diff --git a/src/cutadapt/config.vsh.yaml b/src/cutadapt/config.vsh.yaml
index 88636952..ebd56e3b 100644
--- a/src/cutadapt/config.vsh.yaml
+++ b/src/cutadapt/config.vsh.yaml
@@ -437,14 +437,17 @@ functionality:
         # - name: --untrimmed_paired_output
         # - name: too_short_paired_output
         # - name: too_long_paired_output
+    - name: Debug
+      arguments:
+        - type: boolean_true
+          name: --debug
+          description: Print debug information
   resources:
     - type: bash_script
       path: script.sh
   test_resources:
     - type: bash_script
       path: test.sh
-    - type: file
-      path: test_data
 platforms:
   - type: docker
     image: python:3.12
diff --git a/src/cutadapt/script.sh b/src/cutadapt/script.sh
index 2ae29a3c..1edfb090 100644
--- a/src/cutadapt/script.sh
+++ b/src/cutadapt/script.sh
@@ -1,16 +1,30 @@
 #!/bin/bash
 
+## VIASH START
+par_adapter='AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;GGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
+par_input='src/cutadapt/test_data/se/a.fastq'
+par_report='full'
+par_json='false'
+par_output='output'
+par_fasta='false'
+par_info_file='false'
+par_debug='true'
+## VIASH END
+
+# TODO: change this?
 if [ -z $par_output ]; then
 	par_output=.
 else
 	mkdir -p "$par_output"
 fi
 
+function debug {
+  [[ "$par_debug" == "true" ]] && echo "DEBUG: $@"
+}
 
 # Init
 ###########################################################
-echo "Running cutadapt"
-echo
+
 echo ">> Paired-end data or not?"
 
 mode=""
@@ -29,85 +43,45 @@ fi
 #   - string and fasta
 ###########################################################
 
-multi_adapter=""
-for adapter in `echo $par_adapter | tr ':' ' '`; do
-  multi_adapter="$multi_adapter --adapter $adapter"
-done
-
-multi_adapter_fasta=""
-for adapter_fasta in `echo $par_adapter_fasta | tr ':' ' '`; do
-  multi_adapter_fasta="$multi_adapter_fasta --adapter file:$adapter_fasta"
-done
-
-multi_adapter_r2=""
-for adapter_r2 in `echo $par_adapter_r2 | tr ':' ' '`; do
-  multi_adapter_r2="$multi_adapter_r2 --adapter_r2 $adapter_r2"
-done
-
-multi_adapter_fasta_r2=""
-for adapter_fasta_r2 in `echo $par_adapter_fasta_r2 | tr ':' ' '`; do
-  multi_adapter_fasta_r2="$multi_adapter_fasta_r2 --adapter file:$adapter_fasta_r2"
-done
-
-multi_front=""
-for front in `echo $par_front | tr ':' ' '`; do
-  multi_front="$multi_front --front $front"
-done
-
-multi_front_fasta=""
-for front_fasta in `echo $par_front_fasta | tr ':' ' '`; do
-  multi_front_fasta="$multi_front_fasta --front file:$front_fasta"
-done
-
-multi_front_r2=""
-for front_r2 in `echo $par_front_r2 | tr ':' ' '`; do
-  multi_front_r2="$multi_front_r2 --front_r2 $front_r2"
-done
-
-multi_front_fasta_r2=""
-for front_fasta_r2 in `echo $par_front_fasta_r2 | tr ':' ' '`; do
-  multi_front_fasta_r2="$multi_front_fasta_r2 --front file:$front_fasta_r2"
-done
-
-multi_anywhere=""
-for anywhere in `echo $par_anywhere | tr ':' ' '`; do
-  multi_anywhere="$multi_anywhere --anywhere $anywhere"
-done
-
-multi_anywhere_fasta=""
-for anywhere_fasta in `echo $par_anywhere_fasta | tr ':' ' '`; do
-  multi_anywhere_fasta="$multi_anywhere_fasta --anywhere file:$anywhere_fasta"
-done
-
-multi_anywhere_r2=""
-for anywhere_r2 in `echo $par_anywhere_r2 | tr ':' ' '`; do
-  multi_anywhere_r2="$multi_anywhere_r2 --anywhere_r2 $anywhere_r2"
-done
-
-multi_anywhere_fasta_r2=""
-for anywhere_fasta_r2 in `echo $par_anywhere_fasta_r2 | tr ':' ' '`; do
-  multi_anywhere_fasta_r2="$multi_anywhere_fasta_r2 --anywhere file:$anywhere_fasta_r2"
-done
-
-echo ">> Parsing arguments dealing with adapters"
+function add_flags {
+  local arg=$1
+  local flag=$2
+  local prefix=$3
+  [[ -z $prefix ]] && prefix=""
+
+  # This function should not be called if the input is empty
+  # but check for it just in case
+  if [[ -z $arg ]]; then
+    return
+  fi
+
+  local output=""
+  IFS=';' read -r -a array <<< "$arg"
+  for a in "${array[@]}"; do
+    output="$output $flag $prefix$a"
+  done
+  echo $output
+}
+
+debug ">> Parsing arguments dealing with adapters"
 adapter_args=$(echo \
-  ${par_adapter:+${multi_adapter}} \
-  ${par_adapter_fasta:+${multi_adapter_fasta}} \
-  ${par_front:+${multi_front}} \
-  ${par_front_fasta:+${multi_front_fasta}} \
-  ${par_anywhere:+${multi_anywhere}} \
-  ${par_anywhere_fasta:+${multi_anywhere_fasta}} \
-
-  ${par_adapter_r2:+${multi_adapter_r2}} \
-  ${par_adapter_fasta_r2:+${multi_adapter_fasta_r2}} \
-  ${par_front_r2:+${multi_front_r2}} \
-  ${par_front_fasta_r2:+${multi_front_fasta_r2}} \
-  ${par_anywhere_r2:+${multi_anywhere_r2}} \
-  ${par_anywhere_fasta_r2:+${multi_anywhere_fasta_r2}} \
+  ${par_adapter:+$(add_flags "$par_adapter" "--adapter")} \
+  ${par_adapter_fasta:+$(add_flags "$par_adapter_fasta" "--adapter" "file:")} \
+  ${par_front:+$(add_flags "$par_front" "--front")} \
+  ${par_front_fasta:+$(add_flags "$par_front_fasta" "--front" "file:")} \
+  ${par_anywhere:+$(add_flags "$par_anywhere" "--anywhere")} \
+  ${par_anywhere_fasta:+$(add_flags "$par_anywhere_fasta" "--anywhere" "file:")} \
+  ${par_adapter_r2:+$(add_flags "$par_adapter_r2" "-A")} \
+  ${par_adapter_fasta_r2:+$(add_flags "$par_adapter_fasta_r2" "-A" "file:")} \
+  ${par_front_r2:+$(add_flags "$par_front_r2" "-G")} \
+  ${par_front_fasta_r2:+$(add_flags "$par_front_fasta_r2" "-G" "file:")} \
+  ${par_anywhere_r2:+$(add_flags "$par_anywhere_r2" "-B")} \
+  ${par_anywhere_fasta_r2:+$(add_flags "$par_anywhere_fasta_r2" "-B" "file:")} \
 )
-echo "Arguments to cutadapt:"
-echo "$adapter_args"
-echo
+
+debug "Arguments to cutadapt:"
+debug "$adapter_args"
+debug
 
 # Paired-end options
 ###########################################################
@@ -120,9 +94,9 @@ paired_args=$(echo \
   ${par_pair_filter:+--pair-filter "${par_pair_filter}"} \
   ${par_interleaved:+--interleaved}
 )
-echo "Arguments to cutadapt:"
-echo $paired_args
-echo
+debug "Arguments to cutadapt:"
+debug $paired_args
+debug
 
 # Input arguments 
 ###########################################################
@@ -142,9 +116,9 @@ input_args=$(echo \
   ${par_action:+--action "${par_action}"} \
   ${par_revcomp:+--revcomp} \
 )
-echo "Arguments to cutadapt:"
-echo $input_args
-echo
+debug "Arguments to cutadapt:"
+debug $input_args
+debug
 
 # Read modifications
 ###########################################################
@@ -170,9 +144,9 @@ mod_args=$(echo \
   ${par_rename:+--rename "${par_rename}"} \
   ${par_zero_cap:+--zero-cap} \
 )
-echo "Arguments to cutadapt:"
-echo $mod_args
-echo
+debug "Arguments to cutadapt:"
+debug $mod_args
+debug
 
 # Filtering of processed reads arguments
 ###########################################################
@@ -194,46 +168,58 @@ filter_args=$(echo \
   ${par_discard_untrimmed:+--discard-untrimmed} \
   ${par_discard_casava:+--discard-casava} \
 )
-echo "Arguments to cutadapt:"
-echo $filter_args
-echo
+debug "Arguments to cutadapt:"
+debug $filter_args
+debug
 
-# Output arguments
-# We write the output to a directory rather than
-# individual files.
+# Optional output arguments
 ###########################################################
-echo ">> Output arguments"
+echo ">> Optional arguments"
 [[ "$par_json" == "false" ]] && unset par_json
 [[ "$par_fasta" == "false" ]] && unset par_fasta
 [[ "$par_info_file" == "false" ]] && unset par_info_file
 
+optional_output_args=$(echo \
+  ${par_report:+--report "${par_report}"} \
+  ${par_json:+--json "${par_output}/report.json"} \
+  ${par_fasta:+--fasta} \
+  ${par_info_file:+--info-file "$par_output/info.txt"} \
+)
+
+debug "Arguments to cutadapt:"
+debug $optional_output_args
+debug
+
+# Output arguments
+# We write the output to a directory rather than
+# individual files.
+###########################################################
+
+if [[ -z $par_fasta ]]; then
+  ext="fastq"
+else
+  ext="fasta"
+fi
+
 if [ $mode = "se" ]; then
   output_args=$(echo \
-    ${par_report:+--report "${par_report}"} \
-    ${par_json:+--json "${par_output}/report.json"} \
-    --output "$par_output/{name}_R1_001.fastq" \
-    ${par_fasta:+--fasta} \
-    ${par_info_file:+--info-file} \
+    --output "$par_output/{name}_001.$ext" \
   )
 else
   output_args=$(echo \
-    ${par_report:+--report "${par_report}"} \
-    ${par_json:+--json "${par_output}/report.json"} \
-    --output "$par_output/{name}_R1_001.fastq" \
-    --paired-output "$par_output/{name}_R2_001.fastq" \
-    ${par_fasta:+--fasta} \
-    ${par_info_file:+--info-file} \
+    --output "$par_output/{name}_R1_001.$ext" \
+    --paired-output "$par_output/{name}_R2_001.$ext" \
   )
 fi
-echo "Arguments to cutadapt:"
-echo $output_args
-echo
+
+debug "Arguments to cutadapt:"
+debug $output_args
+debug
 
 # Full CLI
 # Set the --cores argument to 0 unless meta_cpus is set
 ###########################################################
-echo ">> Full CLI to be run:"
-
+echo ">> Running cutadapt"
 par_cpus=0
 [[ ! -z $meta_cpus ]] && par_cpus=$meta_cpus
 
@@ -244,10 +230,13 @@ cli=$(echo \
   $input_args \
   $mod_args \
   $filter_args \
+  $optional_output_args \
   $output_args \
   --cores $par_cpus
 )
 
-echo cutadapt $cli | sed -e 's/--/\r\n  --/g'
+debug ">> Full CLI to be run:"
+debug cutadapt $cli | sed -e 's/--/\r\n  --/g'
+debug
 
 cutadapt $cli | tee $par_output/report.txt
diff --git a/src/cutadapt/test.sh b/src/cutadapt/test.sh
index 14e2e6fe..d36e6798 100644
--- a/src/cutadapt/test.sh
+++ b/src/cutadapt/test.sh
@@ -2,88 +2,216 @@
 
 set -e
 
-dir_in="$meta_resources_dir/test_data"
-
+#############################################
+# helper functions
+assert_file_exists() {
+  [ -f "$1" ] || (echo "File '$1' does not exist" && exit 1)
+}
+assert_file_doesnt_exist() {
+  [ ! -f "$1" ] || (echo "File '$1' exists but shouldn't" && exit 1)
+}
+assert_file_empty() {
+  [ ! -s "$1" ] || (echo "File '$1' is not empty but should be" && exit 1)
+}
+assert_file_not_empty() {
+  [ -s "$1" ] || (echo "File '$1' is empty but shouldn't be" && exit 1)
+}
+assert_file_contains() {
+  grep -q "$2" "$1" || (echo "File '$1' does not contain '$2'" && exit 1)
+}
+assert_file_not_contains() {
+  grep -q "$2" "$1" && (echo "File '$1' contains '$2' but shouldn't" && exit 1)
+}
+
+#############################################
+mkdir test_simple_single_end
+cd test_simple_single_end
+
+echo "#############################################"
 echo "> Run cutadapt on single-end data"
+
+cat > example.fa <<'EOF'
+>read1
+MYSEQUENCEADAPTER
+>read2
+MYSEQUENCEADAP
+>read3
+MYSEQUENCEADAPTERSOMETHINGELSE
+>read4
+MYSEQUENCEADABTER
+>read5
+MYSEQUENCEADAPTR
+>read6
+MYSEQUENCEADAPPTER
+>read7
+ADAPTERMYSEQUENCE
+>read8
+PTERMYSEQUENCE
+>read9
+SOMETHINGADAPTERMYSEQUENCE
+EOF
+
 "$meta_executable" \
   --report minimal \
-  --output output-dir \
-  --adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
-  --input $dir_in/se/a.fastq \
-  --quality_cutoff 20 \
+  --output out_test1 \
+  --adapter ADAPTER \
+  --input example.fa \
+  --fasta \
+  --no_match_adapter_wildcards \
   --json
 
 echo ">> Checking output"
-[ ! -f "output-dir/report.txt" ] && echo "report.txt does not exist" && exit 1
-[ ! -f "output-dir/report.json" ] && echo "report.json does not exist" && exit 1
-[ ! -f "output-dir/1_R1_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
-[ ! -f "output-dir/unknown_R1_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
+assert_file_exists "out_test1/report.txt"
+assert_file_exists "out_test1/report.json"
+assert_file_exists "out_test1/1_001.fasta"
+assert_file_exists "out_test1/unknown_001.fasta"
 
 echo ">> Check if output is empty"
-[ -s "output-dir/1_R1_001.fastq" ] && echo "1_R1_001.fastq should be empty" && exit 1
-[ ! -s "output-dir/unknown_R1_001.fastq" ] && echo "unkown_R1_001.fastq is empty" && exit 1
-
-rm -r output-dir
-
+assert_file_not_empty "out_test1/report.txt"
+assert_file_not_empty "out_test1/report.json"
+assert_file_not_empty "out_test1/1_001.fasta"
+assert_file_not_empty "out_test1/unknown_001.fasta"
+
+echo ">> Check contents"
+for i in 1 2 3 7 9; do
+  assert_file_contains "out_test1/1_001.fasta" ">read$i"
+done
+for i in 4 5 6 8; do
+  assert_file_contains "out_test1/unknown_001.fasta" ">read$i"
+done
+
+cd ..
+echo
+
+#############################################
+mkdir test_multiple_single_end
+cd test_multiple_single_end
+
+echo "#############################################"
 echo "> Run with a combination of inputs"
 
-echo ">adapter1" > adapters1.fasta
-echo "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" >> adapters1.fasta
-
-echo ">adapter1" > adapters2.fasta
-echo "TGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" >> adapters2.fasta
+cat > example.fa <<'EOF'
+>read1
+ACGTACGTACGTAAAAA
+>read2
+ACGTACGTACGTCCCCC
+>read3
+ACGTACGTACGTGGGGG
+>read4
+ACGTACGTACGTTTTTT
+EOF
+
+cat > adapters1.fasta <<'EOF'
+>adapter1
+CCCCC
+EOF
+
+cat > adapters2.fasta <<'EOF'
+>adapter2
+GGGGG
+EOF
 
 "$meta_executable" \
   --report minimal \
-  --output output-dir \
-  --adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
-  --adapter GGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
+  --output out_test2 \
+  --adapter AAAAA \
   --adapter_fasta adapters1.fasta \
   --adapter_fasta adapters2.fasta \
-  --input $dir_in/se/a.fastq \
-  --quality_cutoff 20 \
+  --input example.fa \
+  --fasta \
   --json
 
 echo ">> Checking output"
-[ ! -f "output-dir/report.txt" ] && echo "report.txt does not exist" && exit 1
-[ ! -f "output-dir/report.json" ] && echo "report.json does not exist" && exit 1
-[ ! -f "output-dir/1_R1_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
-[ ! -f "output-dir/unknown_R1_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
+assert_file_exists "out_test2/report.txt"
+assert_file_exists "out_test2/report.json"
+assert_file_exists "out_test2/1_001.fasta"
+assert_file_exists "out_test2/adapter1_001.fasta"
+assert_file_exists "out_test2/adapter2_001.fasta"
+assert_file_exists "out_test2/unknown_001.fasta"
 
 echo ">> Check if output is empty"
-[ -s "output-dir/1_R1_001.fastq" ] && echo "1_R1_001.fastq should be empty" && exit 1
-[ ! -s "output-dir/unknown_R1_001.fastq" ] && echo "unkown_R1_001.fastq is empty" && exit 1
+assert_file_not_empty "out_test2/report.txt"
+assert_file_not_empty "out_test2/report.json"
+assert_file_not_empty "out_test2/1_001.fasta"
+assert_file_not_empty "out_test2/adapter1_001.fasta"
+assert_file_not_empty "out_test2/adapter2_001.fasta"
+assert_file_not_empty "out_test2/unknown_001.fasta"
+
+echo ">> Check contents"
+assert_file_contains "out_test2/1_001.fasta" ">read1"
+assert_file_contains "out_test2/adapter1_001.fasta" ">read2"
+assert_file_contains "out_test2/adapter2_001.fasta" ">read3"
+assert_file_contains "out_test2/unknown_001.fasta" ">read4"
+
+cd ..
+echo
+
+#############################################
+mkdir test_simple_paired_end
+cd test_simple_paired_end
+
+echo "#############################################"
+echo "> Run cutadapt on paired-end data"
 
-rm -r output-dir
-rm adapters?.fasta
+cat > example_R1.fastq <<'EOF'
+@read1
+ACGTACGTACGTAAAAA
++
+IIIIIIIIIIIIIIIII
+@read2
+ACGTACGTACGTCCCCC
++
+IIIIIIIIIIIIIIIII
+EOF
+
+cat > example_R2.fastq <<'EOF'
+@read1
+ACGTACGTACGTGGGGG
++
+IIIIIIIIIIIIIIIII
+@read2
+ACGTACGTACGTTTTTT
++
+IIIIIIIIIIIIIIIII
+EOF
 
-echo "> Run cutadapt on paired-end data"
 "$meta_executable" \
   --report minimal \
-  --output output-dir \
-  --adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
-  --adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCAB \
-  --input $dir_in/pe/a.1.fastq \
-  --input_r2 $dir_in/pe/a.2.fastq \
+  --output out_test3 \
+  --adapter AAAAA \
+  --adapter_r2 GGGGG \
+  --input example_R1.fastq \
+  --input_r2 example_R2.fastq \
   --quality_cutoff 20 \
   --json \
   ---cpus 1
 
 echo ">> Checking output"
-[ ! -f "output-dir/report.txt" ] && echo "report.txt does not exist" && exit 1
-[ ! -f "output-dir/report.json" ] && echo "report.json does not exist" && exit 1
-[ ! -f "output-dir/1_R1_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
-[ ! -f "output-dir/1_R2_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
-[ ! -f "output-dir/unknown_R1_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
-[ ! -f "output-dir/unknown_R2_001.fastq" ] && echo "1_R1_001.fastq does not exist" && exit 1
+assert_file_exists "out_test3/report.txt"
+assert_file_exists "out_test3/report.json"
+assert_file_exists "out_test3/1_R1_001.fastq"
+assert_file_exists "out_test3/1_R2_001.fastq"
+assert_file_exists "out_test3/unknown_R1_001.fastq"
+assert_file_exists "out_test3/unknown_R2_001.fastq"
 
 echo ">> Check if output is empty"
-[ -s "output-dir/1_R1_001.fastq" ] && echo "1_R1_001.fastq should be empty" && exit 1
-[ -s "output-dir/1_R2_001.fastq" ] && echo "1_R2_001.fastq should be empty" && exit 1
-[ ! -s "output-dir/unknown_R1_001.fastq" ] && echo "unkown_R1_001.fastq is empty" && exit 1
-[ ! -s "output-dir/unknown_R2_001.fastq" ] && echo "unkown_R2_001.fastq is empty" && exit 1
+assert_file_not_empty "out_test3/report.txt"
+assert_file_not_empty "out_test3/report.json"
+assert_file_not_empty "out_test3/1_R1_001.fastq"
+assert_file_not_empty "out_test3/1_R2_001.fastq"
+assert_file_not_empty "out_test3/unknown_R1_001.fastq"
+
+echo ">> Check contents"
+assert_file_contains "out_test3/1_R1_001.fastq" "@read1"
+assert_file_contains "out_test3/1_R2_001.fastq" "@read1"
+assert_file_contains "out_test3/unknown_R1_001.fastq" "@read2"
+assert_file_contains "out_test3/unknown_R2_001.fastq" "@read2"
+
+cd ..
+echo
 
-rm -r output-dir
+#############################################
 
+echo "#############################################"
 echo "> Test successful"
 
diff --git a/src/cutadapt/test_data/pe/a.1.fastq b/src/cutadapt/test_data/pe/a.1.fastq
deleted file mode 100644
index 42735560..00000000
--- a/src/cutadapt/test_data/pe/a.1.fastq
+++ /dev/null
@@ -1,4 +0,0 @@
-@1
-ACGGCAT
-+
-!!!!!!!
diff --git a/src/cutadapt/test_data/pe/a.2.fastq b/src/cutadapt/test_data/pe/a.2.fastq
deleted file mode 100644
index 42735560..00000000
--- a/src/cutadapt/test_data/pe/a.2.fastq
+++ /dev/null
@@ -1,4 +0,0 @@
-@1
-ACGGCAT
-+
-!!!!!!!
diff --git a/src/cutadapt/test_data/script.sh b/src/cutadapt/test_data/script.sh
deleted file mode 100755
index 3251b59c..00000000
--- a/src/cutadapt/test_data/script.sh
+++ /dev/null
@@ -1,16 +0,0 @@
-# cutadapt test data
-
-# Test data was obtained from https://github.com/snakemake/snakemake-wrappers/tree/master/bio/cutadapt/test
-
-if [ ! -d /tmp/snakemake-wrappers ]; then
-  git clone --depth 1 --single-branch --branch master https://github.com/snakemake/snakemake-wrappers /tmp/snakemake-wrappers
-fi
-
-mkdir -p src/cutadapt/test_data/pe
-mkdir src/cutadapt/test_data/se
-
-cp -r /tmp/snakemake-wrappers/bio/cutadapt/se/test/reads/* src/cutadapt/test_data/se
-cp -r /tmp/snakemake-wrappers/bio/cutadapt/pe/test/reads/* src/cutadapt/test_data/pe
-
-rm -rf /tmp/snakemake-wrappers
-
diff --git a/src/cutadapt/test_data/se/a.fastq b/src/cutadapt/test_data/se/a.fastq
deleted file mode 100644
index 42735560..00000000
--- a/src/cutadapt/test_data/se/a.fastq
+++ /dev/null
@@ -1,4 +0,0 @@
-@1
-ACGGCAT
-+
-!!!!!!!