diff --git a/src/nanoplot/config.vsh.yaml b/src/nanoplot/config.vsh.yaml
index 8dc9844f..1c22775f 100644
--- a/src/nanoplot/config.vsh.yaml
+++ b/src/nanoplot/config.vsh.yaml
@@ -15,13 +15,13 @@ argument_groups:
     arguments:
       - name: --fastq
         type: file
-        description: Input fastq file(s).
+        description: Input fastq file(s), separated by ";".
         example: read.fq
         direction: input
         multiple: true
       - name: --fasta
         type: file
-        description: Input fasta file(s).
+        description: Input fasta file(s), separated by ";".
         example: read.fa
         direction: input
         multiple: true
@@ -29,7 +29,7 @@ argument_groups:
         type: file
         description: |
           Input fastq file(s) generated by albacore or 
-          MinKNOW with additional information concerning channel and time.
+          MinKNOW with additional information concerning channel and time, separated by ";".
         example: read.fq
         direction: input
         multiple: true
@@ -38,45 +38,45 @@ argument_groups:
         description: |
           Input fastq file(s) generated by albacore or MinKNOW with
           additional information concerning channel and time. Minimal data is extracted
-          swiftly without elaborate checks.
+          swiftly without elaborate checks. Separated by ";".
         example: read.fq
         direction: input
         multiple: true
       - name: --summary
         type: file
         description: |
-          Input summary file(s) generated by albacore or guppy.
+          Input summary file(s) generated by albacore or guppy, separated by ";".
         example: read.txt
         direction: input
         multiple: true
       - name: --bam
         type: file
-        description: Input sorted bam file(s).
+        description: Input sorted bam file(s), separated by ";".
         example: read.bam
         direction: input
         multiple: true
       - name: --ubam
         type: file
-        description: Input unmapped bam file(s).
+        description: Input unmapped bam file(s), separated by ";".
         example: read.ubam
         direction: input
         multiple: true
       - name: --cram
         type: file
-        description: Input sorted cram file(s).
+        description: Input sorted cram file(s), separated by ";".
         example: read.cram
         direction: input
         multiple: true
       - name: --pickle
         type: file
-        description: Input pickle file stored earlier.
+        description: Input pickle file stored earlier, separated by ";".
         example: read.pkl
         direction: input
         multiple: true
       - name: --feather
         alternatives: [--arrow]
         type: file
-        description: Input feather file(s).
+        description: Input feather file(s), separated by ";".
         example: read.arrow
         direction: input
         multiple: true
@@ -219,11 +219,10 @@ test_resources:
     path: test_data
 engines:
   - type: docker
-    image: quay.io/biocontainers/nanoplot:1.42.0--pyhdfd78af_0
+    image: quay.io/biocontainers/nanoplot:1.43.0--pyhdfd78af_1
     setup:
       - type: docker
         run: |
-          touch ./var/software_versions.txt && \
           version=$(NanoPlot --version) && \
           echo "$version" > /var/software_versions.txt
 runners:
diff --git a/src/nanoplot/script.sh b/src/nanoplot/script.sh
index d4344be0..fc198e89 100644
--- a/src/nanoplot/script.sh
+++ b/src/nanoplot/script.sh
@@ -6,50 +6,89 @@ set -eo pipefail
 ## VIASH END
 
 # Unset flags
-[[ "$par_verbose" == "false" ]] && unset par_verbose
-[[ "$par_store" == "false" ]] && unset par_store
-[[ "$par_raw" == "false" ]] && unset par_raw
-[[ "$par_huge" == "false" ]] && unset par_huge
-[[ "$par_no_static" == "true" ]] && unset par_no_static
-[[ "$par_tsv_stats" == "false" ]] && unset par_tsv_stats
-[[ "$par_only_report" == "false" ]] && unset par_only_report
-[[ "$par_info_in_report" == "false" ]] && unset par_info_in_report
-[[ "$par_drop_outliers" == "true" ]] && unset par_drop_outliers
-[[ "$par_loglength" == "false" ]] && unset par_loglength
-[[ "$par_percentqual" == "false" ]] && unset par_percentqual
-[[ "$par_alength" == "false" ]] && unset par_alength
-[[ "$par_barcoded" == "false" ]] && unset par_barcoded
-[[ "$par_no_supplementary" == "true" ]] && unset par_no_supplementary
-[[ "$par_listcolors" == "false" ]] && unset par_listcolors
-[[ "$par_listcolormaps" == "false" ]] && unset par_listcolormaps
-[[ "$par_no_N50" == "true" ]] && unset par_no_N50
-[[ "$par_N50" == "false" ]] && unset par_N50
-[[ "$par_hide_stats" == "true" ]] && unset par_hide_stats
+unset_if_false=( 
+    par_verbose
+    par_store
+    par_raw
+    par_huge
+    par_no_static
+    par_tsv_stats
+    par_only_report
+    par_info_in_report
+    par_drop_outliers
+    par_loglength
+    par_percentqual
+    par_alength
+    par_barcoded
+    par_no_supplementary
+    par_listcolors
+    par_listcolormaps
+    par_no_N50
+    par_N50
+    par_hide_stats
+)
+
+for var in "${unset_if_false[@]}"; do
+    test_val="${!var}"
+    [[ "$test_val" == "false" ]] && unset $var
+done
+
+par_fastq="${par_fastq//;/ }"
+par_fasta="${par_fasta//;/ }"
+par_fastq_rich="${par_fastq_rich//;/ }"
+par_fastq_minimal="${par_fastq_minimal//;/ }"
+par_summary="${par_summary//;/ }"
+par_bam="${par_bam//;/ }"
+par_ubam="${par_ubam//;/ }"
+par_cram="${par_cram//;/ }"
+par_pickle="${par_pickle//;/ }"
+par_feather="${par_feather//;/ }"
+
+
+inputs=( 
+    "$par_fastq" 
+    "$par_fasta"
+    "$par_fastq_rich"
+    "$par_fastq_minimal"
+    "$par_summary"
+    "$par_bam"
+    "$par_ubam"
+    "$par_cram"
+    "$par_pickle"
+    "$par_feather"
+)
+
+one_input=false
+for var in "${inputs[@]}"; do
+    if [ -n "$var" ]; then # if the parameter is not empty
+        if [ "$one_input" = "false" ]; then
+            one_input=true
+        else # Multiple input file types specified
+            echo "Error: Multiple input file types specified."
+            exit 1
+        fi
+    fi
+done
+
+if [ ! "$one_input" ]; then
+    echo "Error: No input file type specified."
+    exit 1
+fi
+
 
-# Multiple inputs - replace ';' with ' ' (space)
-par_fastq=$(echo $par_fastq | tr ';' ' ')
-par_fasta=$(echo $par_fasta | tr ';' ' ')
-par_fastq_rich=$(echo $par_fastq_rich | tr ';' ' ')
-par_fastq_minimal=$(echo $par_fastq_minimal | tr ';' ' ')
-par_summary=$(echo $par_summary | tr ';' ' ')
-par_bam=$(echo $par_bam | tr ';' ' ')
-par_ubam=$(echo $par_ubam | tr ';' ' ')
-par_cram=$(echo $par_cram | tr ';' ' ')
-par_pickle=$(echo $par_pickle | tr ';' ' ')
-par_feather=$(echo $par_feather | tr ';' ' ')
 
 # Run NanoPlot
 NanoPlot \
-    ${par_fastq:+--fastq "$par_fastq"} \
-    ${par_fasta:+--fasta "$par_fasta"} \
-    ${par_fastq_rich:+--fastq_rich "$par_fastq_rich"} \
-    ${par_fastq_minimal:+--fastq_minimal "$par_fastq_minimal"} \
-    ${par_summary:+--summary "$par_summary"} \
-    ${par_bam:+--bam "$par_bam"} \
-    ${par_ubam:+--ubam "$par_ubam"} \
-    ${par_cram:+--cram "$par_cram"} \
-    ${par_pickle:+--pickle "$par_pickle"} \
-    ${par_feather:+--feather "$par_feather"} \
+    ${par_fastq:+--fastq $par_fastq} \
+    ${par_fasta:+--fasta $par_fasta} \
+    ${par_fastq_rich:+--fastq_rich $par_fastq_rich} \
+    ${par_fastq_minimal:+--fastq_minimal $par_fastq_minimal} \
+    ${par_summary:+--summary $par_summary} \
+    ${par_bam:+--bam $par_bam} \
+    ${par_ubam:+--ubam $par_ubam} \
+    ${par_cram:+--cram $par_cram} \
+    ${par_pickle:+--pickle $par_pickle} \
+    ${par_feather:+--feather $par_feather} \
     ${par_verbose:+--verbose} \
     ${par_store:+--store} \
     ${par_raw:+--raw} \
@@ -85,4 +124,6 @@ NanoPlot \
     ${par_dpi:+--dpi "$par_dpi"} \
     ${par_hide_stats:+--hide_stats} \
     ${meta_cpus:+--threads "$meta_cpus"} \
-    --outdir "$par_outdir"
\ No newline at end of file
+    --outdir "$par_outdir"
+
+exit 0
diff --git a/src/nanoplot/test.sh b/src/nanoplot/test.sh
index 878d04b5..cac10c17 100644
--- a/src/nanoplot/test.sh
+++ b/src/nanoplot/test.sh
@@ -3,12 +3,10 @@
 set -eo pipefail
 
 ## VIASH START
-meta_executable="$PWD/target/executable/nanoplot/nanoplot"
-meta_resources_dir="$PWD/src/nanoplot"
 ## VIASH END
 
 # Files at runtime (.gz, .pickle and .feather)
-wget "https://github.com/wdecoster/nanotest/archive/refs/heads/master.zip"
+wget https://github.com/wdecoster/nanotest/archive/refs/heads/master.zip
 unzip master.zip
 
 ###########################################################################
@@ -62,7 +60,7 @@ pushd test2 > /dev/null
 
 echo "> Run Test 2: multiple inputs (Fastq)"
 "$meta_executable" \
-  --fastq "$meta_resources_dir/test_data/test1.fastq" "$meta_resources_dir/test_data/test2.fastq" \
+  --fastq "$meta_resources_dir/test_data/test1.fastq;$meta_resources_dir/test_data/test2.fastq" \
   --outdir output
 
 # Check if output directory exists
@@ -109,7 +107,7 @@ echo "> Run Test 3: multiple options-1"
   --format jpg \
   --prefix biobox_ \
   --store \
-  --color yellow \
+  --color "yellow" \
   --info_in_report \
   --outdir output
 
diff --git a/src/nanoplot/test_data/test1.fastq b/src/nanoplot/test_data/test1.fastq
index 7bc0dc94..f262027d 100644
--- a/src/nanoplot/test_data/test1.fastq
+++ b/src/nanoplot/test_data/test1.fastq
@@ -46,5 +46,4 @@ DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD
 @read_10
 ACTGGTATGTCGTGGTACCCTTGA
 +
-111111111111111111111111
-
+111111111111111111111111
\ No newline at end of file
diff --git a/src/nanoplot/test_data/test2.fastq b/src/nanoplot/test_data/test2.fastq
index 242cb659..b9283728 100644
--- a/src/nanoplot/test_data/test2.fastq
+++ b/src/nanoplot/test_data/test2.fastq
@@ -31,5 +31,4 @@ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 @read_7
 AATAAAGCCCGTTCCACACTTTAGCAATGTCAAGACTGTATCATCGACAGCGGTAGTTATGTAGCCAGCACATTTCATTACCCCCTCGC
 +
-77777777777777777777777777777777777777777777777777777777777777777777777777777777777777777
-
+77777777777777777777777777777777777777777777777777777777777777777777777777777777777777777
\ No newline at end of file