From 4601f21613d121b0272d9466296b6a313271fcca Mon Sep 17 00:00:00 2001
From: Robrecht Cannoodt <rcannood@gmail.com>
Date: Thu, 22 Feb 2024 09:34:55 +0100
Subject: [PATCH] write custom tests for cutadapt

---
 src/cutadapt/config.vsh.yaml        |   2 -
 src/cutadapt/script.sh              |   2 +-
 src/cutadapt/test.sh                | 192 ++++++++++++++++++++++------
 src/cutadapt/test_data/pe/a.1.fastq |   4 -
 src/cutadapt/test_data/pe/a.2.fastq |   4 -
 src/cutadapt/test_data/script.sh    |  16 ---
 src/cutadapt/test_data/se/a.fastq   |   4 -
 7 files changed, 151 insertions(+), 73 deletions(-)
 delete mode 100644 src/cutadapt/test_data/pe/a.1.fastq
 delete mode 100644 src/cutadapt/test_data/pe/a.2.fastq
 delete mode 100755 src/cutadapt/test_data/script.sh
 delete mode 100644 src/cutadapt/test_data/se/a.fastq

diff --git a/src/cutadapt/config.vsh.yaml b/src/cutadapt/config.vsh.yaml
index 88636952..b9918b88 100644
--- a/src/cutadapt/config.vsh.yaml
+++ b/src/cutadapt/config.vsh.yaml
@@ -443,8 +443,6 @@ functionality:
   test_resources:
     - type: bash_script
       path: test.sh
-    - type: file
-      path: test_data
 platforms:
   - type: docker
     image: python:3.12
diff --git a/src/cutadapt/script.sh b/src/cutadapt/script.sh
index bf7bc5d5..0808ddeb 100644
--- a/src/cutadapt/script.sh
+++ b/src/cutadapt/script.sh
@@ -196,7 +196,7 @@ echo
 if [[ -z $par_fasta ]]; then
   ext="fastq"
 else
-  ext="fa"
+  ext="fasta"
 fi
 
 if [ $mode = "se" ]; then
diff --git a/src/cutadapt/test.sh b/src/cutadapt/test.sh
index 9059b6f5..d36e6798 100644
--- a/src/cutadapt/test.sh
+++ b/src/cutadapt/test.sh
@@ -2,7 +2,26 @@
 
 set -e
 
-dir_in="$meta_resources_dir/test_data"
+#############################################
+# helper functions
+assert_file_exists() {
+  [ -f "$1" ] || (echo "File '$1' does not exist" && exit 1)
+}
+assert_file_doesnt_exist() {
+  [ ! -f "$1" ] || (echo "File '$1' exists but shouldn't" && exit 1)
+}
+assert_file_empty() {
+  [ ! -s "$1" ] || (echo "File '$1' is not empty but should be" && exit 1)
+}
+assert_file_not_empty() {
+  [ -s "$1" ] || (echo "File '$1' is empty but shouldn't be" && exit 1)
+}
+assert_file_contains() {
+  grep -q "$2" "$1" || (echo "File '$1' does not contain '$2'" && exit 1)
+}
+assert_file_not_contains() {
+  grep -q "$2" "$1" && (echo "File '$1' contains '$2' but shouldn't" && exit 1)
+}
 
 #############################################
 mkdir test_simple_single_end
@@ -10,23 +29,56 @@ cd test_simple_single_end
 
 echo "#############################################"
 echo "> Run cutadapt on single-end data"
+
+cat > example.fa <<'EOF'
+>read1
+MYSEQUENCEADAPTER
+>read2
+MYSEQUENCEADAP
+>read3
+MYSEQUENCEADAPTERSOMETHINGELSE
+>read4
+MYSEQUENCEADABTER
+>read5
+MYSEQUENCEADAPTR
+>read6
+MYSEQUENCEADAPPTER
+>read7
+ADAPTERMYSEQUENCE
+>read8
+PTERMYSEQUENCE
+>read9
+SOMETHINGADAPTERMYSEQUENCE
+EOF
+
 "$meta_executable" \
   --report minimal \
-  --output output-dir \
-  --adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
-  --input $dir_in/se/a.fastq \
-  --quality_cutoff 20 \
+  --output out_test1 \
+  --adapter ADAPTER \
+  --input example.fa \
+  --fasta \
+  --no_match_adapter_wildcards \
   --json
 
 echo ">> Checking output"
-[ ! -f "output-dir/report.txt" ] && echo "report.txt does not exist" && exit 1
-[ ! -f "output-dir/report.json" ] && echo "report.json does not exist" && exit 1
-[ ! -f "output-dir/1_R1_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
-[ ! -f "output-dir/unknown_R1_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
+assert_file_exists "out_test1/report.txt"
+assert_file_exists "out_test1/report.json"
+assert_file_exists "out_test1/1_001.fasta"
+assert_file_exists "out_test1/unknown_001.fasta"
 
 echo ">> Check if output is empty"
-[ -s "output-dir/1_R1_001.fastq" ] && echo "1_R1_001.fastq should be empty" && exit 1
-[ ! -s "output-dir/unknown_R1_001.fastq" ] && echo "unkown_R1_001.fastq is empty" && exit 1
+assert_file_not_empty "out_test1/report.txt"
+assert_file_not_empty "out_test1/report.json"
+assert_file_not_empty "out_test1/1_001.fasta"
+assert_file_not_empty "out_test1/unknown_001.fasta"
+
+echo ">> Check contents"
+for i in 1 2 3 7 9; do
+  assert_file_contains "out_test1/1_001.fasta" ">read$i"
+done
+for i in 4 5 6 8; do
+  assert_file_contains "out_test1/unknown_001.fasta" ">read$i"
+done
 
 cd ..
 echo
@@ -38,32 +90,58 @@ cd test_multiple_single_end
 echo "#############################################"
 echo "> Run with a combination of inputs"
 
-echo ">adapter1" > adapters1.fasta
-echo "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" >> adapters1.fasta
-
-echo ">adapter1" > adapters2.fasta
-echo "TGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" >> adapters2.fasta
+cat > example.fa <<'EOF'
+>read1
+ACGTACGTACGTAAAAA
+>read2
+ACGTACGTACGTCCCCC
+>read3
+ACGTACGTACGTGGGGG
+>read4
+ACGTACGTACGTTTTTT
+EOF
+
+cat > adapters1.fasta <<'EOF'
+>adapter1
+CCCCC
+EOF
+
+cat > adapters2.fasta <<'EOF'
+>adapter2
+GGGGG
+EOF
 
 "$meta_executable" \
   --report minimal \
-  --output output-dir \
-  --adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
-  --adapter GGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
+  --output out_test2 \
+  --adapter AAAAA \
   --adapter_fasta adapters1.fasta \
   --adapter_fasta adapters2.fasta \
-  --input $dir_in/se/a.fastq \
-  --quality_cutoff 20 \
+  --input example.fa \
+  --fasta \
   --json
 
 echo ">> Checking output"
-[ ! -f "output-dir/report.txt" ] && echo "report.txt does not exist" && exit 1
-[ ! -f "output-dir/report.json" ] && echo "report.json does not exist" && exit 1
-[ ! -f "output-dir/1_R1_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
-[ ! -f "output-dir/unknown_R1_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
+assert_file_exists "out_test2/report.txt"
+assert_file_exists "out_test2/report.json"
+assert_file_exists "out_test2/1_001.fasta"
+assert_file_exists "out_test2/adapter1_001.fasta"
+assert_file_exists "out_test2/adapter2_001.fasta"
+assert_file_exists "out_test2/unknown_001.fasta"
 
 echo ">> Check if output is empty"
-[ -s "output-dir/1_R1_001.fastq" ] && echo "1_R1_001.fastq should be empty" && exit 1
-[ ! -s "output-dir/unknown_R1_001.fastq" ] && echo "unkown_R1_001.fastq is empty" && exit 1
+assert_file_not_empty "out_test2/report.txt"
+assert_file_not_empty "out_test2/report.json"
+assert_file_not_empty "out_test2/1_001.fasta"
+assert_file_not_empty "out_test2/adapter1_001.fasta"
+assert_file_not_empty "out_test2/adapter2_001.fasta"
+assert_file_not_empty "out_test2/unknown_001.fasta"
+
+echo ">> Check contents"
+assert_file_contains "out_test2/1_001.fasta" ">read1"
+assert_file_contains "out_test2/adapter1_001.fasta" ">read2"
+assert_file_contains "out_test2/adapter2_001.fasta" ">read3"
+assert_file_contains "out_test2/unknown_001.fasta" ">read4"
 
 cd ..
 echo
@@ -74,30 +152,60 @@ cd test_simple_paired_end
 
 echo "#############################################"
 echo "> Run cutadapt on paired-end data"
+
+cat > example_R1.fastq <<'EOF'
+@read1
+ACGTACGTACGTAAAAA
++
+IIIIIIIIIIIIIIIII
+@read2
+ACGTACGTACGTCCCCC
++
+IIIIIIIIIIIIIIIII
+EOF
+
+cat > example_R2.fastq <<'EOF'
+@read1
+ACGTACGTACGTGGGGG
++
+IIIIIIIIIIIIIIIII
+@read2
+ACGTACGTACGTTTTTT
++
+IIIIIIIIIIIIIIIII
+EOF
+
 "$meta_executable" \
   --report minimal \
-  --output output-dir \
-  --adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
-  --adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCAB \
-  --input $dir_in/pe/a.1.fastq \
-  --input_r2 $dir_in/pe/a.2.fastq \
+  --output out_test3 \
+  --adapter AAAAA \
+  --adapter_r2 GGGGG \
+  --input example_R1.fastq \
+  --input_r2 example_R2.fastq \
   --quality_cutoff 20 \
   --json \
   ---cpus 1
 
 echo ">> Checking output"
-[ ! -f "output-dir/report.txt" ] && echo "report.txt does not exist" && exit 1
-[ ! -f "output-dir/report.json" ] && echo "report.json does not exist" && exit 1
-[ ! -f "output-dir/1_R1_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
-[ ! -f "output-dir/1_R2_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
-[ ! -f "output-dir/unknown_R1_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
-[ ! -f "output-dir/unknown_R2_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
+assert_file_exists "out_test3/report.txt"
+assert_file_exists "out_test3/report.json"
+assert_file_exists "out_test3/1_R1_001.fastq"
+assert_file_exists "out_test3/1_R2_001.fastq"
+assert_file_exists "out_test3/unknown_R1_001.fastq"
+assert_file_exists "out_test3/unknown_R2_001.fastq"
 
 echo ">> Check if output is empty"
-[ -s "output-dir/1_R1_001.fastq" ] && echo "1_R1_001.fastq should be empty" && exit 1
-[ -s "output-dir/1_R2_001.fastq" ] && echo "1_R2_001.fastq should be empty" && exit 1
-[ ! -s "output-dir/unknown_R1_001.fastq" ] && echo "unkown_R1_001.fastq is empty" && exit 1
-[ ! -s "output-dir/unknown_R2_001.fastq" ] && echo "unkown_R2_001.fastq is empty" && exit 1
+assert_file_not_empty "out_test3/report.txt"
+assert_file_not_empty "out_test3/report.json"
+assert_file_not_empty "out_test3/1_R1_001.fastq"
+assert_file_not_empty "out_test3/1_R2_001.fastq"
+assert_file_not_empty "out_test3/unknown_R1_001.fastq"
+
+echo ">> Check contents"
+assert_file_contains "out_test3/1_R1_001.fastq" "@read1"
+assert_file_contains "out_test3/1_R2_001.fastq" "@read1"
+assert_file_contains "out_test3/unknown_R1_001.fastq" "@read2"
+assert_file_contains "out_test3/unknown_R2_001.fastq" "@read2"
 
 cd ..
 echo
diff --git a/src/cutadapt/test_data/pe/a.1.fastq b/src/cutadapt/test_data/pe/a.1.fastq
deleted file mode 100644
index 42735560..00000000
--- a/src/cutadapt/test_data/pe/a.1.fastq
+++ /dev/null
@@ -1,4 +0,0 @@
-@1
-ACGGCAT
-+
-!!!!!!!
diff --git a/src/cutadapt/test_data/pe/a.2.fastq b/src/cutadapt/test_data/pe/a.2.fastq
deleted file mode 100644
index 42735560..00000000
--- a/src/cutadapt/test_data/pe/a.2.fastq
+++ /dev/null
@@ -1,4 +0,0 @@
-@1
-ACGGCAT
-+
-!!!!!!!
diff --git a/src/cutadapt/test_data/script.sh b/src/cutadapt/test_data/script.sh
deleted file mode 100755
index 3251b59c..00000000
--- a/src/cutadapt/test_data/script.sh
+++ /dev/null
@@ -1,16 +0,0 @@
-# cutadapt test data
-
-# Test data was obtained from https://github.com/snakemake/snakemake-wrappers/tree/master/bio/cutadapt/test
-
-if [ ! -d /tmp/snakemake-wrappers ]; then
-  git clone --depth 1 --single-branch --branch master https://github.com/snakemake/snakemake-wrappers /tmp/snakemake-wrappers
-fi
-
-mkdir -p src/cutadapt/test_data/pe
-mkdir src/cutadapt/test_data/se
-
-cp -r /tmp/snakemake-wrappers/bio/cutadapt/se/test/reads/* src/cutadapt/test_data/se
-cp -r /tmp/snakemake-wrappers/bio/cutadapt/pe/test/reads/* src/cutadapt/test_data/pe
-
-rm -rf /tmp/snakemake-wrappers
-
diff --git a/src/cutadapt/test_data/se/a.fastq b/src/cutadapt/test_data/se/a.fastq
deleted file mode 100644
index 42735560..00000000
--- a/src/cutadapt/test_data/se/a.fastq
+++ /dev/null
@@ -1,4 +0,0 @@
-@1
-ACGGCAT
-+
-!!!!!!!