checking whether output is correct"
-diff "$test_dir/a.sorted.idxstats" "$test_dir/a_ref.sorted.idxstats" || \
-    (echo "Output file a.sorted.idxstats does not match expected output" && exit 1)
-
-rm "$test_dir/a.sorted.idxstats"
-
-############################################################################################
-
-echo ">>> Testing $meta_functionality_name with singletons in the input"
-
-"$meta_executable" \
-  --bam "$test_dir/test.paired_end.sorted.bam" \
-  --bai "$test_dir/test.paired_end.sorted.bam.bai" \
-  --output "$test_dir/test.paired_end.sorted.idxstats"
-
-echo ">>> Checking whether output exists"
-[ ! -f "$test_dir/test.paired_end.sorted.idxstats" ] && \
-    echo "File 'test.paired_end.sorted.idxstats' does not exist!" && exit 1
-
-echo ">>> Checking whether output is non-empty"
-[ ! -s "$test_dir/test.paired_end.sorted.idxstats" ] && \
-    echo "File 'test.paired_end.sorted.idxstats' is empty!" && exit 1
-
-echo ">>> Checking whether output is correct"
-diff "$test_dir/test.paired_end.sorted.idxstats" "$test_dir/test_ref.paired_end.sorted.idxstats" || \
-    (echo "Output file test.paired_end.sorted.idxstats does not match expected output" && exit 1)
-
-rm "$test_dir/test.paired_end.sorted.idxstats"
-
-############################################################################################
-
-echo "All tests succeeded!"
-exit 0
\ No newline at end of file

From d07a42a4a14f3a0a34ea2a08f1100150ffd62ff7 Mon Sep 17 00:00:00 2001
From: emmarousseau <emmarou1@icloud.com>
Date: Sun, 15 Sep 2024 11:50:32 +0200
Subject: [PATCH 3/6] complete component

---
 src/kallisto/kallisto_quant/config.vsh.yaml   | 103 ++++++++++++++++++
 src/kallisto/kallisto_quant/script.sh         |  46 ++++++++
 src/kallisto/kallisto_quant/test.sh           |  53 +++++++++
 .../kallisto_quant/test_data/abundance_1.tsv  |   2 +
 .../kallisto_quant/test_data/abundance_2.tsv  |   2 +
 .../test_data/index/transcriptome.idx         | Bin 0 -> 1583 bytes
 .../kallisto_quant/test_data/reads/A_R1.fastq |   4 +
 .../kallisto_quant/test_data/reads/A_R2.fastq |   4 +
 .../kallisto_quant/test_data/script.sh        |  11 ++
 9 files changed, 225 insertions(+)
 create mode 100644 src/kallisto/kallisto_quant/config.vsh.yaml
 create mode 100644 src/kallisto/kallisto_quant/script.sh
 create mode 100644 src/kallisto/kallisto_quant/test.sh
 create mode 100644 src/kallisto/kallisto_quant/test_data/abundance_1.tsv
 create mode 100644 src/kallisto/kallisto_quant/test_data/abundance_2.tsv
 create mode 100644 src/kallisto/kallisto_quant/test_data/index/transcriptome.idx
 create mode 100644 src/kallisto/kallisto_quant/test_data/reads/A_R1.fastq
 create mode 100644 src/kallisto/kallisto_quant/test_data/reads/A_R2.fastq
 create mode 100755 src/kallisto/kallisto_quant/test_data/script.sh

diff --git a/src/kallisto/kallisto_quant/config.vsh.yaml b/src/kallisto/kallisto_quant/config.vsh.yaml
new file mode 100644
index 00000000..4fb7b0fe
--- /dev/null
+++ b/src/kallisto/kallisto_quant/config.vsh.yaml
@@ -0,0 +1,103 @@
+name: kallisto_quant
+namespace: kallisto
+description: |
+  Quantifying abundances of transcripts from RNA-Seq data, or more generally of target sequences using high-throughput sequencing reads.
+keywords: [kallisto, quant, pseudoalignment]
+links:
+  homepage: https://pachterlab.github.io/kallisto/about
+  documentation: https://pachterlab.github.io/kallisto/manual
+  repository: https://github.com/pachterlab/kallisto
+  issue_tracker: https://github.com/pachterlab/kallisto/issues
+references: 
+  doi: https://doi.org/10.1038/nbt.3519
+license: BSD 2-Clause License
+
+argument_groups:
+- name: "Input"
+  arguments:
+  - name: "--input"
+    type: file
+    description: List of input FastQ files of size 1 and 2 for single-end and paired-end data, respectively.
+    direction: "input"
+    multiple: true
+    required: true
+  - name: "--index"
+    alternatives: ["-i"]
+    type: file
+    description: Kallisto genome index.
+    must_exist: true
+    required: true
+
+- name: "Output"
+  arguments:
+  - name: "--output_dir"
+    alternatives: ["-o"]
+    type: string
+    description: Directory to write output to.
+    required: true
+
+- name: "Options"
+  arguments:
+  - name: "--single"
+    type: boolean_true
+    description: Single end mode.
+  - name: "--single_overhang"
+    type: boolean_true
+    description: Include reads where unobserved rest of fragment is predicted to lie outside a transcript.
+  - name: "--fr_stranded"
+    type: boolean_true
+    description: Strand specific reads, first read forward.
+  - name: "--rf_stranded"
+    type: boolean_true
+    description: Strand specific reads, first read reverse.
+  - name: "--fragment_length"
+    alternatives: ["-l"]
+    type: double
+    description: The estimated average fragment length.
+  - name: "--sd"
+    alternatives: ["-s"]
+    type: double
+    description: |
+      The estimated standard deviation of the fragment length (default: -l, -s values are estimated 
+      from paired end data, but are required when using --single).
+  - name: "--plaintext"
+    type: boolean_true
+    description: Output plaintext instead of HDF5.
+  - name: "--bootstrap_samples"
+    alternatives: ["-b"]
+    type: integer
+    description: |
+      Number of bootstrap samples to draw. Default: '0'
+    example: 0
+  - name: "--seed"
+    type: integer
+    description: |
+      Random seed for bootstrap. Default: '42'
+    example: 42
+
+
+resources:
+- type: bash_script
+  path: script.sh
+
+test_resources:
+- type: bash_script
+  path: test.sh
+- type: file
+  path: test_data
+
+engines:
+  - type: docker
+    image: ubuntu:22.04
+    setup:
+      - type: docker
+        run: |
+          apt-get update && \
+          apt-get install -y --no-install-recommends wget && \
+          wget --no-check-certificate https://github.com/pachterlab/kallisto/releases/download/v0.50.1/kallisto_linux-v0.50.1.tar.gz && \
+          tar -xzf kallisto_linux-v0.50.1.tar.gz && \
+          mv kallisto/kallisto /usr/local/bin/ && \
+          echo "kallisto: $(kallisto version | sed 's/kallisto, version //')" > /var/software_versions.txt
+runners:
+  - type: executable
+  - type: nextflow  
diff --git a/src/kallisto/kallisto_quant/script.sh b/src/kallisto/kallisto_quant/script.sh
new file mode 100644
index 00000000..a7105cd1
--- /dev/null
+++ b/src/kallisto/kallisto_quant/script.sh
@@ -0,0 +1,46 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+set -eo pipefail
+
+unset_if_false=( par_single par_single_overhang par_rf_stranded par_fr_stranded par_plaintext )
+
+for var in "${unset_if_false[@]}"; do
+    temp_var="${!var}"
+    [[ "$temp_var" == "false" ]] && unset $var
+done
+
+IFS=";" read -ra input <<< $par_input
+
+# Check if par_single is not set and ensure even number of input files
+if [ -z "$par_single" ]; then
+    if [ $((${#input[@]} % 2)) -ne 0 ]; then
+        echo "Error: When running in paired-end mode, the number of input files must be even."
+        echo "Number of input files provided: ${#input[@]}"
+        exit 1
+    fi
+fi
+
+
+mkdir -p $par_output_dir
+
+
+kallisto quant \
+    ${meta_cpus:+--threads $meta_cpus} \
+    -i $par_index \
+    ${par_gtf:+--gtf "${par_gtf}"} \
+    ${par_single:+--single} \
+    ${par_single_overhang:+--single-overhang} \
+    ${par_fr_stranded:+--fr-stranded} \
+    ${par_rf_stranded:+--rf-stranded} \
+    ${par_plaintext:+--plaintext} \
+    ${par_bootstrap_samples:+--bootstrap-samples "${par_bootstrap_samples}"} \
+    ${par_fragment_length:+--fragment-length "${par_fragment_length}"} \
+    ${par_sd:+--sd "${par_sd}"} \
+    ${par_seed:+--seed "${par_seed}"} \
+    -o $par_output_dir \
+    ${input[*]}
+
+
diff --git a/src/kallisto/kallisto_quant/test.sh b/src/kallisto/kallisto_quant/test.sh
new file mode 100644
index 00000000..28e2e3ad
--- /dev/null
+++ b/src/kallisto/kallisto_quant/test.sh
@@ -0,0 +1,53 @@
+#!/bin/bash
+
+echo ">>> Testing $meta_functionality_name"
+
+echo ">>> Test 1: Testing for paired-end reads"
+"$meta_executable" \
+  --index "$meta_resources_dir/test_data/index/transcriptome.idx" \
+  --rf_stranded \
+  --output_dir . \
+  --input "$meta_resources_dir/test_data/reads/A_R1.fastq;$meta_resources_dir/test_data/reads/A_R2.fastq"
+
+echo ">>> Checking whether output exists"
+[ ! -f "run_info.json" ] && echo "run_info.json does not exist!" && exit 1
+[ ! -s "run_info.json" ] && echo "run_info.json is empty!" && exit 1
+[ ! -f "abundance.tsv" ] && echo "abundance.tsv does not exist!" && exit 1
+[ ! -s "abundance.tsv" ] && echo "abundance.tsv is empty!" && exit 1
+[ ! -f "abundance.h5" ] && echo "abundance.h5 does not exist!" && exit 1
+[ ! -s "abundance.h5" ] && echo "abundance.h5 is empty!" && exit 1
+
+echo ">>> Checking if output is correct"
+diff "abundance.tsv" "$meta_resources_dir/test_data/abundance_1.tsv" || { echo "abundance.tsv is not correct"; exit 1; }
+
+rm -rf abundance.tsv abundance.h5 run_info.json
+
+################################################################################
+
+echo ">>> Test 2: Testing for single-end reads"
+"$meta_executable" \
+  --index "$meta_resources_dir/test_data/index/transcriptome.idx" \
+  --rf_stranded \
+  --output_dir . \
+  --single \
+  --input "$meta_resources_dir/test_data/reads/A_R1.fastq" \
+  --fragment_length 101 \
+  --sd 50
+
+echo ">>> Checking whether output exists"
+[ ! -f "run_info.json" ] && echo "run_info.json does not exist!" && exit 1
+[ ! -s "run_info.json" ] && echo "run_info.json is empty!" && exit 1
+[ ! -f "abundance.tsv" ] && echo "abundance.tsv does not exist!" && exit 1
+[ ! -s "abundance.tsv" ] && echo "abundance.tsv is empty!" && exit 1
+[ ! -f "abundance.h5" ] && echo "abundance.h5 does not exist!" && exit 1
+[ ! -s "abundance.h5" ] && echo "abundance.h5 is empty!" && exit 1
+
+echo ">>> Checking if output is correct"
+diff "abundance.tsv" "$meta_resources_dir/test_data/abundance_2.tsv" || { echo "abundance.tsv is not correct"; exit 1; }
+
+rm -rf abundance.tsv abundance.h5 run_info.json
+
+################################################################################
+
+echo "All tests succeeded!"
+exit 0
diff --git a/src/kallisto/kallisto_quant/test_data/abundance_1.tsv b/src/kallisto/kallisto_quant/test_data/abundance_1.tsv
new file mode 100644
index 00000000..1de99e54
--- /dev/null
+++ b/src/kallisto/kallisto_quant/test_data/abundance_1.tsv
@@ -0,0 +1,2 @@
+target_id	length	eff_length	est_counts	tpm
+Sheila	35	36	0	-nan
diff --git a/src/kallisto/kallisto_quant/test_data/abundance_2.tsv b/src/kallisto/kallisto_quant/test_data/abundance_2.tsv
new file mode 100644
index 00000000..6b3e9055
--- /dev/null
+++ b/src/kallisto/kallisto_quant/test_data/abundance_2.tsv
@@ -0,0 +1,2 @@
+target_id	length	eff_length	est_counts	tpm
+Sheila	35	15.0373	0	-nan
diff --git a/src/kallisto/kallisto_quant/test_data/index/transcriptome.idx b/src/kallisto/kallisto_quant/test_data/index/transcriptome.idx
new file mode 100644
index 0000000000000000000000000000000000000000..194fec14b9b858e324345e535e00764a36100db7
GIT binary patch
literal 1583
zcmd;OfPjTinh{9b$1B#!18H#}2Jt~a8A36bm2ogIJfAt+63T~DAce8EHEN$uybqZC
zfg=W{5v~BrV208#c|}Et0E`c#VftWv7=48WCIhA&B!LvnOc?C|Rl)?N*?=^%HkesZ
zX$A)<1EwA(4x?e}ahVTO2ct*TLqcLSJR#vQnjS{e1FUQS(dg*`Sq@nqrq10t#1V*{
z9o-$_AjH`nh=7E<vpG~hSUD?@!wD0B833cPN+<(WgGxvc2+l~&%t;i2a2Tu%5N;I!
Giva)u(jTM%

literal 0
HcmV?d00001

diff --git a/src/kallisto/kallisto_quant/test_data/reads/A_R1.fastq b/src/kallisto/kallisto_quant/test_data/reads/A_R1.fastq
new file mode 100644
index 00000000..999ed649
--- /dev/null
+++ b/src/kallisto/kallisto_quant/test_data/reads/A_R1.fastq
@@ -0,0 +1,4 @@
+@1
+GCTAGCTCAGAAAAAAAAAATCGTCGCGTGCGCGT
++
+!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
diff --git a/src/kallisto/kallisto_quant/test_data/reads/A_R2.fastq b/src/kallisto/kallisto_quant/test_data/reads/A_R2.fastq
new file mode 100644
index 00000000..999ed649
--- /dev/null
+++ b/src/kallisto/kallisto_quant/test_data/reads/A_R2.fastq
@@ -0,0 +1,4 @@
+@1
+GCTAGCTCAGAAAAAAAAAATCGTCGCGTGCGCGT
++
+!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
diff --git a/src/kallisto/kallisto_quant/test_data/script.sh b/src/kallisto/kallisto_quant/test_data/script.sh
new file mode 100755
index 00000000..6d684b29
--- /dev/null
+++ b/src/kallisto/kallisto_quant/test_data/script.sh
@@ -0,0 +1,11 @@
+#!/bin/bash
+
+# clone repo
+if [ ! -d /tmp/snakemake-wrappers ]; then
+  git clone --depth 1 --single-branch --branch master https://github.com/snakemake/snakemake-wrappers /tmp/snakemake-wrappers
+fi
+
+# copy test data
+cp -r /tmp/snakemake-wrappers/bio/kallisto/quant/test/* src/kallisto/kallisto_quant/test_data
+
+rm src/kallisto/kallisto_quant/test_data/Snakefile
\ No newline at end of file

From 81fdf59df5216f68c056d1dd3b2f49f1e2e9fbf3 Mon Sep 17 00:00:00 2001
From: emmarousseau <emmarou1@icloud.com>
Date: Sun, 15 Sep 2024 11:54:50 +0200
Subject: [PATCH 4/6] Update changelog

---
 CHANGELOG.md | 4 ++++
 1 file changed, 4 insertions(+)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 3e9f40fc..9ff0bf83 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -36,6 +36,10 @@
 
 * `rsem/rsem_prepare_reference`: Prepare transcript references for RSEM (PR #89).
 
+* `kallisto`:
+  - `kallisto/kallisto_quant`: Quantifying abundances of transcripts from RNA-Seq data, or more generally of target sequences  
+                               using high-throughput sequencing reads (PR #152).
+
 ## MINOR CHANGES
 
 * `busco` components: update BUSCO to `5.7.1` (PR #72).

From a62b87b1153ee66d4355c3eab32338fe59c4f09b Mon Sep 17 00:00:00 2001
From: emmarousseau <emmarou1@icloud.com>
Date: Sun, 15 Sep 2024 12:17:25 +0200
Subject: [PATCH 5/6] add help.txt

---
 src/kallisto/kallisto_quant/help.txt | 33 ++++++++++++++++++++++++++++
 1 file changed, 33 insertions(+)
 create mode 100644 src/kallisto/kallisto_quant/help.txt

diff --git a/src/kallisto/kallisto_quant/help.txt b/src/kallisto/kallisto_quant/help.txt
new file mode 100644
index 00000000..7022571b
--- /dev/null
+++ b/src/kallisto/kallisto_quant/help.txt
@@ -0,0 +1,33 @@
+```
+kallisto quant
+```
+
+kallisto 0.50.1
+Computes equivalence classes for reads and quantifies abundances
+
+Usage: kallisto quant [arguments] FASTQ-files
+
+Required arguments:
+-i, --index=STRING            Filename for the kallisto index to be used for
+                              quantification
+-o, --output-dir=STRING       Directory to write output to
+
+Optional arguments:
+-b, --bootstrap-samples=INT   Number of bootstrap samples (default: 0)
+    --seed=INT                Seed for the bootstrap sampling (default: 42)
+    --plaintext               Output plaintext instead of HDF5
+    --single                  Quantify single-end reads
+    --single-overhang         Include reads where unobserved rest of fragment is
+                              predicted to lie outside a transcript
+    --fr-stranded             Strand specific reads, first read forward
+    --rf-stranded             Strand specific reads, first read reverse
+-l, --fragment-length=DOUBLE  Estimated average fragment length
+-s, --sd=DOUBLE               Estimated standard deviation of fragment length
+                              (default: -l, -s values are estimated from paired
+                               end data, but are required when using --single)
+-p, --priors                  Priors for the EM algorithm, either as raw counts or as
+                              probabilities. Pseudocounts are added to raw reads to
+                              prevent zero valued priors. Supplied in the same order
+                              as the transcripts in the transcriptome
+-t, --threads=INT             Number of threads to use (default: 1)
+    --verbose                 Print out progress information every 1M proccessed reads
\ No newline at end of file

From e64ebdf8cf236a54cb82dafe851b7f33ed4cc1b2 Mon Sep 17 00:00:00 2001
From: emmarousseau <emmarou1@icloud.com>
Date: Wed, 18 Sep 2024 15:41:20 +0200
Subject: [PATCH 6/6] apply suggested changes (changelog, config)

---
 CHANGELOG.md                                | 15 +++++++--------
 src/kallisto/kallisto_quant/config.vsh.yaml |  6 ++++--
 2 files changed, 11 insertions(+), 10 deletions(-)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index a9ccf26b..b99fd09f 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -50,9 +50,14 @@
 
 * `fastqc`: High throughput sequence quality control analysis tool (PR #92).
 
+* `sortmerna`: Local sequence alignment tool for mapping, clustering, and filtering rRNA from
+  metatranscriptomic data (PR #146).
+
+* `fq_subsample`: Sample a subset of records from single or paired FASTQ files (PR #147).
+
 * `kallisto`:
-  - `kallisto/kallisto_quant`: Quantifying abundances of transcripts from RNA-Seq data, or more generally of target sequences  
-                               using high-throughput sequencing reads (PR #152).
+    - `kallisto_index`: Create a kallisto index (PR #149).
+    - `kallisto_quant`: Quantifying abundances of transcripts from RNA-Seq data, or more generally of target sequences using high-throughput sequencing reads (PR #152).
 
 
 ## MINOR CHANGES
@@ -151,13 +156,7 @@
     - `bedtools_getfasta`: extract sequences from a FASTA file for each of the
                            intervals defined in a BED/GFF/VCF file (PR #59).
 
-* `sortmerna`: Local sequence alignment tool for mapping, clustering, and filtering rRNA from metatranscriptomic 
-               data. (PR #146)
 
-* `fq_subsample`: Sample a subset of records from single or paired FASTQ files (PR #147).
-
-* `kallisto`:
-    - `kallisto_index`: Create a kallisto index (PR #149).
 
 
 ## MINOR CHANGES
diff --git a/src/kallisto/kallisto_quant/config.vsh.yaml b/src/kallisto/kallisto_quant/config.vsh.yaml
index 4fb7b0fe..e92ac6b3 100644
--- a/src/kallisto/kallisto_quant/config.vsh.yaml
+++ b/src/kallisto/kallisto_quant/config.vsh.yaml
@@ -9,7 +9,7 @@ links:
   repository: https://github.com/pachterlab/kallisto
   issue_tracker: https://github.com/pachterlab/kallisto/issues
 references: 
-  doi: https://doi.org/10.1038/nbt.3519
+  doi: 10.1038/nbt.3519
 license: BSD 2-Clause License
 
 argument_groups:
@@ -96,7 +96,9 @@ engines:
           apt-get install -y --no-install-recommends wget && \
           wget --no-check-certificate https://github.com/pachterlab/kallisto/releases/download/v0.50.1/kallisto_linux-v0.50.1.tar.gz && \
           tar -xzf kallisto_linux-v0.50.1.tar.gz && \
-          mv kallisto/kallisto /usr/local/bin/ && \
+          mv kallisto/kallisto /usr/local/bin/
+      - type: docker
+        run: |
           echo "kallisto: $(kallisto version | sed 's/kallisto, version //')" > /var/software_versions.txt
 runners:
   - type: executable