diff --git a/.github/workflows/test.yaml b/.github/workflows/test.yaml index 6e1fc4b3..2591978f 100644 --- a/.github/workflows/test.yaml +++ b/.github/workflows/test.yaml @@ -3,114 +3,7 @@ name: Component Testing on: pull_request: push: - branches: [ '**' ] jobs: - run_ci_check_job: - runs-on: ubuntu-latest - outputs: - run_ci: ${{ steps.github_cli.outputs.check }} - steps: - - name: 'Check if branch has an existing pull request and the trigger was a push' - id: github_cli - run: | - pull_request=$(gh pr list -R ${{ github.repository }} -H ${{ github.ref_name }} --json url --state open --limit 1 | jq '.[0].url') - # If the branch has a PR and this run was triggered by a push event, do not run - if [[ "$pull_request" != "null" && "$GITHUB_REF_NAME" != "main" && "${{ github.event_name == 'push' }}" == "true" && "${{ !contains(github.event.head_commit.message, 'ci force') }}" == "true" ]]; then - echo "check=false" >> $GITHUB_OUTPUT - else - echo "check=true" >> $GITHUB_OUTPUT - fi - env: - GH_TOKEN: ${{ github.token }} - - # phase 1 - list: - needs: run_ci_check_job - runs-on: ubuntu-latest - if: ${{ needs.run_ci_check_job.outputs.run_ci == 'true' }} - - outputs: - matrix: ${{ steps.set_matrix.outputs.matrix }} - - steps: - - uses: actions/checkout@v4 - with: - fetch-depth: 0 - - - name: Get head git commit message - id: get_head_commit_message - run: echo "HEAD_COMMIT_MESSAGE=$(git show -s --format=%s ${{ github.event.pull_request.head.sha || github.sha }})" >> "$GITHUB_OUTPUT" - - - uses: viash-io/viash-actions/setup@v5 - - - name: Check if all config can be parsed if there is no unicode support - run: | - LANG=C viash ns list > /dev/null - - # see https://github.com/viash-io/viash/issues/654 - # and https://github.com/viash-io/viash-actions/pull/27 - # - name: Get changed files - # id: changed-files - # uses: tj-actions/changed-files@v42 - # with: - # separator: ";" - # diff_relative: true - # - id: ns_list - # uses: viash-io/viash-actions/ns-list@v5 - # with: - # platform: docker - # format: json - # query: ^(?!workflows) - # - id: ns_list_filtered - # uses: viash-io/viash-actions/project/detect-changed-components@v5 - # with: - # input_file: "${{ steps.ns_list.outputs.output_file }}" - # - id: set_matrix - # run: | - # echo "matrix=$(jq -c '[ .[] | - # { - # "name": (.functionality.namespace + "/" + .functionality.name), - # "config": .info.config, - # "dir": .info.config | capture("^(?.*\/)").dir - # } - # ]' ${{ contains(steps.get_head_commit_message.outputs.HEAD_COMMIT_MESSAGE, 'ci force') && steps.ns_list.outputs.output_file || steps.ns_list_filtered.outputs.output_file }} )" >> $GITHUB_OUTPUT - - - - id: set_matrix - run: | - viash ns list --format json > ns_list.json - echo "matrix=$(jq -c '[ .[] | - { - "name": (.namespace + "/" + .name), - "config": .build_info.config, - "dir": .build_info.config | capture("^(?.*\/)").dir - } - ]' ns_list.json )" >> $GITHUB_OUTPUT - - # phase 2 - viash_test: - needs: list - if: ${{ needs.list.outputs.matrix != '[]' && needs.list.outputs.matrix != '' }} - runs-on: ubuntu-latest - - strategy: - fail-fast: false - matrix: - component: ${{ fromJson(needs.list.outputs.matrix) }} - - steps: - # Remove unnecessary files to free up space. Otherwise, we get 'no space left on device.' - - uses: data-intuitive/reclaim-the-bytes@v2 - - - uses: actions/checkout@v4 - - - uses: viash-io/viash-actions/setup@v5 - - - name: Run test - timeout-minutes: 30 - run: | - viash test \ - "${{ matrix.component.config }}" \ - --cpus 2 \ - --memory "6gb" \ No newline at end of file + test: + uses: viash-hub/toolbox/.github/workflows/test.yaml@main \ No newline at end of file diff --git a/CHANGELOG.md b/CHANGELOG.md index 151b7a41..bfe2b1b6 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -1,4 +1,10 @@ -# base unreleased +# biobox x.x.x + +## BUG FIXES + +* `pear`: fix component not exiting with the correct exitcode when PEAR fails. + +# biobox 0.1.0 ## BREAKING CHANGES @@ -17,6 +23,8 @@ - `busco/busco_list_datasets`: Lists available busco datasets (PR #18). - `busco/busco_download_datasets`: Download busco datasets (PR #19). +* `cutadapt`: Remove adapter sequences from high-throughput sequencing reads (PR #7). + * `featurecounts`: Assign sequence reads to genomic features (PR #11). * `bgzip`: Add bgzip functionality to compress and decompress files (PR #13). @@ -29,7 +37,9 @@ * `multiqc`: Aggregate results from bioinformatics analyses across many samples into a single report (PR #42). -* `star/star_align_reads`: Align reads to a reference genome (PR #22). +* `star`: + - `star/star_align_reads`: Align reads to a reference genome (PR #22). + - `star/star_genome_generate`: Generate a genome index for STAR alignment (PR #58). * `gffread`: Validate, filter, convert and perform other operations on GFF files (PR #29). @@ -50,8 +60,9 @@ * `falco`: A C++ drop-in replacement of FastQC to assess the quality of sequence read data (PR #43). - -## MAJOR CHANGES +* `bedtools`: + - `bedtools_getfasta`: extract sequences from a FASTA file for each of the + intervals defined in a BED/GFF/VCF file (PR #59). ## MINOR CHANGES @@ -61,8 +72,16 @@ * Update to Viash 0.9.0-RC3 (PR #51). +* Update to Viash 0.9.0-RC6 (PR #63). + +* Switch to viash-hub/toolbox actions (PR #64). + ## DOCUMENTATION +* Update README (PR #64). + ## BUG FIXES -* Add escaping character before leading hashtag in the description field of the config file (PR #50). \ No newline at end of file +* Add escaping character before leading hashtag in the description field of the config file (PR #50). + +* Format URL in biobase/bcl_convert description (PR #55). \ No newline at end of file diff --git a/README.md b/README.md index ecf807ca..4b497dcd 100644 --- a/README.md +++ b/README.md @@ -1,15 +1,24 @@ -# Base repository for reusable Viash components -This repository is a collection of reproducible and reusable Viash -components. +# 🌱📦 biobox + +[![ViashHub](https://img.shields.io/badge/ViashHub-biobox-7a4baa.png)](https://web.viash-hub.com/packages/biobox) +[![GitHub](https://img.shields.io/badge/GitHub-viash--hub%2Fbiobox-blue.png)](https://github.com/viash-hub/biobox) +[![GitHub +License](https://img.shields.io/github/license/viash-hub/biobox.png)](https://github.com/viash-hub/biobox/blob/main/LICENSE) +[![GitHub +Issues](https://img.shields.io/github/issues/viash-hub/biobox.png)](https://github.com/viash-hub/biobox/issues) +[![Viash +version](https://img.shields.io/badge/Viash-v0.9.0--RC6-blue)](https://viash.io) + +A collection of bioinformatics tools for working with sequence data. ## Objectives - **Reusability**: Facilitating the use of components across various projects and contexts. -- **Reproducibility**: Guaranteeing that bioinformatics analyses can be - reliably replicated. +- **Reproducibility**: Ensuring that components are reproducible and can + be easily shared. - **Best Practices**: Adhering to established standards in software development and bioinformatics. @@ -43,18 +52,21 @@ contribute a component to this repository. 12. Create test script 13. Create a `/var/software_versions.txt` file -See the [CONTRIBUTING](CONTRIBUTING.md) file for more details. +See the +[CONTRIBUTING](https://github.com/viash-hub/biobox/blob/main/CONTRIBUTING.md) +file for more details. ## Support and Community For support, questions, or to join our community: - **Issues**: Submit questions or issues via the [GitHub issue - tracker](https://github.com/viash-hub/base/issues). + tracker](https://github.com/viash-hub/biobox/issues). - **Discussions**: Join our discussions via [GitHub - Discussions](https://github.com/viash-hub/base/discussions). + Discussions](https://github.com/viash-hub/biobox/discussions). ## License This repository is licensed under an MIT license. See the -[LICENSE](LICENSE) file for details. +[LICENSE](https://github.com/viash-hub/biobox/blob/main/LICENSE) file +for details. diff --git a/README.qmd b/README.qmd index 656cdac7..7d36430b 100644 --- a/README.qmd +++ b/README.qmd @@ -1,14 +1,25 @@ --- -title: Base repository for reusable Viash components format: gfm --- +```{r setup, include=FALSE} +project <- yaml::read_yaml("_viash.yaml") +license <- paste0(project$links$repository, "/blob/main/LICENSE") +contributing <- paste0(project$links$repository, "/blob/main/CONTRIBUTING.md") +``` +# 🌱📦 `r project$name` + +[![ViashHub](https://img.shields.io/badge/ViashHub-`r project$name`-7a4baa)](https://web.viash-hub.com/packages/`r project$name`) +[![GitHub](https://img.shields.io/badge/GitHub-viash--hub%2F`r project$name`-blue)](`r project$links$repository`) +[![GitHub License](https://img.shields.io/github/license/viash-hub/`r project$name`)](`r license`) +[![GitHub Issues](https://img.shields.io/github/issues/viash-hub/`r project$name`)](`r project$links$issue_tracker`) +[![Viash version](https://img.shields.io/badge/Viash-v`r gsub("-", "--", project$viash_version)`-blue)](https://viash.io) -This repository is a collection of reproducible and reusable Viash components. +`r project$description` ## Objectives - **Reusability**: Facilitating the use of components across various projects and contexts. -- **Reproducibility**: Guaranteeing that bioinformatics analyses can be reliably replicated. +- **Reproducibility**: Ensuring that components are reproducible and can be easily shared. - **Best Practices**: Adhering to established standards in software development and bioinformatics. ## Contributing @@ -37,15 +48,15 @@ knitr::asis_output( ) ``` -See the [CONTRIBUTING](CONTRIBUTING.md) file for more details. +See the [CONTRIBUTING](`r contributing`) file for more details. ## Support and Community For support, questions, or to join our community: -- **Issues**: Submit questions or issues via the [GitHub issue tracker](https://github.com/viash-hub/base/issues). -- **Discussions**: Join our discussions via [GitHub Discussions](https://github.com/viash-hub/base/discussions). +- **Issues**: Submit questions or issues via the [GitHub issue tracker](`r project$links$issue_tracker`). +- **Discussions**: Join our discussions via [GitHub Discussions](`r project$links$repository`/discussions). ## License -This repository is licensed under an MIT license. See the [LICENSE](LICENSE) file for details. +This repository is licensed under an MIT license. See the [LICENSE](`r license`) file for details. diff --git a/_viash.yaml b/_viash.yaml index 397a8d69..9a240c24 100644 --- a/_viash.yaml +++ b/_viash.yaml @@ -1,13 +1,13 @@ -name: biobase +name: biobox description: | A collection of bioinformatics tools for working with sequence data. license: MIT -keywords: [bioinformatics, sequence, alignment, variant calling] +keywords: [bioinformatics, modules, sequencing] links: - issue_tracker: https://github.com/viash-hub/biobase/issues - repository: https://github.com/viash-hub/biobase + issue_tracker: https://github.com/viash-hub/biobox/issues + repository: https://github.com/viash-hub/biobox -viash_version: 0.9.0-RC3 +viash_version: 0.9.0-RC6 config_mods: | .requirements.commands := ['ps'] diff --git a/src/bcl_convert/config.vsh.yaml b/src/bcl_convert/config.vsh.yaml index d0cedfa7..657fb1f0 100644 --- a/src/bcl_convert/config.vsh.yaml +++ b/src/bcl_convert/config.vsh.yaml @@ -2,8 +2,8 @@ name: bcl_convert description: | Convert bcl files to fastq files using bcl-convert. Information about upgrading from bcl2fastq via - https://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html - and https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html + [Upgrading from bcl2fastq to BCL Convert](https://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html) + and [BCL Convert Compatible Products](https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html) argument_groups: - name: Input arguments arguments: diff --git a/src/bedtools/bedtools_getfasta/config.vsh.yaml b/src/bedtools/bedtools_getfasta/config.vsh.yaml new file mode 100644 index 00000000..f1f49a87 --- /dev/null +++ b/src/bedtools/bedtools_getfasta/config.vsh.yaml @@ -0,0 +1,103 @@ +name: bedtools_getfasta +namespace: bedtools +description: Extract sequences from a FASTA file for each of the intervals defined in a BED/GFF/VCF file. +keywords: [sequencing, fasta, BED, GFF, VCF] +links: + documentation: https://bedtools.readthedocs.io/en/latest/content/tools/getfasta.html + repository: https://github.com/arq5x/bedtools2 +references: + doi: 10.1093/bioinformatics/btq033 +license: GPL-2.0 +requirements: + commands: [bedtools] + +argument_groups: + - name: Input arguments + arguments: + - name: --input_fasta + type: file + description: | + FASTA file containing sequences for each interval specified in the input BED file. + The headers in the input FASTA file must exactly match the chromosome column in the BED file. + - name: "--input_bed" + type: file + description: | + BED file containing intervals to extract from the FASTA file. + BED files containing a single region require a newline character + at the end of the line, otherwise a blank output file is produced. + - name: --rna + type: boolean_true + description: | + The FASTA is RNA not DNA. Reverse complementation handled accordingly. + + - name: Run arguments + arguments: + - name: "--strandedness" + type: boolean_true + alternatives: ["-s"] + description: | + Force strandedness. If the feature occupies the antisense strand, the output sequence will + be reverse complemented. By default strandedness is not taken into account. + + - name: Output arguments + arguments: + - name: --output + alternatives: [-o] + required: true + type: file + direction: output + description: | + Output file where the output from the 'bedtools getfasta' commend will + be written to. + - name: --tab + type: boolean_true + description: | + Report extract sequences in a tab-delimited format instead of in FASTA format. + - name: --bed_out + type: boolean_true + description: | + Report extract sequences in a tab-delimited BED format instead of in FASTA format. + - name: "--name" + type: boolean_true + description: | + Set the FASTA header for each extracted sequence to be the "name" and coordinate columns from the BED feature. + - name: "--name_only" + type: boolean_true + description: | + Set the FASTA header for each extracted sequence to be the "name" columns from the BED feature. + - name: "--split" + type: boolean_true + description: | + When --input is in BED12 format, create a separate fasta entry for each block in a BED12 record, + blocks being described in the 11th and 12th column of the BED. + - name: "--full_header" + type: boolean_true + description: | + Use full fasta header. By default, only the word before the first space or tab is used. + +# Arguments not taken into account: +# +# -fo [Specify an output file name. By default, output goes to stdout. +# + +resources: + - type: bash_script + path: script.sh + +test_resources: + - type: bash_script + path: test.sh + +engines: + - type: docker + image: debian:stable-slim + setup: + - type: apt + packages: [bedtools, procps] + - type: docker + run: | + echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var/software_versions.txt + +runners: + - type: executable + - type: nextflow diff --git a/src/bedtools/bedtools_getfasta/script.sh b/src/bedtools/bedtools_getfasta/script.sh new file mode 100644 index 00000000..8e88b318 --- /dev/null +++ b/src/bedtools/bedtools_getfasta/script.sh @@ -0,0 +1,22 @@ +#!/usr/bin/env bash +set -eo pipefail + +unset_if_false=( par_rna par_strandedness par_tab par_bed_out par_name par_name_only par_split par_full_header ) + +for par in ${unset_if_false[@]}; do + test_val="${!par}" + [[ "$test_val" == "false" ]] && unset $par +done + +bedtools getfasta \ + -fi "$par_input_fasta" \ + -bed "$par_input_bed" \ + ${par_rna:+-rna} \ + ${par_name:+-name} \ + ${par_name_only:+-nameOnly} \ + ${par_tab:+-tab} \ + ${par_bed_out:+-bedOut} \ + ${par_strandedness:+-s} \ + ${par_split:+-split} \ + ${par_full_header:+-fullHeader} > "$par_output" + diff --git a/src/bedtools/bedtools_getfasta/test.sh b/src/bedtools/bedtools_getfasta/test.sh new file mode 100644 index 00000000..a28e3a7e --- /dev/null +++ b/src/bedtools/bedtools_getfasta/test.sh @@ -0,0 +1,119 @@ +#!/usr/bin/env bash +set -eo pipefail + +TMPDIR=$(mktemp -d) +function clean_up { + [[ -d "$TMPDIR" ]] && rm -r "$TMPDIR" +} +trap clean_up EXIT + +# Create dummy test fasta file +cat > "$TMPDIR/test.fa" <chr1 +AAAAAAAACCCCCCCCCCCCCGCTACTGGGGGGGGGGGGGGGGGG +EOF + +TAB="$(printf '\t')" + +# Create dummy bed file +cat > "$TMPDIR/test.bed" < "$TMPDIR/expected.fasta" <chr1:5-10 +AAACC +EOF + +"$meta_executable" \ + --input_bed "$TMPDIR/test.bed" \ + --input_fasta "$TMPDIR/test.fa" \ + --output "$TMPDIR/output.fasta" + +cmp --silent "$TMPDIR/output.fasta" "$TMPDIR/expected.fasta" || { echo "files are different:"; exit 1; } + + +# Create expected bed file for --name +cat > "$TMPDIR/expected_with_name.fasta" <myseq::chr1:5-10 +AAACC +EOF + +"$meta_executable" \ + --input_bed "$TMPDIR/test.bed" \ + --input_fasta "$TMPDIR/test.fa" \ + --name \ + --output "$TMPDIR/output_with_name.fasta" + + +cmp --silent "$TMPDIR/output_with_name.fasta" "$TMPDIR/expected_with_name.fasta" || { echo "Files when using --name are different."; exit 1; } + +# Create expected bed file for --name_only +cat > "$TMPDIR/expected_with_name_only.fasta" <myseq +AAACC +EOF + +"$meta_executable" \ + --input_bed "$TMPDIR/test.bed" \ + --input_fasta "$TMPDIR/test.fa" \ + --name_only \ + --output "$TMPDIR/output_with_name_only.fasta" + +cmp --silent "$TMPDIR/output_with_name_only.fasta" "$TMPDIR/expected_with_name_only.fasta" || { echo "Files when using --name_only are different."; exit 1; } + + +# Create expected tab-delimited file for --tab +cat > "$TMPDIR/expected_tab.out" < "$TMPDIR/expected.bed" < "$TMPDIR/test_strandedness.bed" < "$TMPDIR/expected_strandedness.fasta" <forward(+) +CGCTA +>reverse(-) +TAGCG +EOF + +"$meta_executable" \ + --input_bed "$TMPDIR/test_strandedness.bed" \ + --input_fasta "$TMPDIR/test.fa" \ + -s \ + --name_only \ + --output "$TMPDIR/output_strandedness.fasta" + + +cmp --silent "$TMPDIR/expected_strandedness.fasta" "$TMPDIR/output_strandedness.fasta" || { echo "Files when using -s are different."; exit 1; } + diff --git a/src/bgzip/config.vsh.yaml b/src/bgzip/config.vsh.yaml deleted file mode 100644 index 26e31ae4..00000000 --- a/src/bgzip/config.vsh.yaml +++ /dev/null @@ -1,128 +0,0 @@ -name: bgzip -description: Block compression/decompression utility -links: - homepage: https://www.htslib.org/ - documentation: https://www.htslib.org/doc/bgzip.html - repository: https://github.com/samtools/htslib -references: - doi: 10.1093/gigascience/giab007 -license: MIT -requirements: - commands: [ bgzip ] -argument_groups: - - name: Inputs - arguments: - - name: --input - type: file - direction: input - description: file to be compressed or decompressed - required: true - - name: Outputs - arguments: - - name: --output - type: file - direction: output - description: compressed or decompressed output - required: true - - name: --index_name - alternatives: -I - type: file - direction: output - description: name of BGZF index file [file.gz.gzi] - - name: Arguments - arguments: - - name: --offset - alternatives: -b - type: integer - description: decompress at virtual file pointer (0-based uncompressed offset) - - name: --decompress - alternatives: -d - type: boolean_true - description: decompress the input file - - name: --rebgzip - alternatives: -g - type: boolean_true - description: use an index file to bgzip a file - - name: --index - alternatives: -i - type: boolean_true - description: compress and create BGZF index - - name: --compress_level - alternatives: -l - type: integer - description: compression level to use when compressing; 0 to 9, or -1 for default [-1] - min: -1 - max: 9 - - name: --reindex - alternatives: -r - type: boolean_true - description: (re)index the output file - - name: --size - alternatives: -s - type: integer - description: decompress INT bytes (uncompressed size) - min: 0 - - name: --test - alternatives: -t - type: boolean_true - description: test integrity of compressed file - - name: --binary - type: boolean_true - description: Don't align blocks with text lines -resources: - - type: bash_script - text: | - [[ "$par_decompress" == "false" ]] && unset par_decompress - [[ "$par_rebgzip" == "false" ]] && unset par_rebgzip - [[ "$par_index" == "false" ]] && unset par_index - [[ "$par_reindex" == "false" ]] && unset par_reindex - [[ "$par_test" == "false" ]] && unset par_test - [[ "$par_binary" == "false" ]] && unset par_binary - bgzip -c \ - ${meta_cpus:+--threads "${meta_cpus}"} \ - ${par_offset:+-b "${par_offset}"} \ - ${par_decompress:+-d} \ - ${par_rebgzip:+-g} \ - ${par_index:+-i} \ - ${par_index_name:+-I "${par_index_name}"} \ - ${par_compress_level:+-l "${par_compress_level}"} \ - ${par_reindex:+-r} \ - ${par_size:+-s "${par_size}"} \ - ${par_test:+-t} \ - ${par_binary:+--binary} \ - "$par_input" > "$par_output" -test_resources: - - type: bash_script - text: | - set -e - - "$meta_executable" --input "$meta_resources_dir/test_data/test.vcf" --output "test.vcf.gz" - - echo ">> Checking output of compressing" - [ ! -f "test.vcf.gz" ] && echo "Output file test.vcf.gz does not exist" && exit 1 - - "$meta_executable" --input "test.vcf.gz" --output "test.vcf" --decompress - - echo ">> Checking output of decompressing" - [ ! -f "test.vcf" ] && echo "Output file test.vcf does not exist" && exit 1 - - echo ">> Checking original and decompressed files are the same" - set +e - cmp --silent -- "$meta_resources_dir/test_data/test.vcf" "test.vcf" - [ $? -ne 0 ] && echo "files are different" && exit 1 - set -e - - echo "> Test successful" - - type: file - path: test_data - -engines: - - type: docker - image: quay.io/biocontainers/htslib:1.19--h81da01d_0 - setup: - - type: docker - run: | - bgzip -h | grep 'Version:' 2>&1 | sed 's/Version:\s\(.*\)/bgzip: "\1"/' > /var/software_versions.txt -runners: - - type: executable - - type: nextflow \ No newline at end of file diff --git a/src/bgzip/help.txt b/src/bgzip/help.txt deleted file mode 100644 index d4012efd..00000000 --- a/src/bgzip/help.txt +++ /dev/null @@ -1,22 +0,0 @@ -```bash -bgzip -h -``` - -Version: 1.19 -Usage: bgzip [OPTIONS] [FILE] ... -Options: - -b, --offset INT decompress at virtual file pointer (0-based uncompressed offset) - -c, --stdout write on standard output, keep original files unchanged - -d, --decompress decompress - -f, --force overwrite files without asking - -g, --rebgzip use an index file to bgzip a file - -h, --help give this help - -i, --index compress and create BGZF index - -I, --index-name FILE name of BGZF index file [file.gz.gzi] - -k, --keep don't delete input files during operation - -l, --compress-level INT Compression level to use when compressing; 0 to 9, or -1 for default [-1] - -r, --reindex (re)index compressed file - -s, --size INT decompress INT bytes (uncompressed size) - -t, --test test integrity of compressed file - --binary Don't align blocks with text lines - -@, --threads INT number of compression threads to use [1] diff --git a/src/bgzip/test_data/script.sh b/src/bgzip/test_data/script.sh deleted file mode 100644 index c9114473..00000000 --- a/src/bgzip/test_data/script.sh +++ /dev/null @@ -1,10 +0,0 @@ -# bgzip test data - -# Test data was obtained from https://github.com/snakemake/snakemake-wrappers/tree/master/bio/bgzip/test. - -if [ ! -d /tmp/snakemake-wrappers ]; then - git clone --depth 1 --single-branch --branch master https://github.com/snakemake/snakemake-wrappers /tmp/snakemake-wrappers -fi - -cp -r /tmp/snakemake-wrappers/bio/bgzip/test/* src/bgzip/test_data - diff --git a/src/bgzip/test_data/test.vcf b/src/bgzip/test_data/test.vcf deleted file mode 100644 index 11b5400e..00000000 --- a/src/bgzip/test_data/test.vcf +++ /dev/null @@ -1,23 +0,0 @@ -##fileformat=VCFv4.0 -##fileDate=20090805 -##source=https://www.internationalgenome.org/wiki/Analysis/vcf4.0/ -##reference=1000GenomesPilot-NCBI36 -##phasing=partial -##INFO= -##INFO= -##INFO= -##INFO= -##INFO= -##INFO= -##FILTER= -##FILTER= -##FORMAT= -##FORMAT= -##FORMAT= -##FORMAT= -#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA00003 -20 14370 rs6054257 G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,. -20 17330 . T A 3 q10 NS=3;DP=11;AF=0.017 GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:3 -20 1110696 rs6040355 A G,T 67 PASS NS=2;DP=10;AF=0.333,0.667;AA=T;DB GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2 2/2:35:4 -20 1230237 . T . 47 PASS NS=3;DP=13;AA=T GT:GQ:DP:HQ 0|0:54:7:56,60 0|0:48:4:51,51 0/0:61:2 -20 1234567 microsat1 GTCT G,GTACT 50 PASS NS=3;DP=9;AA=G GT:GQ:DP 0/1:35:4 0/2:17:2 1/1:40:3 diff --git a/src/cutadapt/config.vsh.yaml b/src/cutadapt/config.vsh.yaml new file mode 100644 index 00000000..a62f0aa9 --- /dev/null +++ b/src/cutadapt/config.vsh.yaml @@ -0,0 +1,463 @@ +name: cutadapt +description: | + Cutadapt removes adapter sequences from high-throughput sequencing reads. +keywords: [RNA-seq, scRNA-seq, high-throughput] +links: + homepage: https://cutadapt.readthedocs.io + documentation: https://cutadapt.readthedocs.io + repository: https://github.com/marcelm/cutadapt +references: + doi: 10.14806/ej.17.1.200 +license: MIT +argument_groups: + #################################################################### + - name: Specify Adapters for R1 + arguments: + - name: --adapter + alternatives: [-a] + type: string + multiple: true + description: | + Sequence of an adapter ligated to the 3' end (paired data: + of the first read). The adapter and subsequent bases are + trimmed. If a '$' character is appended ('anchoring'), the + adapter is only found if it is a suffix of the read. + required: false + - name: --front + alternatives: [-g] + type: string + multiple: true + description: | + Sequence of an adapter ligated to the 5' end (paired data: + of the first read). The adapter and any preceding bases + are trimmed. Partial matches at the 5' end are allowed. If + a '^' character is prepended ('anchoring'), the adapter is + only found if it is a prefix of the read. + required: false + - name: --anywhere + alternatives: [-b] + type: string + multiple: true + description: | + Sequence of an adapter that may be ligated to the 5' or 3' + end (paired data: of the first read). Both types of + matches as described under -a and -g are allowed. If the + first base of the read is part of the match, the behavior + is as with -g, otherwise as with -a. This option is mostly + for rescuing failed library preparations - do not use if + you know which end your adapter was ligated to! + required: false + + #################################################################### + - name: Specify Adapters using Fasta files for R1 + arguments: + - name: --adapter_fasta + type: file + multiple: true + description: | + Fasta file containing sequences of an adapter ligated to the 3' end (paired data: + of the first read). The adapter and subsequent bases are + trimmed. If a '$' character is appended ('anchoring'), the + adapter is only found if it is a suffix of the read. + required: false + - name: --front_fasta + type: file + description: | + Fasta file containing sequences of an adapter ligated to the 5' end (paired data: + of the first read). The adapter and any preceding bases + are trimmed. Partial matches at the 5' end are allowed. If + a '^' character is prepended ('anchoring'), the adapter is + only found if it is a prefix of the read. + required: false + - name: --anywhere_fasta + type: file + description: | + Fasta file containing sequences of an adapter that may be ligated to the 5' or 3' + end (paired data: of the first read). Both types of + matches as described under -a and -g are allowed. If the + first base of the read is part of the match, the behavior + is as with -g, otherwise as with -a. This option is mostly + for rescuing failed library preparations - do not use if + you know which end your adapter was ligated to! + required: false + + #################################################################### + - name: Specify Adapters for R2 + arguments: + - name: --adapter_r2 + alternatives: [-A] + type: string + multiple: true + description: | + Sequence of an adapter ligated to the 3' end (paired data: + of the first read). The adapter and subsequent bases are + trimmed. If a '$' character is appended ('anchoring'), the + adapter is only found if it is a suffix of the read. + required: false + - name: --front_r2 + alternatives: [-G] + type: string + multiple: true + description: | + Sequence of an adapter ligated to the 5' end (paired data: + of the first read). The adapter and any preceding bases + are trimmed. Partial matches at the 5' end are allowed. If + a '^' character is prepended ('anchoring'), the adapter is + only found if it is a prefix of the read. + required: false + - name: --anywhere_r2 + alternatives: [-B] + type: string + multiple: true + description: | + Sequence of an adapter that may be ligated to the 5' or 3' + end (paired data: of the first read). Both types of + matches as described under -a and -g are allowed. If the + first base of the read is part of the match, the behavior + is as with -g, otherwise as with -a. This option is mostly + for rescuing failed library preparations - do not use if + you know which end your adapter was ligated to! + required: false + + #################################################################### + - name: Specify Adapters using Fasta files for R2 + arguments: + - name: --adapter_r2_fasta + type: file + description: | + Fasta file containing sequences of an adapter ligated to the 3' end (paired data: + of the first read). The adapter and subsequent bases are + trimmed. If a '$' character is appended ('anchoring'), the + adapter is only found if it is a suffix of the read. + required: false + - name: --front_r2_fasta + type: file + description: | + Fasta file containing sequences of an adapter ligated to the 5' end (paired data: + of the first read). The adapter and any preceding bases + are trimmed. Partial matches at the 5' end are allowed. If + a '^' character is prepended ('anchoring'), the adapter is + only found if it is a prefix of the read. + required: false + - name: --anywhere_r2_fasta + type: file + description: | + Fasta file containing sequences of an adapter that may be ligated to the 5' or 3' + end (paired data: of the first read). Both types of + matches as described under -a and -g are allowed. If the + first base of the read is part of the match, the behavior + is as with -g, otherwise as with -a. This option is mostly + for rescuing failed library preparations - do not use if + you know which end your adapter was ligated to! + required: false + + #################################################################### + - name: Paired-end options + arguments: + - name: --pair_adapters + type: boolean_true + description: | + Treat adapters given with -a/-A etc. as pairs. Either both + or none are removed from each read pair. + - name: --pair_filter + type: string + choices: [any, both, first] + description: | + Which of the reads in a paired-end read have to match the + filtering criterion in order for the pair to be filtered. + - name: --interleaved + type: boolean_true + description: | + Read and/or write interleaved paired-end reads. + + #################################################################### + - name: Input parameters + arguments: + - name: --input + type: file + required: true + description: | + Input fastq file for single-end reads or R1 for paired-end reads. + - name: --input_r2 + type: file + required: false + description: | + Input fastq file for R2 in the case of paired-end reads. + - name: --error_rate + alternatives: [-E, --errors] + type: double + description: | + Maximum allowed error rate (if 0 <= E < 1), or absolute + number of errors for full-length adapter match (if E is an + integer >= 1). Error rate = no. of errors divided by + length of matching region. Default: 0.1 (10%). + example: 0.1 + - name: --no_indels + type: boolean_false + description: | + Allow only mismatches in alignments. + + - name: --times + type: integer + alternatives: [-n] + description: | + Remove up to COUNT adapters from each read. Default: 1. + example: 1 + - name: --overlap + alternatives: [-O] + type: integer + description: | + Require MINLENGTH overlap between read and adapter for an + adapter to be found. The default is 3. + example: 3 + - name: --match_read_wildcards + type: boolean_true + description: | + Interpret IUPAC wildcards in reads. + - name: --no_match_adapter_wildcards + type: boolean_false + description: | + Do not interpret IUPAC wildcards in adapters. + - name: --action + type: string + choices: + - trim + - retain + - mask + - lowercase + - none + description: | + What to do if a match was found. trim: trim adapter and + up- or downstream sequence; retain: trim, but retain + adapter; mask: replace with 'N' characters; lowercase: + convert to lowercase; none: leave unchanged. + The default is trim. + example: trim + - name: --revcomp + alternatives: [--rc] + type: boolean_true + description: | + Check both the read and its reverse complement for adapter + matches. If match is on reverse-complemented version, + output that one. + + #################################################################### + - name: Read modifications + arguments: + - name: --cut + alternatives: [-u] + type: integer + multiple: true + description: | + Remove LEN bases from each read (or R1 if paired; use --cut_r2 + option for R2). If LEN is positive, remove bases from the + beginning. If LEN is negative, remove bases from the end. + Can be used twice if LENs have different signs. Applied + *before* adapter trimming. + - name: --cut_r2 + type: integer + multiple: true + description: | + Remove LEN bases from each read (for R2). If LEN is positive, remove bases from the + beginning. If LEN is negative, remove bases from the end. + Can be used twice if LENs have different signs. Applied + *before* adapter trimming. + - name: --nextseq_trim + type: string + description: | + NextSeq-specific quality trimming (each read). Trims also + dark cycles appearing as high-quality G bases. + - name: --quality_cutoff + alternatives: [-q] + type: string + description: | + Trim low-quality bases from 5' and/or 3' ends of each read + before adapter removal. Applied to both reads if data is + paired. If one value is given, only the 3' end is trimmed. + If two comma-separated cutoffs are given, the 5' end is + trimmed with the first cutoff, the 3' end with the second. + - name: --quality_cutoff_r2 + alternatives: [-Q] + type: string + description: | + Quality-trimming cutoff for R2. Default: same as for R1 + - name: --quality_base + type: integer + description: | + Assume that quality values in FASTQ are encoded as + ascii(quality + N). This needs to be set to 64 for some + old Illumina FASTQ files. The default is 33. + example: 33 + - name: --poly_a + type: boolean_true + description: Trim poly-A tails + - name: --length + alternatives: [-l] + type: integer + description: | + Shorten reads to LENGTH. Positive values remove bases at + the end while negative ones remove bases at the beginning. + This and the following modifications are applied after + adapter trimming. + - name: --trim_n + type: boolean_true + description: Trim N's on ends of reads. + - name: --length_tag + type: string + description: | + Search for TAG followed by a decimal number in the + description field of the read. Replace the decimal number + with the correct length of the trimmed read. For example, + use --length-tag 'length=' to correct fields like + 'length=123'. + example: "length=" + - name: --strip_suffix + type: string + description: | + Remove this suffix from read names if present. Can be + given multiple times. + - name: --prefix + alternatives: [-x] + type: string + description: | + Add this prefix to read names. Use {name} to insert the + name of the matching adapter. + - name: --suffix + alternatives: [-y] + type: string + description: | + Add this suffix to read names; can also include {name} + - name: --rename + type: string + description: | + Rename reads using TEMPLATE containing variables such as + {id}, {adapter_name} etc. (see documentation) + - name: --zero_cap + alternatives: [-z] + type: boolean_true + description: Change negative quality values to zero. + + #################################################################### + - name: Filtering of processed reads + description: | + Filters are applied after above read modifications. Paired-end reads are + always discarded pairwise (see also --pair_filter). + arguments: + - name: --minimum_length + alternatives: [-m] + type: string + description: | + Discard reads shorter than LEN. Default is 0. + When trimming paired-end reads, the minimum lengths for R1 and R2 can be specified separately by separating them with a colon (:). + If the colon syntax is not used, the same minimum length applies to both reads, as discussed above. + Also, one of the values can be omitted to impose no restrictions. + For example, with -m 17:, the length of R1 must be at least 17, but the length of R2 is ignored. + example: "0" + - name: --maximum_length + alternatives: [-M] + type: string + description: | + Discard reads longer than LEN. Default: no limit. + For paired reads, see the remark for --minimum_length + - name: --max_n + type: string + description: | + Discard reads with more than COUNT 'N' bases. If COUNT is + a number between 0 and 1, it is interpreted as a fraction + of the read length. + - name: --max_expected_errors + alternatives: [--max_ee] + type: long + description: | + Discard reads whose expected number of errors (computed + from quality values) exceeds ERRORS. + - name: --max_average_error_rate + alternatives: [--max_aer] + type: long + description: | + as --max_expected_errors (see above), but divided by + length to account for reads of varying length. + - name: --discard_trimmed + alternatives: [--discard] + type: boolean_true + description: | + Discard reads that contain an adapter. Use also -O to + avoid discarding too many randomly matching reads. + - name: --discard_untrimmed + alternatives: [--trimmed_only] + type: boolean_true + description: | + Discard reads that do not contain an adapter. + - name: --discard_casava + type: boolean_true + description: | + Discard reads that did not pass CASAVA filtering (header + has :Y:). + + #################################################################### + - name: Output parameters + arguments: + - name: --report + type: string + choices: [full, minimal] + description: | + Which type of report to print: 'full' (default) or 'minimal'. + example: full + - name: --json + type: boolean_true + description: | + Write report in JSON format to this file. + - name: --output + type: file + description: | + Glob pattern for matching the expected output files. + Should include `$output_dir`. + example: "fastq/*_001.fast[a,q]" + direction: output + required: true + must_exist: true + multiple: true + - name: --fasta + type: boolean_true + description: | + Output FASTA to standard output even on FASTQ input. + - name: --info_file + type: boolean_true + description: | + Write information about each read and its adapter matches + into info.txt in the output directory. + See the documentation for the file format. + # - name: -Z + # - name: --rest_file + # - name: --wildcard-file + # - name: --too_short_output + # - name: --too_long_output + # - name: --untrimmed_output + # - name: --untrimmed_paired_output + # - name: too_short_paired_output + # - name: too_long_paired_output + - name: Debug + arguments: + - type: boolean_true + name: --debug + description: Print debug information +resources: + - type: bash_script + path: script.sh +test_resources: + - type: bash_script + path: test.sh + +engines: + - type: docker + image: python:3.12 + setup: + - type: python + pip: + - cutadapt + - type: docker + run: | + cutadapt --version | sed 's/\(.*\)/cutadapt: "\1"/' > /var/software_versions.txt +runners: + - type: executable + - type: nextflow diff --git a/src/cutadapt/help.txt b/src/cutadapt/help.txt new file mode 100644 index 00000000..2280c3e2 --- /dev/null +++ b/src/cutadapt/help.txt @@ -0,0 +1,218 @@ +cutadapt version 4.6 + +Copyright (C) 2010 Marcel Martin and contributors + +Cutadapt removes adapter sequences from high-throughput sequencing reads. + +Usage: + cutadapt -a ADAPTER [options] [-o output.fastq] input.fastq + +For paired-end reads: + cutadapt -a ADAPT1 -A ADAPT2 [options] -o out1.fastq -p out2.fastq in1.fastq in2.fastq + +Replace "ADAPTER" with the actual sequence of your 3' adapter. IUPAC wildcard +characters are supported. All reads from input.fastq will be written to +output.fastq with the adapter sequence removed. Adapter matching is +error-tolerant. Multiple adapter sequences can be given (use further -a +options), but only the best-matching adapter will be removed. + +Input may also be in FASTA format. Compressed input and output is supported and +auto-detected from the file name (.gz, .xz, .bz2). Use the file name '-' for +standard input/output. Without the -o option, output is sent to standard output. + +Citation: + +Marcel Martin. Cutadapt removes adapter sequences from high-throughput +sequencing reads. EMBnet.Journal, 17(1):10-12, May 2011. +http://dx.doi.org/10.14806/ej.17.1.200 + +Run "cutadapt --help" to see all command-line options. +See https://cutadapt.readthedocs.io/ for full documentation. + +Options: + -h, --help Show this help message and exit + --version Show version number and exit + --debug Print debug log. Use twice to also print DP matrices + -j CORES, --cores CORES + Number of CPU cores to use. Use 0 to auto-detect. Default: + 1 + +Finding adapters: + Parameters -a, -g, -b specify adapters to be removed from each read (or from + R1 if data is paired-end. If specified multiple times, only the best matching + adapter is trimmed (but see the --times option). Use notation 'file:FILE' to + read adapter sequences from a FASTA file. + + -a ADAPTER, --adapter ADAPTER + Sequence of an adapter ligated to the 3' end (paired data: + of the first read). The adapter and subsequent bases are + trimmed. If a '$' character is appended ('anchoring'), the + adapter is only found if it is a suffix of the read. + -g ADAPTER, --front ADAPTER + Sequence of an adapter ligated to the 5' end (paired data: + of the first read). The adapter and any preceding bases + are trimmed. Partial matches at the 5' end are allowed. If + a '^' character is prepended ('anchoring'), the adapter is + only found if it is a prefix of the read. + -b ADAPTER, --anywhere ADAPTER + Sequence of an adapter that may be ligated to the 5' or 3' + end (paired data: of the first read). Both types of + matches as described under -a and -g are allowed. If the + first base of the read is part of the match, the behavior + is as with -g, otherwise as with -a. This option is mostly + for rescuing failed library preparations - do not use if + you know which end your adapter was ligated to! + -e E, --error-rate E, --errors E + Maximum allowed error rate (if 0 <= E < 1), or absolute + number of errors for full-length adapter match (if E is an + integer >= 1). Error rate = no. of errors divided by + length of matching region. Default: 0.1 (10%) + --no-indels Allow only mismatches in alignments. Default: allow both + mismatches and indels + -n COUNT, --times COUNT + Remove up to COUNT adapters from each read. Default: 1 + -O MINLENGTH, --overlap MINLENGTH + Require MINLENGTH overlap between read and adapter for an + adapter to be found. Default: 3 + --match-read-wildcards + Interpret IUPAC wildcards in reads. Default: False + -N, --no-match-adapter-wildcards + Do not interpret IUPAC wildcards in adapters. + --action {trim,retain,mask,lowercase,none} + What to do if a match was found. trim: trim adapter and + up- or downstream sequence; retain: trim, but retain + adapter; mask: replace with 'N' characters; lowercase: + convert to lowercase; none: leave unchanged. Default: trim + --rc, --revcomp Check both the read and its reverse complement for adapter + matches. If match is on reverse-complemented version, + output that one. Default: check only read + +Additional read modifications: + -u LEN, --cut LEN Remove LEN bases from each read (or R1 if paired; use -U + option for R2). If LEN is positive, remove bases from the + beginning. If LEN is negative, remove bases from the end. + Can be used twice if LENs have different signs. Applied + *before* adapter trimming. + --nextseq-trim 3'CUTOFF + NextSeq-specific quality trimming (each read). Trims also + dark cycles appearing as high-quality G bases. + -q [5'CUTOFF,]3'CUTOFF, --quality-cutoff [5'CUTOFF,]3'CUTOFF + Trim low-quality bases from 5' and/or 3' ends of each read + before adapter removal. Applied to both reads if data is + paired. If one value is given, only the 3' end is trimmed. + If two comma-separated cutoffs are given, the 5' end is + trimmed with the first cutoff, the 3' end with the second. + --quality-base N Assume that quality values in FASTQ are encoded as + ascii(quality + N). This needs to be set to 64 for some + old Illumina FASTQ files. Default: 33 + --poly-a Trim poly-A tails + --length LENGTH, -l LENGTH + Shorten reads to LENGTH. Positive values remove bases at + the end while negative ones remove bases at the beginning. + This and the following modifications are applied after + adapter trimming. + --trim-n Trim N's on ends of reads. + --length-tag TAG Search for TAG followed by a decimal number in the + description field of the read. Replace the decimal number + with the correct length of the trimmed read. For example, + use --length-tag 'length=' to correct fields like + 'length=123'. + --strip-suffix STRIP_SUFFIX + Remove this suffix from read names if present. Can be + given multiple times. + -x PREFIX, --prefix PREFIX + Add this prefix to read names. Use {name} to insert the + name of the matching adapter. + -y SUFFIX, --suffix SUFFIX + Add this suffix to read names; can also include {name} + --rename TEMPLATE Rename reads using TEMPLATE containing variables such as + {id}, {adapter_name} etc. (see documentation) + --zero-cap, -z Change negative quality values to zero. + +Filtering of processed reads: + Filters are applied after above read modifications. Paired-end reads are + always discarded pairwise (see also --pair-filter). + + -m LEN[:LEN2], --minimum-length LEN[:LEN2] + Discard reads shorter than LEN. Default: 0 + -M LEN[:LEN2], --maximum-length LEN[:LEN2] + Discard reads longer than LEN. Default: no limit + --max-n COUNT Discard reads with more than COUNT 'N' bases. If COUNT is + a number between 0 and 1, it is interpreted as a fraction + of the read length. + --max-expected-errors ERRORS, --max-ee ERRORS + Discard reads whose expected number of errors (computed + from quality values) exceeds ERRORS. + --max-average-error-rate ERROR_RATE, --max-aer ERROR_RATE + as --max-expected-errors (see above), but divided by + length to account for reads of varying length. + --discard-trimmed, --discard + Discard reads that contain an adapter. Use also -O to + avoid discarding too many randomly matching reads. + --discard-untrimmed, --trimmed-only + Discard reads that do not contain an adapter. + --discard-casava Discard reads that did not pass CASAVA filtering (header + has :Y:). + +Output: + --quiet Print only error messages. + --report {full,minimal} + Which type of report to print: 'full' or 'minimal'. + Default: full + --json FILE Dump report in JSON format to FILE + -o FILE, --output FILE + Write trimmed reads to FILE. FASTQ or FASTA format is + chosen depending on input. Summary report is sent to + standard output. Use '{name}' for demultiplexing (see + docs). Default: write to standard output + --fasta Output FASTA to standard output even on FASTQ input. + -Z Use compression level 1 for gzipped output files (faster, + but uses more space) + --info-file FILE Write information about each read and its adapter matches + into FILE. See the documentation for the file format. + -r FILE, --rest-file FILE + When the adapter matches in the middle of a read, write + the rest (after the adapter) to FILE. + --wildcard-file FILE When the adapter has N wildcard bases, write adapter bases + matching wildcard positions to FILE. (Inaccurate with + indels.) + --too-short-output FILE + Write reads that are too short (according to length + specified by -m) to FILE. Default: discard reads + --too-long-output FILE + Write reads that are too long (according to length + specified by -M) to FILE. Default: discard reads + --untrimmed-output FILE + Write reads that do not contain any adapter to FILE. + Default: output to same file as trimmed reads + +Paired-end options: + The -A/-G/-B/-U/-Q options work like their lowercase counterparts, but are + applied to R2 (second read in pair) + + -A ADAPTER 3' adapter to be removed from R2 + -G ADAPTER 5' adapter to be removed from R2 + -B ADAPTER 5'/3 adapter to be removed from R2 + -U LENGTH Remove LENGTH bases from R2 + -Q [5'CUTOFF,]3'CUTOFF + Quality-trimming cutoff for R2. Default: same as for R1 + -p FILE, --paired-output FILE + Write R2 to FILE. + --pair-adapters Treat adapters given with -a/-A etc. as pairs. Either both + or none are removed from each read pair. + --pair-filter {any,both,first} + Which of the reads in a paired-end read have to match the + filtering criterion in order for the pair to be filtered. + Default: any + --interleaved Read and/or write interleaved paired-end reads. + --untrimmed-paired-output FILE + Write second read in a pair to this FILE when no adapter + was found. Use with --untrimmed-output. Default: output to + same file as trimmed reads + --too-short-paired-output FILE + Write second read in a pair to this file if pair is too + short. + --too-long-paired-output FILE + Write second read in a pair to this file if pair is too + long. + diff --git a/src/cutadapt/script.sh b/src/cutadapt/script.sh new file mode 100644 index 00000000..5e1f9e30 --- /dev/null +++ b/src/cutadapt/script.sh @@ -0,0 +1,237 @@ +#!/bin/bash + +## VIASH START +par_adapter='AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;GGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' +par_input='src/cutadapt/test_data/se/a.fastq' +par_report='full' +par_json='false' +par_fasta='false' +par_info_file='false' +par_debug='true' +## VIASH END + +function debug { + [[ "$par_debug" == "true" ]] && echo "DEBUG: $@" +} + +output_dir=$(dirname $par_output) +[[ ! -d $output_dir ]] && mkdir -p $output_dir + +# Init +########################################################### + +echo ">> Paired-end data or not?" + +mode="" +if [[ -z $par_input_r2 ]]; then + mode="se" + echo " Single end" + input="$par_input" +else + echo " Paired end" + mode="pe" + input="$par_input $par_input_r2" +fi + +# Adapter arguments +# - paired and single-end +# - string and fasta +########################################################### + +function add_flags { + local arg=$1 + local flag=$2 + local prefix=$3 + [[ -z $prefix ]] && prefix="" + + # This function should not be called if the input is empty + # but check for it just in case + if [[ -z $arg ]]; then + return + fi + + local output="" + IFS=';' read -r -a array <<< "$arg" + for a in "${array[@]}"; do + output="$output $flag $prefix$a" + done + echo $output +} + +debug ">> Parsing arguments dealing with adapters" +adapter_args=$(echo \ + ${par_adapter:+$(add_flags "$par_adapter" "--adapter")} \ + ${par_adapter_fasta:+$(add_flags "$par_adapter_fasta" "--adapter" "file:")} \ + ${par_front:+$(add_flags "$par_front" "--front")} \ + ${par_front_fasta:+$(add_flags "$par_front_fasta" "--front" "file:")} \ + ${par_anywhere:+$(add_flags "$par_anywhere" "--anywhere")} \ + ${par_anywhere_fasta:+$(add_flags "$par_anywhere_fasta" "--anywhere" "file:")} \ + ${par_adapter_r2:+$(add_flags "$par_adapter_r2" "-A")} \ + ${par_adapter_fasta_r2:+$(add_flags "$par_adapter_fasta_r2" "-A" "file:")} \ + ${par_front_r2:+$(add_flags "$par_front_r2" "-G")} \ + ${par_front_fasta_r2:+$(add_flags "$par_front_fasta_r2" "-G" "file:")} \ + ${par_anywhere_r2:+$(add_flags "$par_anywhere_r2" "-B")} \ + ${par_anywhere_fasta_r2:+$(add_flags "$par_anywhere_fasta_r2" "-B" "file:")} \ +) + +debug "Arguments to cutadapt:" +debug "$adapter_args" +debug + +# Paired-end options +########################################################### +echo ">> Parsing arguments for paired-end reads" +[[ "$par_pair_adapters" == "false" ]] && unset par_pair_adapters +[[ "$par_interleaved" == "false" ]] && unset par_interleaved + +paired_args=$(echo \ + ${par_pair_adapters:+--pair-adapters} \ + ${par_pair_filter:+--pair-filter "${par_pair_filter}"} \ + ${par_interleaved:+--interleaved} +) +debug "Arguments to cutadapt:" +debug $paired_args +debug + +# Input arguments +########################################################### +echo ">> Parsing input arguments" +[[ "$par_no_indels" == "true" ]] && unset par_no_indels +[[ "$par_match_read_wildcards" == "false" ]] && unset par_match_read_wildcards +[[ "$par_no_match_adapter_wildcards" == "true" ]] && unset par_no_match_adapter_wildcards +[[ "$par_revcomp" == "false" ]] && unset par_revcomp + +input_args=$(echo \ + ${par_error_rate:+--error-rate "${par_error_rate}"} \ + ${par_no_indels:+--no-indels} \ + ${par_times:+--times "${par_times}"} \ + ${par_overlap:+--overlap "${par_overlap}"} \ + ${par_match_read_wildcards:+--match-read-wildcards} \ + ${par_no_match_adapter_wildcards:+--no-match-adapter-wildcards} \ + ${par_action:+--action "${par_action}"} \ + ${par_revcomp:+--revcomp} \ +) +debug "Arguments to cutadapt:" +debug $input_args +debug + +# Read modifications +########################################################### +echo ">> Parsing read modification arguments" +[[ "$par_poly_a" == "false" ]] && unset par_poly_a +[[ "$par_trim_n" == "false" ]] && unset par_trim_n +[[ "$par_zero_cap" == "false" ]] && unset par_zero_cap + +mod_args=$(echo \ + ${par_cut:+--cut "${par_cut}"} \ + ${par_cut_r2:+--cut_r2 "${par_cut_r2}"} \ + ${par_nextseq_trim:+--nextseq-trim "${par_nextseq_trim}"} \ + ${par_quality_cutoff:+--quality-cutoff "${par_quality_cutoff}"} \ + ${par_quality_cutoff_r2:+--quality-cutoff_r2 "${par_quality_cutoff_r2}"} \ + ${par_quality_base:+--quality-base "${par_quality_base}"} \ + ${par_poly_a:+--poly-a} \ + ${par_length:+--length "${par_length}"} \ + ${par_trim_n:+--trim-n} \ + ${par_length_tag:+--length-tag "${par_length_tag}"} \ + ${par_strip_suffix:+--strip-suffix "${par_strip_suffix}"} \ + ${par_prefix:+--prefix "${par_prefix}"} \ + ${par_suffix:+--suffix "${par_suffix}"} \ + ${par_rename:+--rename "${par_rename}"} \ + ${par_zero_cap:+--zero-cap} \ +) +debug "Arguments to cutadapt:" +debug $mod_args +debug + +# Filtering of processed reads arguments +########################################################### +echo ">> Filtering of processed reads arguments" +[[ "$par_discard_trimmed" == "false" ]] && unset par_discard_trimmed +[[ "$par_discard_untrimmed" == "false" ]] && unset par_discard_untrimmed +[[ "$par_discard_casava" == "false" ]] && unset par_discard_casava + +# Parse and transform the minimum and maximum length arguments +[[ -z $par_minimum_length ]] + +filter_args=$(echo \ + ${par_minimum_length:+--minimum-length "${par_minimum_length}"} \ + ${par_maximum_length:+--maximum-length "${par_maximum_length}"} \ + ${par_max_n:+--max-n "${par_max_n}"} \ + ${par_max_expected_errors:+--max-expected-errors "${par_max_expected_errors}"} \ + ${par_max_average_error_rate:+--max-average-error-rate "${par_max_average_error_rate}"} \ + ${par_discard_trimmed:+--discard-trimmed} \ + ${par_discard_untrimmed:+--discard-untrimmed} \ + ${par_discard_casava:+--discard-casava} \ +) +debug "Arguments to cutadapt:" +debug $filter_args +debug + +# Optional output arguments +########################################################### +echo ">> Optional arguments" +[[ "$par_json" == "false" ]] && unset par_json +[[ "$par_fasta" == "false" ]] && unset par_fasta +[[ "$par_info_file" == "false" ]] && unset par_info_file + +optional_output_args=$(echo \ + ${par_report:+--report "${par_report}"} \ + ${par_json:+--json "report.json"} \ + ${par_fasta:+--fasta} \ + ${par_info_file:+--info-file "info.txt"} \ +) + +debug "Arguments to cutadapt:" +debug $optional_output_args +debug + +# Output arguments +# We write the output to a directory rather than +# individual files. +########################################################### + +if [[ -z $par_fasta ]]; then + ext="fastq" +else + ext="fasta" +fi + +if [ $mode = "se" ]; then + output_args=$(echo \ + --output "$output_dir/{name}_001.$ext" \ + ) +else + output_args=$(echo \ + --output "$output_dir/{name}_R1_001.$ext" \ + --paired-output "$output_dir/{name}_R2_001.$ext" \ + ) +fi + +debug "Arguments to cutadapt:" +debug $output_args +debug + +# Full CLI +# Set the --cores argument to 0 unless meta_cpus is set +########################################################### +echo ">> Running cutadapt" +par_cpus=0 +[[ ! -z $meta_cpus ]] && par_cpus=$meta_cpus + +cli=$(echo \ + $input \ + $adapter_args \ + $paired_args \ + $input_args \ + $mod_args \ + $filter_args \ + $optional_output_args \ + $output_args \ + --cores $par_cpus +) + +debug ">> Full CLI to be run:" +debug cutadapt $cli | sed -e 's/--/\r\n --/g' +debug + +cutadapt $cli diff --git a/src/cutadapt/test.sh b/src/cutadapt/test.sh new file mode 100644 index 00000000..eff997d7 --- /dev/null +++ b/src/cutadapt/test.sh @@ -0,0 +1,256 @@ +#!/bin/bash + +set -e + +############################################# +# helper functions +assert_file_exists() { + [ -f "$1" ] || (echo "File '$1' does not exist" && exit 1) +} +assert_file_doesnt_exist() { + [ ! -f "$1" ] || (echo "File '$1' exists but shouldn't" && exit 1) +} +assert_file_empty() { + [ ! -s "$1" ] || (echo "File '$1' is not empty but should be" && exit 1) +} +assert_file_not_empty() { + [ -s "$1" ] || (echo "File '$1' is empty but shouldn't be" && exit 1) +} +assert_file_contains() { + grep -q "$2" "$1" || (echo "File '$1' does not contain '$2'" && exit 1) +} +assert_file_not_contains() { + grep -q "$2" "$1" && (echo "File '$1' contains '$2' but shouldn't" && exit 1) +} + +############################################# +mkdir test_multiple_output +cd test_multiple_output + +echo "#############################################" +echo "> Run cutadapt with multiple outputs" + +cat > example.fa <<'EOF' +>read1 +MYSEQUENCEADAPTER +>read2 +MYSEQUENCEADAP +>read3 +MYSEQUENCEADAPTERSOMETHINGELSE +>read4 +MYSEQUENCEADABTER +>read5 +MYSEQUENCEADAPTR +>read6 +MYSEQUENCEADAPPTER +>read7 +ADAPTERMYSEQUENCE +>read8 +PTERMYSEQUENCE +>read9 +SOMETHINGADAPTERMYSEQUENCE +EOF + +"$meta_executable" \ + --report minimal \ + --output "out_test/*.fasta" \ + --adapter ADAPTER \ + --input example.fa \ + --fasta \ + --no_match_adapter_wildcards \ + --json + +echo ">> Checking output" +assert_file_exists "report.json" +assert_file_exists "out_test/1_001.fasta" +assert_file_exists "out_test/unknown_001.fasta" + +cd .. +echo + +############################################# +mkdir test_simple_single_end +cd test_simple_single_end + +echo "#############################################" +echo "> Run cutadapt on single-end data" + +cat > example.fa <<'EOF' +>read1 +MYSEQUENCEADAPTER +>read2 +MYSEQUENCEADAP +>read3 +MYSEQUENCEADAPTERSOMETHINGELSE +>read4 +MYSEQUENCEADABTER +>read5 +MYSEQUENCEADAPTR +>read6 +MYSEQUENCEADAPPTER +>read7 +ADAPTERMYSEQUENCE +>read8 +PTERMYSEQUENCE +>read9 +SOMETHINGADAPTERMYSEQUENCE +EOF + +"$meta_executable" \ + --report minimal \ + --output "out_test1/*.fasta" \ + --adapter ADAPTER \ + --input example.fa \ + --fasta \ + --no_match_adapter_wildcards \ + --json + +echo ">> Checking output" +assert_file_exists "report.json" +assert_file_exists "out_test1/1_001.fasta" +assert_file_exists "out_test1/unknown_001.fasta" + +echo ">> Check if output is empty" +assert_file_not_empty "report.json" +assert_file_not_empty "out_test1/1_001.fasta" +assert_file_not_empty "out_test1/unknown_001.fasta" + +echo ">> Check contents" +for i in 1 2 3 7 9; do + assert_file_contains "out_test1/1_001.fasta" ">read$i" +done +for i in 4 5 6 8; do + assert_file_contains "out_test1/unknown_001.fasta" ">read$i" +done + +cd .. +echo + +############################################# +mkdir test_multiple_single_end +cd test_multiple_single_end + +echo "#############################################" +echo "> Run with a combination of inputs" + +cat > example.fa <<'EOF' +>read1 +ACGTACGTACGTAAAAA +>read2 +ACGTACGTACGTCCCCC +>read3 +ACGTACGTACGTGGGGG +>read4 +ACGTACGTACGTTTTTT +EOF + +cat > adapters1.fasta <<'EOF' +>adapter1 +CCCCC +EOF + +cat > adapters2.fasta <<'EOF' +>adapter2 +GGGGG +EOF + +"$meta_executable" \ + --report minimal \ + --output "out_test2/*.fasta" \ + --adapter AAAAA \ + --adapter_fasta adapters1.fasta \ + --adapter_fasta adapters2.fasta \ + --input example.fa \ + --fasta \ + --json + +echo ">> Checking output" +assert_file_exists "report.json" +assert_file_exists "out_test2/1_001.fasta" +assert_file_exists "out_test2/adapter1_001.fasta" +assert_file_exists "out_test2/adapter2_001.fasta" +assert_file_exists "out_test2/unknown_001.fasta" + +echo ">> Check if output is empty" +assert_file_not_empty "report.json" +assert_file_not_empty "out_test2/1_001.fasta" +assert_file_not_empty "out_test2/adapter1_001.fasta" +assert_file_not_empty "out_test2/adapter2_001.fasta" +assert_file_not_empty "out_test2/unknown_001.fasta" + +echo ">> Check contents" +assert_file_contains "out_test2/1_001.fasta" ">read1" +assert_file_contains "out_test2/adapter1_001.fasta" ">read2" +assert_file_contains "out_test2/adapter2_001.fasta" ">read3" +assert_file_contains "out_test2/unknown_001.fasta" ">read4" + +cd .. +echo + +############################################# +mkdir test_simple_paired_end +cd test_simple_paired_end + +echo "#############################################" +echo "> Run cutadapt on paired-end data" + +cat > example_R1.fastq <<'EOF' +@read1 +ACGTACGTACGTAAAAA ++ +IIIIIIIIIIIIIIIII +@read2 +ACGTACGTACGTCCCCC ++ +IIIIIIIIIIIIIIIII +EOF + +cat > example_R2.fastq <<'EOF' +@read1 +ACGTACGTACGTGGGGG ++ +IIIIIIIIIIIIIIIII +@read2 +ACGTACGTACGTTTTTT ++ +IIIIIIIIIIIIIIIII +EOF + +"$meta_executable" \ + --report minimal \ + --output "out_test3/*.fastq" \ + --adapter AAAAA \ + --adapter_r2 GGGGG \ + --input example_R1.fastq \ + --input_r2 example_R2.fastq \ + --quality_cutoff 20 \ + --json \ + ---cpus 1 + +echo ">> Checking output" +assert_file_exists "report.json" +assert_file_exists "out_test3/1_R1_001.fastq" +assert_file_exists "out_test3/1_R2_001.fastq" +assert_file_exists "out_test3/unknown_R1_001.fastq" +assert_file_exists "out_test3/unknown_R2_001.fastq" + +echo ">> Check if output is empty" +assert_file_not_empty "report.json" +assert_file_not_empty "out_test3/1_R1_001.fastq" +assert_file_not_empty "out_test3/1_R2_001.fastq" +assert_file_not_empty "out_test3/unknown_R1_001.fastq" + +echo ">> Check contents" +assert_file_contains "out_test3/1_R1_001.fastq" "@read1" +assert_file_contains "out_test3/1_R2_001.fastq" "@read1" +assert_file_contains "out_test3/unknown_R1_001.fastq" "@read2" +assert_file_contains "out_test3/unknown_R2_001.fastq" "@read2" + +cd .. +echo + +############################################# + +echo "#############################################" +echo "> Test successful" + diff --git a/src/pear/script.sh b/src/pear/script.sh index f7d6a28f..9eff147b 100644 --- a/src/pear/script.sh +++ b/src/pear/script.sh @@ -1,5 +1,7 @@ #!/bin/bash +set -eo pipefail + ## VIASH START ## VIASH END diff --git a/src/salmon/salmon_quant/config.vsh.yaml b/src/salmon/salmon_quant/config.vsh.yaml index 47d72665..b7e303f4 100644 --- a/src/salmon/salmon_quant/config.vsh.yaml +++ b/src/salmon/salmon_quant/config.vsh.yaml @@ -42,7 +42,7 @@ argument_groups: type: file description: | Salmon index. - required: true + required: false example: transcriptome_index - name: --unmated_reads alternatives: ["-r"] @@ -320,12 +320,15 @@ argument_groups: example: 0.00001 - name: --write_mappings alternatives: ["-z"] - type: file - direction: output + type: boolean_true description: | If this option is provided, then the selective-alignment results will be written out in SAM-compatible format. By default, output will be directed to stdout, but an alternative file name can be provided instead. + - name: --mapping_sam + type: file + description: Path to file that should output the selective-alignment results in SAM-compatible format. THis option must be provided while using --write_mappings required: false - example: mappings.sam + direction: output + example: mappings.sam - name: --write_qualities type: boolean_true description: | diff --git a/src/salmon/salmon_quant/script.sh b/src/salmon/salmon_quant/script.sh index ace79711..4c9f69d5 100644 --- a/src/salmon/salmon_quant/script.sh +++ b/src/salmon/salmon_quant/script.sh @@ -21,6 +21,7 @@ set -e [[ "$par_softclip_overhangs" == "false" ]] && unset par_softclip_overhangs [[ "$par_full_length_alignment" == "false" ]] && unset par_full_length_alignment [[ "$par_hard_filter" == "false" ]] && unset par_hard_filter +[[ "$par_write_mappings" == "false" ]] && unset par_write_mappings [[ "$par_write_qualities" == "false" ]] && unset par_write_qualities [[ "$par_alternative_init_mode" == "false" ]] && unset par_alternative_init_mode [[ "$par_skip_quant" == "false" ]] && unset par_skip_quant @@ -96,7 +97,7 @@ salmon quant \ ${par_full_length_alignment:+--fullLengthAlignment} \ ${par_hard_filter:+--hardFilter} \ ${par_min_aln_prob:+--minAlnProb "${par_min_aln_prob}"} \ - ${par_write_mappings:+-z "${par_write_mappings}"} \ + ${par_write_mappings:+--write_mappings="${par_mappings_sam}"} \ ${par_write_qualities:+--writeQualities} \ ${par_hit_filter_policy:+--hitFilterPolicy "${par_hit_filter_policy}"} \ ${par_alternative_init_mode:+--alternativeInitMode} \ diff --git a/src/star/star_align_reads/config.vsh.yaml b/src/star/star_align_reads/config.vsh.yaml index 8fdd5256..eab65b35 100644 --- a/src/star/star_align_reads/config.vsh.yaml +++ b/src/star/star_align_reads/config.vsh.yaml @@ -72,6 +72,12 @@ argument_groups: description: The output file containing the splice junctions. direction: output example: splice_junctions.tsv + - type: file + name: --reads_aligned_to_transcriptome + required: false + description: The output file containing the alignments to transcriptome in BAM formats. This file is generated when --quantMode is set to TranscriptomeSAM. + direction: output + example: transcriptome_aligned.bam # other arguments are defined in a separate file __merge__: argument_groups.yaml resources: diff --git a/src/star/star_align_reads/script.py b/src/star/star_align_reads/script.py index 2bde8798..f3d64a57 100644 --- a/src/star/star_align_reads/script.py +++ b/src/star/star_align_reads/script.py @@ -58,7 +58,8 @@ "log": "Log.final.out", "splice_junctions": "SJ.out.tab", "unmapped": "Unmapped.out.mate1", - "unmapped_r2": "Unmapped.out.mate2" + "unmapped_r2": "Unmapped.out.mate2", + "reads_aligned_to_transcriptome": "Aligned.toTranscriptome.out.bam" } output_paths = {name: par[name] for name in expected_outputs.keys()} for name in expected_outputs.keys(): diff --git a/src/star/star_align_reads/test.sh b/src/star/star_align_reads/test.sh index 374b9014..a15ea599 100644 --- a/src/star/star_align_reads/test.sh +++ b/src/star/star_align_reads/test.sh @@ -98,6 +98,7 @@ echo "> Run star_align_reads on SE" --reads_per_gene "reads_per_gene.tsv" \ --outSJtype Standard \ --splice_junctions "splice_junctions.tsv" \ + --reads_aligned_to_transcriptome "transcriptome_aligned.bam" \ ${meta_cpus:+---cpus $meta_cpus} # TODO: Test data doesn't contain any chimeric reads yet @@ -111,6 +112,7 @@ assert_file_exists "reads_per_gene.tsv" # assert_file_exists "chimeric_junctions.tsv" assert_file_exists "splice_junctions.tsv" assert_file_exists "unmapped.sam" +assert_file_exists "transcriptome_aligned.bam" echo ">> Check if output contents are not empty" assert_file_not_empty "output.sam" @@ -119,6 +121,7 @@ assert_file_not_empty "reads_per_gene.tsv" # assert_file_not_empty "chimeric_junctions.tsv" # assert_file_not_empty "splice_junctions.tsv" # TODO: test data doesn't contain any splice junctions yet assert_file_not_empty "unmapped.sam" +assert_file_not_empty "transcriptome_aligned.bam" echo ">> Check if output contents are correct" assert_file_contains "log.txt" "Number of input reads \\| 2" diff --git a/src/star/star_genome_generate/config.vsh.yaml b/src/star/star_genome_generate/config.vsh.yaml new file mode 100644 index 00000000..3adaf7a2 --- /dev/null +++ b/src/star/star_genome_generate/config.vsh.yaml @@ -0,0 +1,139 @@ +name: star_genome_generate +namespace: star +description: | + Create index for STAR +keywords: [genome, index, align] +links: + repository: https://github.com/alexdobin/STAR + documentation: https://github.com/alexdobin/STAR/blob/master/doc/STARmanual.pdf +references: + doi: 10.1093/bioinformatics/bts635 +license: MIT +requirements: + commands: [ STAR ] + +argument_groups: +- name: "Input" + arguments: + - name: "--genomeFastaFiles" + type: file + description: | + Path(s) to the fasta files with the genome sequences, separated by spaces. These files should be plain text FASTA files, they *cannot* be zipped. + required: true + multiple: yes + multiple_sep: ; + - name: "--sjdbGTFfile" + type: file + description: Path to the GTF file with annotations + - name: --sjdbOverhang + type: integer + description: Length of the donor/acceptor sequence on each side of the junctions, ideally = (mate_length - 1) + example: 100 + - name: --sjdbGTFchrPrefix + type: string + description: Prefix for chromosome names in a GTF file (e.g. 'chr' for using ENSMEBL annotations with UCSC genomes) + - name: --sjdbGTFfeatureExon + type: string + description: Feature type in GTF file to be used as exons for building transcripts + example: exon + - name: --sjdbGTFtagExonParentTranscript + type: string + description: GTF attribute name for parent transcript ID (default "transcript_id" works for GTF files) + example: transcript_id + - name: --sjdbGTFtagExonParentGene + type: string + description: GTF attribute name for parent gene ID (default "gene_id" works for GTF files) + example: gene_id + - name: --sjdbGTFtagExonParentGeneName + type: string + description: GTF attribute name for parent gene name + example: gene_name + multiple: yes + multiple_sep: ; + - name: --sjdbGTFtagExonParentGeneType + type: string + description: GTF attribute name for parent gene type + example: + - gene_type + - gene_biotype + multiple: yes + multiple_sep: ; + - name: --limitGenomeGenerateRAM + type: long + description: Maximum available RAM (bytes) for genome generation + example: '31000000000' + - name: --genomeSAindexNbases + type: integer + description: Length (bases) of the SA pre-indexing string. Typically between 10 and 15. Longer strings will use much more memory, but allow faster searches. For small genomes, this parameter must be scaled down to min(14, log2(GenomeLength)/2 - 1). + example: 14 + - name: --genomeChrBinNbits + type: integer + description: Defined as log2(chrBin), where chrBin is the size of the bins for genome storage. Each chromosome will occupy an integer number of bins. For a genome with large number of contigs, it is recommended to scale this parameter as min(18, log2[max(GenomeLength/NumberOfReferences,ReadLength)]). + example: 18 + - name: --genomeSAsparseD + type: integer + min: 0 + example: 1 + description: Suffux array sparsity, i.e. distance between indices. Use bigger numbers to decrease needed RAM at the cost of mapping speed reduction. + - name: --genomeSuffixLengthMax + type: integer + description: Maximum length of the suffixes, has to be longer than read length. Use -1 for infinite length. + example: -1 + - name: --genomeTransformType + type: string + description: | + Type of genome transformation + None ... no transformation + Haploid ... replace reference alleles with alternative alleles from VCF file (e.g. consensus allele) + Diploid ... create two haplotypes for each chromosome listed in VCF file, for genotypes 1|2, assumes perfect phasing (e.g. personal genome) + example: None + - name: --genomeTransformVCF + type: file + description: path to VCF file for genome transformation + +- name: "Output" + arguments: + - name: "--index" + type: file + direction: output + description: STAR index directory. + default: STAR_index + required: true + +resources: + - type: bash_script + path: script.sh + +test_resources: + - type: bash_script + path: test.sh + +engines: +- type: docker + image: ubuntu:22.04 + setup: + # setup derived from https://github.com/alexdobin/STAR/blob/master/extras/docker/Dockerfile + - type: docker + env: + - STAR_VERSION 2.7.11b + - PACKAGES gcc g++ make wget zlib1g-dev unzip xxd + run: | + apt-get update && \ + apt-get install -y --no-install-recommends ${PACKAGES} && \ + cd /tmp && \ + wget --no-check-certificate https://github.com/alexdobin/STAR/archive/refs/tags/${STAR_VERSION}.zip && \ + unzip ${STAR_VERSION}.zip && \ + cd STAR-${STAR_VERSION}/source && \ + make STARstatic CXXFLAGS_SIMD=-std=c++11 && \ + cp STAR /usr/local/bin && \ + cd / && \ + rm -rf /tmp/STAR-${STAR_VERSION} /tmp/${STAR_VERSION}.zip && \ + apt-get --purge autoremove -y ${PACKAGES} && \ + apt-get clean + - type: docker + run: | + STAR --version | sed 's#\(.*\)#star: "\1"#' > /var/software_versions.txt + +runners: + - type: executable + - type: nextflow diff --git a/src/star/star_genome_generate/help.txt b/src/star/star_genome_generate/help.txt new file mode 100644 index 00000000..940f639d --- /dev/null +++ b/src/star/star_genome_generate/help.txt @@ -0,0 +1,927 @@ +Usage: STAR [options]... --genomeDir /path/to/genome/index/ --readFilesIn R1.fq R2.fq +Spliced Transcripts Alignment to a Reference (c) Alexander Dobin, 2009-2022 + +STAR version=2.7.11b +STAR compilation time,server,dir=2024-02-11T19:36:26+00:00 :/tmp/STAR-2.7.11b/source +For more details see: + + +### versions +versionGenome 2.7.4a + string: earliest genome index version compatible with this STAR release. Please do not change this value! + +### Parameter Files +parametersFiles - + string: name of a user-defined parameters file, "-": none. Can only be defined on the command line. + +### System +sysShell - + string: path to the shell binary, preferably bash, e.g. /bin/bash. + - ... the default shell is executed, typically /bin/sh. This was reported to fail on some Ubuntu systems - then you need to specify path to bash. + +### Run Parameters +runMode alignReads + string: type of the run. + alignReads ... map reads + genomeGenerate ... generate genome files + inputAlignmentsFromBAM ... input alignments from BAM. Presently only works with --outWigType and --bamRemoveDuplicates options. + liftOver ... lift-over of GTF files (--sjdbGTFfile) between genome assemblies using chain file(s) from --genomeChainFiles. + soloCellFiltering ... STARsolo cell filtering ("calling") without remapping, followed by the path to raw count directory and output (filtered) prefix + +runThreadN 1 + int: number of threads to run STAR + +runDirPerm User_RWX + string: permissions for the directories created at the run-time. + User_RWX ... user-read/write/execute + All_RWX ... all-read/write/execute (same as chmod 777) + +runRNGseed 777 + int: random number generator seed. + + +### Genome Parameters +genomeDir ./GenomeDir/ + string: path to the directory where genome files are stored (for --runMode alignReads) or will be generated (for --runMode generateGenome) + +genomeLoad NoSharedMemory + string: mode of shared memory usage for the genome files. Only used with --runMode alignReads. + LoadAndKeep ... load genome into shared and keep it in memory after run + LoadAndRemove ... load genome into shared but remove it after run + LoadAndExit ... load genome into shared memory and exit, keeping the genome in memory for future runs + Remove ... do not map anything, just remove loaded genome from memory + NoSharedMemory ... do not use shared memory, each job will have its own private copy of the genome + +genomeFastaFiles - + string(s): path(s) to the fasta files with the genome sequences, separated by spaces. These files should be plain text FASTA files, they *cannot* be zipped. + Required for the genome generation (--runMode genomeGenerate). Can also be used in the mapping (--runMode alignReads) to add extra (new) sequences to the genome (e.g. spike-ins). + +genomeChainFiles - + string: chain files for genomic liftover. Only used with --runMode liftOver . + +genomeFileSizes 0 + uint(s)>0: genome files exact sizes in bytes. Typically, this should not be defined by the user. + +genomeTransformOutput None + string(s): which output to transform back to original genome + SAM ... SAM/BAM alignments + SJ ... splice junctions (SJ.out.tab) + Quant ... quantifications (from --quantMode option) + None ... no transformation of the output + +genomeChrSetMitochondrial chrM M MT + string(s): names of the mitochondrial chromosomes. Presently only used for STARsolo statistics output/ + +### Genome Indexing Parameters - only used with --runMode genomeGenerate +genomeChrBinNbits 18 + int: =log2(chrBin), where chrBin is the size of the bins for genome storage: each chromosome will occupy an integer number of bins. For a genome with large number of contigs, it is recommended to scale this parameter as min(18, log2[max(GenomeLength/NumberOfReferences,ReadLength)]). + +genomeSAindexNbases 14 + int: length (bases) of the SA pre-indexing string. Typically between 10 and 15. Longer strings will use much more memory, but allow faster searches. For small genomes, the parameter --genomeSAindexNbases must be scaled down to min(14, log2(GenomeLength)/2 - 1). + +genomeSAsparseD 1 + int>0: suffux array sparsity, i.e. distance between indices: use bigger numbers to decrease needed RAM at the cost of mapping speed reduction + +genomeSuffixLengthMax -1 + int: maximum length of the suffixes, has to be longer than read length. -1 = infinite. + +genomeTransformType None + string: type of genome transformation + None ... no transformation + Haploid ... replace reference alleles with alternative alleles from VCF file (e.g. consensus allele) + Diploid ... create two haplotypes for each chromosome listed in VCF file, for genotypes 1|2, assumes perfect phasing (e.g. personal genome) + +genomeTransformVCF - + string: path to VCF file for genome transformation + + + +#####UnderDevelopment_begin : not supported - do not use +genomeType Full + string: type of genome to generate + Full ... full (normal) genome + Transcriptome ... genome consists of transcript sequences + SuperTransriptome ... genome consists of superTranscript sequences +#####UnderDevelopment_end + +# DEPRECATED: please use --genomeTransformVCF and --genomeTransformType options instead. +#genomeConsensusFile - +# string: VCF file with consensus SNPs (i.e. alternative allele is the major (AF>0.5) allele) +# DEPRECATED + + + +### Splice Junctions Database +sjdbFileChrStartEnd - + string(s): path to the files with genomic coordinates (chr start end strand) for the splice junction introns. Multiple files can be supplied and will be concatenated. + +sjdbGTFfile - + string: path to the GTF file with annotations + +sjdbGTFchrPrefix - + string: prefix for chromosome names in a GTF file (e.g. 'chr' for using ENSMEBL annotations with UCSC genomes) + +sjdbGTFfeatureExon exon + string: feature type in GTF file to be used as exons for building transcripts + +sjdbGTFtagExonParentTranscript transcript_id + string: GTF attribute name for parent transcript ID (default "transcript_id" works for GTF files) + +sjdbGTFtagExonParentGene gene_id + string: GTF attribute name for parent gene ID (default "gene_id" works for GTF files) + +sjdbGTFtagExonParentGeneName gene_name + string(s): GTF attribute name for parent gene name + +sjdbGTFtagExonParentGeneType gene_type gene_biotype + string(s): GTF attribute name for parent gene type + +sjdbOverhang 100 + int>0: length of the donor/acceptor sequence on each side of the junctions, ideally = (mate_length - 1) + +sjdbScore 2 + int: extra alignment score for alignments that cross database junctions + +sjdbInsertSave Basic + string: which files to save when sjdb junctions are inserted on the fly at the mapping step + Basic ... only small junction / transcript files + All ... all files including big Genome, SA and SAindex - this will create a complete genome directory + +### Variation parameters +varVCFfile - + string: path to the VCF file that contains variation data. The 10th column should contain the genotype information, e.g. 0/1 + +### Input Files +inputBAMfile - + string: path to BAM input file, to be used with --runMode inputAlignmentsFromBAM + +### Read Parameters +readFilesType Fastx + string: format of input read files + Fastx ... FASTA or FASTQ + SAM SE ... SAM or BAM single-end reads; for BAM use --readFilesCommand samtools view + SAM PE ... SAM or BAM paired-end reads; for BAM use --readFilesCommand samtools view + +readFilesSAMattrKeep All + string(s): for --readFilesType SAM SE/PE, which SAM tags to keep in the output BAM, e.g.: --readFilesSAMtagsKeep RG PL + All ... keep all tags + None ... do not keep any tags + +readFilesIn Read1 Read2 + string(s): paths to files that contain input read1 (and, if needed, read2) + +readFilesManifest - + string: path to the "manifest" file with the names of read files. The manifest file should contain 3 tab-separated columns: + paired-end reads: read1_file_name $tab$ read2_file_name $tab$ read_group_line. + single-end reads: read1_file_name $tab$ - $tab$ read_group_line. + Spaces, but not tabs are allowed in file names. + If read_group_line does not start with ID:, it can only contain one ID field, and ID: will be added to it. + If read_group_line starts with ID:, it can contain several fields separated by $tab$, and all fields will be be copied verbatim into SAM @RG header line. + +readFilesPrefix - + string: prefix for the read files names, i.e. it will be added in front of the strings in --readFilesIn + +readFilesCommand - + string(s): command line to execute for each of the input file. This command should generate FASTA or FASTQ text and send it to stdout + For example: zcat - to uncompress .gz files, bzcat - to uncompress .bz2 files, etc. + +readMapNumber -1 + int: number of reads to map from the beginning of the file + -1: map all reads + +readMatesLengthsIn NotEqual + string: Equal/NotEqual - lengths of names,sequences,qualities for both mates are the same / not the same. NotEqual is safe in all situations. + +readNameSeparator / + string(s): character(s) separating the part of the read names that will be trimmed in output (read name after space is always trimmed) + +readQualityScoreBase 33 + int>=0: number to be subtracted from the ASCII code to get Phred quality score + +### Read Clipping + +clipAdapterType Hamming + string: adapter clipping type + Hamming ... adapter clipping based on Hamming distance, with the number of mismatches controlled by --clip5pAdapterMMp + CellRanger4 ... 5p and 3p adapter clipping similar to CellRanger4. Utilizes Opal package by Martin Šošić: https://github.com/Martinsos/opal + None ... no adapter clipping, all other clip* parameters are disregarded + +clip3pNbases 0 + int(s): number(s) of bases to clip from 3p of each mate. If one value is given, it will be assumed the same for both mates. + +clip3pAdapterSeq - + string(s): adapter sequences to clip from 3p of each mate. If one value is given, it will be assumed the same for both mates. + polyA ... polyA sequence with the length equal to read length + +clip3pAdapterMMp 0.1 + double(s): max proportion of mismatches for 3p adapter clipping for each mate. If one value is given, it will be assumed the same for both mates. + +clip3pAfterAdapterNbases 0 + int(s): number of bases to clip from 3p of each mate after the adapter clipping. If one value is given, it will be assumed the same for both mates. + +clip5pNbases 0 + int(s): number(s) of bases to clip from 5p of each mate. If one value is given, it will be assumed the same for both mates. + +#####UnderDevelopment_begin : not supported - do not use +clip5pAdapterSeq - + string(s): adapter sequences to clip from 5p of each mate, separated by space. + +clip5pAdapterMMp 0.1 + double(s): max proportion of mismatches for 5p adapter clipping for each mate, separated by space + +clip5pAfterAdapterNbases 0 + int(s): number of bases to clip from 5p of each mate after the adapter clipping, separated by space. +#####UnderDevelopment_end + +### Limits +limitGenomeGenerateRAM 31000000000 + int>0: maximum available RAM (bytes) for genome generation + +limitIObufferSize 30000000 50000000 + int(s)>0: max available buffers size (bytes) for input/output, per thread + +limitOutSAMoneReadBytes 100000 + int>0: max size of the SAM record (bytes) for one read. Recommended value: >(2*(LengthMate1+LengthMate2+100)*outFilterMultimapNmax + +limitOutSJoneRead 1000 + int>0: max number of junctions for one read (including all multi-mappers) + +limitOutSJcollapsed 1000000 + int>0: max number of collapsed junctions + +limitBAMsortRAM 0 + int>=0: maximum available RAM (bytes) for sorting BAM. If =0, it will be set to the genome index size. 0 value can only be used with --genomeLoad NoSharedMemory option. + +limitSjdbInsertNsj 1000000 + int>=0: maximum number of junctions to be inserted to the genome on the fly at the mapping stage, including those from annotations and those detected in the 1st step of the 2-pass run + +limitNreadsSoft -1 + int: soft limit on the number of reads + +### Output: general +outFileNamePrefix ./ + string: output files name prefix (including full or relative path). Can only be defined on the command line. + +outTmpDir - + string: path to a directory that will be used as temporary by STAR. All contents of this directory will be removed! + - ... the temp directory will default to outFileNamePrefix_STARtmp + +outTmpKeep None + string: whether to keep the temporary files after STAR runs is finished + None ... remove all temporary files + All ... keep all files + +outStd Log + string: which output will be directed to stdout (standard out) + Log ... log messages + SAM ... alignments in SAM format (which normally are output to Aligned.out.sam file), normal standard output will go into Log.std.out + BAM_Unsorted ... alignments in BAM format, unsorted. Requires --outSAMtype BAM Unsorted + BAM_SortedByCoordinate ... alignments in BAM format, sorted by coordinate. Requires --outSAMtype BAM SortedByCoordinate + BAM_Quant ... alignments to transcriptome in BAM format, unsorted. Requires --quantMode TranscriptomeSAM + +outReadsUnmapped None + string: output of unmapped and partially mapped (i.e. mapped only one mate of a paired end read) reads in separate file(s). + None ... no output + Fastx ... output in separate fasta/fastq files, Unmapped.out.mate1/2 + +outQSconversionAdd 0 + int: add this number to the quality score (e.g. to convert from Illumina to Sanger, use -31) + +outMultimapperOrder Old_2.4 + string: order of multimapping alignments in the output files + Old_2.4 ... quasi-random order used before 2.5.0 + Random ... random order of alignments for each multi-mapper. Read mates (pairs) are always adjacent, all alignment for each read stay together. This option will become default in the future releases. + +### Output: SAM and BAM +outSAMtype SAM + strings: type of SAM/BAM output + 1st word: + BAM ... output BAM without sorting + SAM ... output SAM without sorting + None ... no SAM/BAM output + 2nd, 3rd: + Unsorted ... standard unsorted + SortedByCoordinate ... sorted by coordinate. This option will allocate extra memory for sorting which can be specified by --limitBAMsortRAM. + +outSAMmode Full + string: mode of SAM output + None ... no SAM output + Full ... full SAM output + NoQS ... full SAM but without quality scores + +outSAMstrandField None + string: Cufflinks-like strand field flag + None ... not used + intronMotif ... strand derived from the intron motif. This option changes the output alignments: reads with inconsistent and/or non-canonical introns are filtered out. + +outSAMattributes Standard + string(s): a string of desired SAM attributes, in the order desired for the output SAM. Tags can be listed in any combination/order. + ***Presets: + None ... no attributes + Standard ... NH HI AS nM + All ... NH HI AS nM NM MD jM jI MC ch + ***Alignment: + NH ... number of loci the reads maps to: =1 for unique mappers, >1 for multimappers. Standard SAM tag. + HI ... multiple alignment index, starts with --outSAMattrIHstart (=1 by default). Standard SAM tag. + AS ... local alignment score, +1/-1 for matches/mismateches, score* penalties for indels and gaps. For PE reads, total score for two mates. Stadnard SAM tag. + nM ... number of mismatches. For PE reads, sum over two mates. + NM ... edit distance to the reference (number of mismatched + inserted + deleted bases) for each mate. Standard SAM tag. + MD ... string encoding mismatched and deleted reference bases (see standard SAM specifications). Standard SAM tag. + jM ... intron motifs for all junctions (i.e. N in CIGAR): 0: non-canonical; 1: GT/AG, 2: CT/AC, 3: GC/AG, 4: CT/GC, 5: AT/AC, 6: GT/AT. If splice junctions database is used, and a junction is annotated, 20 is added to its motif value. + jI ... start and end of introns for all junctions (1-based). + XS ... alignment strand according to --outSAMstrandField. + MC ... mate's CIGAR string. Standard SAM tag. + ch ... marks all segment of all chimeric alingments for --chimOutType WithinBAM output. + cN ... number of bases clipped from the read ends: 5' and 3' + ***Variation: + vA ... variant allele + vG ... genomic coordinate of the variant overlapped by the read. + vW ... 1 - alignment passes WASP filtering; 2,3,4,5,6,7 - alignment does not pass WASP filtering. Requires --waspOutputMode SAMtag. + ha ... haplotype (1/2) when mapping to the diploid genome. Requires genome generated with --genomeTransformType Diploid . + ***STARsolo: + CR CY UR UY ... sequences and quality scores of cell barcodes and UMIs for the solo* demultiplexing. + GX GN ... gene ID and gene name for unique-gene reads. + gx gn ... gene IDs and gene names for unique- and multi-gene reads. + CB UB ... error-corrected cell barcodes and UMIs for solo* demultiplexing. Requires --outSAMtype BAM SortedByCoordinate. + sM ... assessment of CB and UMI. + sS ... sequence of the entire barcode (CB,UMI,adapter). + sQ ... quality of the entire barcode. + sF ... type of feature overlap and number of features for each alignment + ***Unsupported/undocumented: + rB ... alignment block read/genomic coordinates. + vR ... read coordinate of the variant. + +outSAMattrIHstart 1 + int>=0: start value for the IH attribute. 0 may be required by some downstream software, such as Cufflinks or StringTie. + +outSAMunmapped None + string(s): output of unmapped reads in the SAM format + 1st word: + None ... no output + Within ... output unmapped reads within the main SAM file (i.e. Aligned.out.sam) + 2nd word: + KeepPairs ... record unmapped mate for each alignment, and, in case of unsorted output, keep it adjacent to its mapped mate. Only affects multi-mapping reads. + +outSAMorder Paired + string: type of sorting for the SAM output + Paired: one mate after the other for all paired alignments + PairedKeepInputOrder: one mate after the other for all paired alignments, the order is kept the same as in the input FASTQ files + +outSAMprimaryFlag OneBestScore + string: which alignments are considered primary - all others will be marked with 0x100 bit in the FLAG + OneBestScore ... only one alignment with the best score is primary + AllBestScore ... all alignments with the best score are primary + +outSAMreadID Standard + string: read ID record type + Standard ... first word (until space) from the FASTx read ID line, removing /1,/2 from the end + Number ... read number (index) in the FASTx file + +outSAMmapqUnique 255 + int: 0 to 255: the MAPQ value for unique mappers + +outSAMflagOR 0 + int: 0 to 65535: sam FLAG will be bitwise OR'd with this value, i.e. FLAG=FLAG | outSAMflagOR. This is applied after all flags have been set by STAR, and after outSAMflagAND. Can be used to set specific bits that are not set otherwise. + +outSAMflagAND 65535 + int: 0 to 65535: sam FLAG will be bitwise AND'd with this value, i.e. FLAG=FLAG & outSAMflagOR. This is applied after all flags have been set by STAR, but before outSAMflagOR. Can be used to unset specific bits that are not set otherwise. + +outSAMattrRGline - + string(s): SAM/BAM read group line. The first word contains the read group identifier and must start with "ID:", e.g. --outSAMattrRGline ID:xxx CN:yy "DS:z z z". + xxx will be added as RG tag to each output alignment. Any spaces in the tag values have to be double quoted. + Comma separated RG lines correspons to different (comma separated) input files in --readFilesIn. Commas have to be surrounded by spaces, e.g. + --outSAMattrRGline ID:xxx , ID:zzz "DS:z z" , ID:yyy DS:yyyy + +outSAMheaderHD - + strings: @HD (header) line of the SAM header + +outSAMheaderPG - + strings: extra @PG (software) line of the SAM header (in addition to STAR) + +outSAMheaderCommentFile - + string: path to the file with @CO (comment) lines of the SAM header + +outSAMfilter None + string(s): filter the output into main SAM/BAM files + KeepOnlyAddedReferences ... only keep the reads for which all alignments are to the extra reference sequences added with --genomeFastaFiles at the mapping stage. + KeepAllAddedReferences ... keep all alignments to the extra reference sequences added with --genomeFastaFiles at the mapping stage. + + +outSAMmultNmax -1 + int: max number of multiple alignments for a read that will be output to the SAM/BAM files. Note that if this value is not equal to -1, the top scoring alignment will be output first + -1 ... all alignments (up to --outFilterMultimapNmax) will be output + +outSAMtlen 1 + int: calculation method for the TLEN field in the SAM/BAM files + 1 ... leftmost base of the (+)strand mate to rightmost base of the (-)mate. (+)sign for the (+)strand mate + 2 ... leftmost base of any mate to rightmost base of any mate. (+)sign for the mate with the leftmost base. This is different from 1 for overlapping mates with protruding ends + +outBAMcompression 1 + int: -1 to 10 BAM compression level, -1=default compression (6?), 0=no compression, 10=maximum compression + +outBAMsortingThreadN 0 + int: >=0: number of threads for BAM sorting. 0 will default to min(6,--runThreadN). + +outBAMsortingBinsN 50 + int: >0: number of genome bins for coordinate-sorting + +### BAM processing +bamRemoveDuplicatesType - + string: mark duplicates in the BAM file, for now only works with (i) sorted BAM fed with inputBAMfile, and (ii) for paired-end alignments only + - ... no duplicate removal/marking + UniqueIdentical ... mark all multimappers, and duplicate unique mappers. The coordinates, FLAG, CIGAR must be identical + UniqueIdenticalNotMulti ... mark duplicate unique mappers but not multimappers. + +bamRemoveDuplicatesMate2basesN 0 + int>0: number of bases from the 5' of mate 2 to use in collapsing (e.g. for RAMPAGE) + +### Output Wiggle +outWigType None + string(s): type of signal output, e.g. "bedGraph" OR "bedGraph read1_5p". Requires sorted BAM: --outSAMtype BAM SortedByCoordinate . + 1st word: + None ... no signal output + bedGraph ... bedGraph format + wiggle ... wiggle format + 2nd word: + read1_5p ... signal from only 5' of the 1st read, useful for CAGE/RAMPAGE etc + read2 ... signal from only 2nd read + +outWigStrand Stranded + string: strandedness of wiggle/bedGraph output + Stranded ... separate strands, str1 and str2 + Unstranded ... collapsed strands + +outWigReferencesPrefix - + string: prefix matching reference names to include in the output wiggle file, e.g. "chr", default "-" - include all references + +outWigNorm RPM + string: type of normalization for the signal + RPM ... reads per million of mapped reads + None ... no normalization, "raw" counts + +### Output Filtering +outFilterType Normal + string: type of filtering + Normal ... standard filtering using only current alignment + BySJout ... keep only those reads that contain junctions that passed filtering into SJ.out.tab + +outFilterMultimapScoreRange 1 + int: the score range below the maximum score for multimapping alignments + +outFilterMultimapNmax 10 + int: maximum number of loci the read is allowed to map to. Alignments (all of them) will be output only if the read maps to no more loci than this value. + Otherwise no alignments will be output, and the read will be counted as "mapped to too many loci" in the Log.final.out . + +outFilterMismatchNmax 10 + int: alignment will be output only if it has no more mismatches than this value. + +outFilterMismatchNoverLmax 0.3 + real: alignment will be output only if its ratio of mismatches to *mapped* length is less than or equal to this value. + +outFilterMismatchNoverReadLmax 1.0 + real: alignment will be output only if its ratio of mismatches to *read* length is less than or equal to this value. + + +outFilterScoreMin 0 + int: alignment will be output only if its score is higher than or equal to this value. + +outFilterScoreMinOverLread 0.66 + real: same as outFilterScoreMin, but normalized to read length (sum of mates' lengths for paired-end reads) + +outFilterMatchNmin 0 + int: alignment will be output only if the number of matched bases is higher than or equal to this value. + +outFilterMatchNminOverLread 0.66 + real: sam as outFilterMatchNmin, but normalized to the read length (sum of mates' lengths for paired-end reads). + +outFilterIntronMotifs None + string: filter alignment using their motifs + None ... no filtering + RemoveNoncanonical ... filter out alignments that contain non-canonical junctions + RemoveNoncanonicalUnannotated ... filter out alignments that contain non-canonical unannotated junctions when using annotated splice junctions database. The annotated non-canonical junctions will be kept. + +outFilterIntronStrands RemoveInconsistentStrands + string: filter alignments + RemoveInconsistentStrands ... remove alignments that have junctions with inconsistent strands + None ... no filtering + +### Output splice junctions (SJ.out.tab) +outSJtype Standard + string: type of splice junction output + Standard ... standard SJ.out.tab output + None ... no splice junction output + +### Output Filtering: Splice Junctions +outSJfilterReads All + string: which reads to consider for collapsed splice junctions output + All ... all reads, unique- and multi-mappers + Unique ... uniquely mapping reads only + +outSJfilterOverhangMin 30 12 12 12 + 4 integers: minimum overhang length for splice junctions on both sides for: (1) non-canonical motifs, (2) GT/AG and CT/AC motif, (3) GC/AG and CT/GC motif, (4) AT/AC and GT/AT motif. -1 means no output for that motif + does not apply to annotated junctions + +outSJfilterCountUniqueMin 3 1 1 1 + 4 integers: minimum uniquely mapping read count per junction for: (1) non-canonical motifs, (2) GT/AG and CT/AC motif, (3) GC/AG and CT/GC motif, (4) AT/AC and GT/AT motif. -1 means no output for that motif + Junctions are output if one of outSJfilterCountUniqueMin OR outSJfilterCountTotalMin conditions are satisfied + does not apply to annotated junctions + +outSJfilterCountTotalMin 3 1 1 1 + 4 integers: minimum total (multi-mapping+unique) read count per junction for: (1) non-canonical motifs, (2) GT/AG and CT/AC motif, (3) GC/AG and CT/GC motif, (4) AT/AC and GT/AT motif. -1 means no output for that motif + Junctions are output if one of outSJfilterCountUniqueMin OR outSJfilterCountTotalMin conditions are satisfied + does not apply to annotated junctions + +outSJfilterDistToOtherSJmin 10 0 5 10 + 4 integers>=0: minimum allowed distance to other junctions' donor/acceptor + does not apply to annotated junctions + +outSJfilterIntronMaxVsReadN 50000 100000 200000 + N integers>=0: maximum gap allowed for junctions supported by 1,2,3,,,N reads + i.e. by default junctions supported by 1 read can have gaps <=50000b, by 2 reads: <=100000b, by 3 reads: <=200000. by >=4 reads any gap <=alignIntronMax + does not apply to annotated junctions + +### Scoring +scoreGap 0 + int: splice junction penalty (independent on intron motif) + +scoreGapNoncan -8 + int: non-canonical junction penalty (in addition to scoreGap) + +scoreGapGCAG -4 + int: GC/AG and CT/GC junction penalty (in addition to scoreGap) + +scoreGapATAC -8 + int: AT/AC and GT/AT junction penalty (in addition to scoreGap) + +scoreGenomicLengthLog2scale -0.25 + int: extra score logarithmically scaled with genomic length of the alignment: scoreGenomicLengthLog2scale*log2(genomicLength) + +scoreDelOpen -2 + int: deletion open penalty + +scoreDelBase -2 + int: deletion extension penalty per base (in addition to scoreDelOpen) + +scoreInsOpen -2 + int: insertion open penalty + +scoreInsBase -2 + int: insertion extension penalty per base (in addition to scoreInsOpen) + +scoreStitchSJshift 1 + int: maximum score reduction while searching for SJ boundaries in the stitching step + + +### Alignments and Seeding + +seedSearchStartLmax 50 + int>0: defines the search start point through the read - the read is split into pieces no longer than this value + +seedSearchStartLmaxOverLread 1.0 + real: seedSearchStartLmax normalized to read length (sum of mates' lengths for paired-end reads) + +seedSearchLmax 0 + int>=0: defines the maximum length of the seeds, if =0 seed length is not limited + +seedMultimapNmax 10000 + int>0: only pieces that map fewer than this value are utilized in the stitching procedure + +seedPerReadNmax 1000 + int>0: max number of seeds per read + +seedPerWindowNmax 50 + int>0: max number of seeds per window + +seedNoneLociPerWindow 10 + int>0: max number of one seed loci per window + +seedSplitMin 12 + int>0: min length of the seed sequences split by Ns or mate gap + +seedMapMin 5 + int>0: min length of seeds to be mapped + +alignIntronMin 21 + int: minimum intron size, genomic gap is considered intron if its length>=alignIntronMin, otherwise it is considered Deletion + +alignIntronMax 0 + int: maximum intron size, if 0, max intron size will be determined by (2^winBinNbits)*winAnchorDistNbins + +alignMatesGapMax 0 + int: maximum gap between two mates, if 0, max intron gap will be determined by (2^winBinNbits)*winAnchorDistNbins + +alignSJoverhangMin 5 + int>0: minimum overhang (i.e. block size) for spliced alignments + +alignSJstitchMismatchNmax 0 -1 0 0 + 4*int>=0: maximum number of mismatches for stitching of the splice junctions (-1: no limit). + (1) non-canonical motifs, (2) GT/AG and CT/AC motif, (3) GC/AG and CT/GC motif, (4) AT/AC and GT/AT motif. + +alignSJDBoverhangMin 3 + int>0: minimum overhang (i.e. block size) for annotated (sjdb) spliced alignments + +alignSplicedMateMapLmin 0 + int>0: minimum mapped length for a read mate that is spliced + +alignSplicedMateMapLminOverLmate 0.66 + real>0: alignSplicedMateMapLmin normalized to mate length + +alignWindowsPerReadNmax 10000 + int>0: max number of windows per read + +alignTranscriptsPerWindowNmax 100 + int>0: max number of transcripts per window + +alignTranscriptsPerReadNmax 10000 + int>0: max number of different alignments per read to consider + +alignEndsType Local + string: type of read ends alignment + Local ... standard local alignment with soft-clipping allowed + EndToEnd ... force end-to-end read alignment, do not soft-clip + Extend5pOfRead1 ... fully extend only the 5p of the read1, all other ends: local alignment + Extend5pOfReads12 ... fully extend only the 5p of the both read1 and read2, all other ends: local alignment + +alignEndsProtrude 0 ConcordantPair + int, string: allow protrusion of alignment ends, i.e. start (end) of the +strand mate downstream of the start (end) of the -strand mate + 1st word: int: maximum number of protrusion bases allowed + 2nd word: string: + ConcordantPair ... report alignments with non-zero protrusion as concordant pairs + DiscordantPair ... report alignments with non-zero protrusion as discordant pairs + +alignSoftClipAtReferenceEnds Yes + string: allow the soft-clipping of the alignments past the end of the chromosomes + Yes ... allow + No ... prohibit, useful for compatibility with Cufflinks + +alignInsertionFlush None + string: how to flush ambiguous insertion positions + None ... insertions are not flushed + Right ... insertions are flushed to the right + +### Paired-End reads +peOverlapNbasesMin 0 + int>=0: minimum number of overlapping bases to trigger mates merging and realignment. Specify >0 value to switch on the "merginf of overlapping mates" algorithm. + +peOverlapMMp 0.01 + real, >=0 & <1: maximum proportion of mismatched bases in the overlap area + +### Windows, Anchors, Binning + +winAnchorMultimapNmax 50 + int>0: max number of loci anchors are allowed to map to + +winBinNbits 16 + int>0: =log2(winBin), where winBin is the size of the bin for the windows/clustering, each window will occupy an integer number of bins. + +winAnchorDistNbins 9 + int>0: max number of bins between two anchors that allows aggregation of anchors into one window + +winFlankNbins 4 + int>0: log2(winFlank), where win Flank is the size of the left and right flanking regions for each window + +winReadCoverageRelativeMin 0.5 + real>=0: minimum relative coverage of the read sequence by the seeds in a window, for STARlong algorithm only. + +winReadCoverageBasesMin 0 + int>0: minimum number of bases covered by the seeds in a window , for STARlong algorithm only. + +### Chimeric Alignments +chimOutType Junctions + string(s): type of chimeric output + Junctions ... Chimeric.out.junction + SeparateSAMold ... output old SAM into separate Chimeric.out.sam file + WithinBAM ... output into main aligned BAM files (Aligned.*.bam) + WithinBAM HardClip ... (default) hard-clipping in the CIGAR for supplemental chimeric alignments (default if no 2nd word is present) + WithinBAM SoftClip ... soft-clipping in the CIGAR for supplemental chimeric alignments + +chimSegmentMin 0 + int>=0: minimum length of chimeric segment length, if ==0, no chimeric output + +chimScoreMin 0 + int>=0: minimum total (summed) score of the chimeric segments + +chimScoreDropMax 20 + int>=0: max drop (difference) of chimeric score (the sum of scores of all chimeric segments) from the read length + +chimScoreSeparation 10 + int>=0: minimum difference (separation) between the best chimeric score and the next one + +chimScoreJunctionNonGTAG -1 + int: penalty for a non-GT/AG chimeric junction + +chimJunctionOverhangMin 20 + int>=0: minimum overhang for a chimeric junction + +chimSegmentReadGapMax 0 + int>=0: maximum gap in the read sequence between chimeric segments + +chimFilter banGenomicN + string(s): different filters for chimeric alignments + None ... no filtering + banGenomicN ... Ns are not allowed in the genome sequence around the chimeric junction + +chimMainSegmentMultNmax 10 + int>=1: maximum number of multi-alignments for the main chimeric segment. =1 will prohibit multimapping main segments. + +chimMultimapNmax 0 + int>=0: maximum number of chimeric multi-alignments + 0 ... use the old scheme for chimeric detection which only considered unique alignments + +chimMultimapScoreRange 1 + int>=0: the score range for multi-mapping chimeras below the best chimeric score. Only works with --chimMultimapNmax > 1 + +chimNonchimScoreDropMin 20 + int>=0: to trigger chimeric detection, the drop in the best non-chimeric alignment score with respect to the read length has to be greater than this value + +chimOutJunctionFormat 0 + int: formatting type for the Chimeric.out.junction file + 0 ... no comment lines/headers + 1 ... comment lines at the end of the file: command line and Nreads: total, unique/multi-mapping + +### Quantification of Annotations +quantMode - + string(s): types of quantification requested + - ... none + TranscriptomeSAM ... output SAM/BAM alignments to transcriptome into a separate file + GeneCounts ... count reads per gene + +quantTranscriptomeBAMcompression 1 + int: -2 to 10 transcriptome BAM compression level + -2 ... no BAM output + -1 ... default compression (6?) + 0 ... no compression + 10 ... maximum compression + +quantTranscriptomeSAMoutput BanSingleEnd_BanIndels_ExtendSoftclip + string: alignment filtering for TranscriptomeSAM output + BanSingleEnd_BanIndels_ExtendSoftclip ... prohibit indels and single-end alignments, extend softclips - compatible with RSEM + BanSingleEnd ... prohibit single-end alignments, allow indels and softclips + BanSingleEnd_ExtendSoftclip ... prohibit single-end alignments, extend softclips, allow indels + + +### 2-pass Mapping +twopassMode None + string: 2-pass mapping mode. + None ... 1-pass mapping + Basic ... basic 2-pass mapping, with all 1st pass junctions inserted into the genome indices on the fly + +twopass1readsN -1 + int: number of reads to process for the 1st step. Use very large number (or default -1) to map all reads in the first step. + + +### WASP parameters +waspOutputMode None + string: WASP allele-specific output type. This is re-implementation of the original WASP mappability filtering by Bryce van de Geijn, Graham McVicker, Yoav Gilad & Jonathan K Pritchard. Please cite the original WASP paper: Nature Methods 12, 1061–1063 (2015), https://www.nature.com/articles/nmeth.3582 . + SAMtag ... add WASP tags to the alignments that pass WASP filtering + +### STARsolo (single cell RNA-seq) parameters +soloType None + string(s): type of single-cell RNA-seq + CB_UMI_Simple ... (a.k.a. Droplet) one UMI and one Cell Barcode of fixed length in read2, e.g. Drop-seq and 10X Chromium. + CB_UMI_Complex ... multiple Cell Barcodes of varying length, one UMI of fixed length and one adapter sequence of fixed length are allowed in read2 only (e.g. inDrop, ddSeq). + CB_samTagOut ... output Cell Barcode as CR and/or CB SAm tag. No UMI counting. --readFilesIn cDNA_read1 [cDNA_read2 if paired-end] CellBarcode_read . Requires --outSAMtype BAM Unsorted [and/or SortedByCoordinate] + SmartSeq ... Smart-seq: each cell in a separate FASTQ (paired- or single-end), barcodes are corresponding read-groups, no UMI sequences, alignments deduplicated according to alignment start and end (after extending soft-clipped bases) + +soloCBtype Sequence + string: cell barcode type + Sequence: cell barcode is a sequence (standard option) + String: cell barcode is an arbitrary string + +soloCBwhitelist - + string(s): file(s) with whitelist(s) of cell barcodes. Only --soloType CB_UMI_Complex allows more than one whitelist file. + None ... no whitelist: all cell barcodes are allowed + +soloCBstart 1 + int>0: cell barcode start base + +soloCBlen 16 + int>0: cell barcode length + +soloUMIstart 17 + int>0: UMI start base + +soloUMIlen 10 + int>0: UMI length + +soloBarcodeReadLength 1 + int: length of the barcode read + 1 ... equal to sum of soloCBlen+soloUMIlen + 0 ... not defined, do not check + +soloBarcodeMate 0 + int: identifies which read mate contains the barcode (CB+UMI) sequence + 0 ... barcode sequence is on separate read, which should always be the last file in the --readFilesIn listed + 1 ... barcode sequence is a part of mate 1 + 2 ... barcode sequence is a part of mate 2 + +soloCBposition - + strings(s): position of Cell Barcode(s) on the barcode read. + Presently only works with --soloType CB_UMI_Complex, and barcodes are assumed to be on Read2. + Format for each barcode: startAnchor_startPosition_endAnchor_endPosition + start(end)Anchor defines the Anchor Base for the CB: 0: read start; 1: read end; 2: adapter start; 3: adapter end + start(end)Position is the 0-based position with of the CB start(end) with respect to the Anchor Base + String for different barcodes are separated by space. + Example: inDrop (Zilionis et al, Nat. Protocols, 2017): + --soloCBposition 0_0_2_-1 3_1_3_8 + +soloUMIposition - + string: position of the UMI on the barcode read, same as soloCBposition + Example: inDrop (Zilionis et al, Nat. Protocols, 2017): + --soloCBposition 3_9_3_14 + +soloAdapterSequence - + string: adapter sequence to anchor barcodes. Only one adapter sequence is allowed. + +soloAdapterMismatchesNmax 1 + int>0: maximum number of mismatches allowed in adapter sequence. + +soloCBmatchWLtype 1MM_multi + string: matching the Cell Barcodes to the WhiteList + Exact ... only exact matches allowed + 1MM ... only one match in whitelist with 1 mismatched base allowed. Allowed CBs have to have at least one read with exact match. + 1MM_multi ... multiple matches in whitelist with 1 mismatched base allowed, posterior probability calculation is used choose one of the matches. + Allowed CBs have to have at least one read with exact match. This option matches best with CellRanger 2.2.0 + 1MM_multi_pseudocounts ... same as 1MM_Multi, but pseudocounts of 1 are added to all whitelist barcodes. + 1MM_multi_Nbase_pseudocounts ... same as 1MM_multi_pseudocounts, multimatching to WL is allowed for CBs with N-bases. This option matches best with CellRanger >= 3.0.0 + EditDist_2 ... allow up to edit distance of 3 fpr each of the barcodes. May include one deletion + one insertion. Only works with --soloType CB_UMI_Complex. Matches to multiple passlist barcdoes are not allowed. Similar to ParseBio Split-seq pipeline. + +soloInputSAMattrBarcodeSeq - + string(s): when inputting reads from a SAM file (--readsFileType SAM SE/PE), these SAM attributes mark the barcode sequence (in proper order). + For instance, for 10X CellRanger or STARsolo BAMs, use --soloInputSAMattrBarcodeSeq CR UR . + This parameter is required when running STARsolo with input from SAM. + +soloInputSAMattrBarcodeQual - + string(s): when inputting reads from a SAM file (--readsFileType SAM SE/PE), these SAM attributes mark the barcode qualities (in proper order). + For instance, for 10X CellRanger or STARsolo BAMs, use --soloInputSAMattrBarcodeQual CY UY . + If this parameter is '-' (default), the quality 'H' will be assigned to all bases. + +soloStrand Forward + string: strandedness of the solo libraries: + Unstranded ... no strand information + Forward ... read strand same as the original RNA molecule + Reverse ... read strand opposite to the original RNA molecule + +soloFeatures Gene + string(s): genomic features for which the UMI counts per Cell Barcode are collected + Gene ... genes: reads match the gene transcript + SJ ... splice junctions: reported in SJ.out.tab + GeneFull ... full gene (pre-mRNA): count all reads overlapping genes' exons and introns + GeneFull_ExonOverIntron ... full gene (pre-mRNA): count all reads overlapping genes' exons and introns: prioritize 100% overlap with exons + GeneFull_Ex50pAS ... full gene (pre-RNA): count all reads overlapping genes' exons and introns: prioritize >50% overlap with exons. Do not count reads with 100% exonic overlap in the antisense direction. + +#####UnderDevelopment_begin : not supported - do not use + Transcript3p ... quantification of transcript for 3' protocols +#####UnderDevelopment_end + +soloMultiMappers Unique + string(s): counting method for reads mapping to multiple genes + Unique ... count only reads that map to unique genes + Uniform ... uniformly distribute multi-genic UMIs to all genes + Rescue ... distribute UMIs proportionally to unique+uniform counts (~ first iteration of EM) + PropUnique ... distribute UMIs proportionally to unique mappers, if present, and uniformly if not. + EM ... multi-gene UMIs are distributed using Expectation Maximization algorithm + +soloUMIdedup 1MM_All + string(s): type of UMI deduplication (collapsing) algorithm + 1MM_All ... all UMIs with 1 mismatch distance to each other are collapsed (i.e. counted once). + 1MM_Directional_UMItools ... follows the "directional" method from the UMI-tools by Smith, Heger and Sudbery (Genome Research 2017). + 1MM_Directional ... same as 1MM_Directional_UMItools, but with more stringent criteria for duplicate UMIs + Exact ... only exactly matching UMIs are collapsed. + NoDedup ... no deduplication of UMIs, count all reads. + 1MM_CR ... CellRanger2-4 algorithm for 1MM UMI collapsing. + +soloUMIfiltering - + string(s): type of UMI filtering (for reads uniquely mapping to genes) + - ... basic filtering: remove UMIs with N and homopolymers (similar to CellRanger 2.2.0). + MultiGeneUMI ... basic + remove lower-count UMIs that map to more than one gene. + MultiGeneUMI_All ... basic + remove all UMIs that map to more than one gene. + MultiGeneUMI_CR ... basic + remove lower-count UMIs that map to more than one gene, matching CellRanger > 3.0.0 . + Only works with --soloUMIdedup 1MM_CR + +soloOutFileNames Solo.out/ features.tsv barcodes.tsv matrix.mtx + string(s): file names for STARsolo output: + file_name_prefix gene_names barcode_sequences cell_feature_count_matrix + +soloCellFilter CellRanger2.2 3000 0.99 10 + string(s): cell filtering type and parameters + None ... do not output filtered cells + TopCells ... only report top cells by UMI count, followed by the exact number of cells + CellRanger2.2 ... simple filtering of CellRanger 2.2. + Can be followed by numbers: number of expected cells, robust maximum percentile for UMI count, maximum to minimum ratio for UMI count + The harcoded values are from CellRanger: nExpectedCells=3000; maxPercentile=0.99; maxMinRatio=10 + EmptyDrops_CR ... EmptyDrops filtering in CellRanger flavor. Please cite the original EmptyDrops paper: A.T.L Lun et al, Genome Biology, 20, 63 (2019): https://genomebiology.biomedcentral.com/articles/10.1186/s13059-019-1662-y + Can be followed by 10 numeric parameters: nExpectedCells maxPercentile maxMinRatio indMin indMax umiMin umiMinFracMedian candMaxN FDR simN + The harcoded values are from CellRanger: 3000 0.99 10 45000 90000 500 0.01 20000 0.01 10000 + +soloOutFormatFeaturesGeneField3 "Gene Expression" + string(s): field 3 in the Gene features.tsv file. If "-", then no 3rd field is output. + +soloCellReadStats None + string: Output reads statistics for each CB + Standard ... standard output + +#####UnderDevelopment_begin : not supported - do not use +soloClusterCBfile - + string: file containing the cluster information for cell barcodes, two columns: CB cluster_index. Only used with --soloFeatures Transcript3p +#####UnderDevelopment_end diff --git a/src/star/star_genome_generate/script.sh b/src/star/star_genome_generate/script.sh new file mode 100644 index 00000000..cb3b906c --- /dev/null +++ b/src/star/star_genome_generate/script.sh @@ -0,0 +1,29 @@ +#!/bin/bash + +set -e + +## VIASH START +## VIASH END + +mkdir -p $par_index + +STAR \ + --runMode genomeGenerate \ + --genomeDir $par_index \ + --genomeFastaFiles $par_genomeFastaFiles \ + ${meta_cpus:+--runThreadN "${meta_cpus}"} \ + ${par_sjdbGTFfile:+--sjdbGTFfile "${par_sjdbGTFfile}"} \ + ${par_sjdbOverhang:+--sjdbOverhang "${par_sjdbOverhang}"} \ + ${par_genomeSAindexNbases:+--genomeSAindexNbases "${par_genomeSAindexNbases}"} \ + ${par_sjdbGTFchrPrefix:+--sjdbGTFchrPrefix "${par_sjdbGTFchrPrefix}"} \ + ${par_sjdbGTFfeatureExon:+--sjdbGTFfeatureExon "${par_sjdbGTFfeatureExon}"} \ + ${par_sjdbGTFtagExonParentTranscript:+--sjdbGTFtagExonParentTranscript "${par_sjdbGTFtagExonParentTranscript}"} \ + ${par_sjdbGTFtagExonParentGene:+--sjdbGTFtagExonParentGene "${par_sjdbGTFtagExonParentGene}"} \ + ${par_sjdbGTFtagExonParentGeneName:+--sjdbGTFtagExonParentGeneName "${par_sjdbGTFtagExonParentGeneName}"} \ + ${par_sjdbGTFtagExonParentGeneType:+--sjdbGTFtagExonParentGeneType "${sjdbGTFtagExonParentGeneType}"} \ + ${par_limitGenomeGenerateRAM:+--limitGenomeGenerateRAM "${par_limitGenomeGenerateRAM}"} \ + ${par_genomeChrBinNbits:+--genomeChrBinNbits "${par_genomeChrBinNbits}"} \ + ${par_genomeSAsparseD:+--genomeSAsparseD "${par_genomeSAsparseD}"} \ + ${par_genomeSuffixLengthMax:+--genomeSuffixLengthMax "${par_genomeSuffixLengthMax}"} \ + ${par_genomeTransformType:+--genomeTransformType "${par_genomeTransformType}"} \ + ${par_genomeTransformVCF:+--genomeTransformVCF "${par_genomeTransformVCF}"} \ diff --git a/src/star/star_genome_generate/test.sh b/src/star/star_genome_generate/test.sh new file mode 100644 index 00000000..fd0e4775 --- /dev/null +++ b/src/star/star_genome_generate/test.sh @@ -0,0 +1,48 @@ +#!/bin/bash + +set -e + +## VIASH START +## VIASH END + +######################################################################################### + +echo "> Prepare test data" + +cat > genome.fasta <<'EOF' +>chr1 +TGGCATGAGCCAACGAACGCTGCCTCATAAGCCTCACACATCCGCGCCTATGTTGTGACTCTCTGTGAGCGTTCGTGGG +GCTCGTCACCACTATGGTTGGCCGGTTAGTAGTGTGACTCCTGGTTTTCTGGAGCTTCTTTAAACCGTAGTCCAGTCAA +TGCGAATGGCACTTCACGACGGACTGTCCTTAGCTCAGGGGA +EOF + +cat > genes.gtf <<'EOF' +chr1 example_source gene 0 50 . + . gene_id "gene1"; transcript_id "transcript1"; +chr1 example_source exon 20 40 . + . gene_id "gene1"; transcript_id "transcript1"; +EOF + +######################################################################################### + +echo "> Generate index" +"$meta_executable" \ + ${meta_cpus:+---cpus $meta_cpus} \ + --index "star_index/" \ + --genomeFastaFiles "genome.fasta" \ + --sjdbGTFfile "genes.gtf" \ + --genomeSAindexNbases 2 + +files=("Genome" "Log.out" "SA" "SAindex" "chrLength.txt" "chrName.txt" "chrNameLength.txt" "chrStart.txt" "exonGeTrInfo.tab" "exonInfo.tab" "geneInfo.tab" "genomeParameters.txt" "sjdbInfo.txt" "sjdbList.fromGTF.out.tab" "sjdbList.out.tab" "transcriptInfo.tab") + +echo ">> Check if output exists" +[ ! -d "star_index" ] && echo "Directory 'star_index' does not exist!" && exit 1 +for file in "${files[@]}"; do + [ ! -f "star_index/$file" ] && echo "File '$file' does not exist in 'star_index'." && exit 1 +done + +echo ">> Check contents of output files" +grep -q "200" "star_index/chrLength.txt" || (echo "Chromosome length in file 'chrLength.txt' is incorrect! " && exit 1) +grep -q "chr1" "star_index/chrName.txt" || (echo "Chromosome name in file 'chrName.txt' is incorrect! " && exit 1) +grep -q "chr1 200" "star_index/chrNameLength.txt" || (echo "Chromosome name in file 'chrNameLength.txt' is incorrect! " && exit 1) + +echo ">>> Test finished successfully" +exit 0