diff --git a/src/star/star_align/test.sh b/src/star/star_align/test.sh
index 1bdadf38..ae31af3c 100644
--- a/src/star/star_align/test.sh
+++ b/src/star/star_align/test.sh
@@ -7,14 +7,78 @@ meta_executable="target/docker/star/star_align/star_align"
 meta_resources_dir="src/star/star_align"
 ## VIASH END
 
+#############################################
+# helper functions
+assert_file_exists() {
+  [ -f "$1" ] || (echo "File '$1' does not exist" && exit 1)
+}
+assert_file_doesnt_exist() {
+  [ ! -f "$1" ] || (echo "File '$1' exists but shouldn't" && exit 1)
+}
+assert_file_empty() {
+  [ ! -s "$1" ] || (echo "File '$1' is not empty but should be" && exit 1)
+}
+assert_file_not_empty() {
+  [ -s "$1" ] || (echo "File '$1' is empty but shouldn't be" && exit 1)
+}
+assert_file_contains() {
+  grep -q "$2" "$1" || (echo "File '$1' does not contain '$2'" && exit 1)
+}
+assert_file_not_contains() {
+  grep -q "$2" "$1" && (echo "File '$1' contains '$2' but shouldn't" && exit 1)
+}
+assert_file_contains_regex() {
+  grep -q -E "$2" "$1" || (echo "File '$1' does not contain '$2'" && exit 1)
+}
+assert_file_not_contains_regex() {
+  grep -q -E "$2" "$1" && (echo "File '$1' contains '$2' but shouldn't" && exit 1)
+}
+
+#############################################
+echo "> Prepare test data"
+
+cat > reads_R1.fastq <<'EOF'
+@SEQ_ID1
+ACGCTGCCTCATAAGCCTCACACAT
++
+IIIIIIIIIIIIIIIIIIIIIIIII
+@SEQ_ID2
+ACCCGCAAGATTAGGCTCCGTACAC
++
+!!!!!!!!!!!!!!!!!!!!!!!!!
+EOF
+
+cat > reads_R2.fastq <<'EOF'
+@SEQ_ID1
+ATGTGTGAGGCTTATGAGGCAGCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIII
+@SEQ_ID2
+GTGTACGGAGCCTAATCTTGCAGGG
++
+!!!!!!!!!!!!!!!!!!!!!!!!!
+EOF
+
+cat > genome.fasta <<'EOF'
+>chr1
+TGGCATGAGCCAACGAACGCTGCCTCATAAGCCTCACACATCCGCGCCTATGTTGTGACTCTCTGTGAGCGTTCGTGGG
+GCTCGTCACCACTATGGTTGGCCGGTTAGTAGTGTGACTCCTGGTTTTCTGGAGCTTCTTTAAACCGTAGTCCAGTCAA
+TGCGAATGGCACTTCACGACGGACTGTCCTTAGCTCAGGGGA
+EOF
+
+cat > genes.gtf <<'EOF'
+chr1    example_source  gene    0    50   .   +   .   gene_id "gene1"; transcript_id "transcript1";
+chr1    example_source  exon    20   40   .   +   .   gene_id "gene1"; transcript_id "transcript1"; 
+EOF
 
 echo "> Generate index"
 STAR \
   ${meta_cpus:+--runThreadN $meta_cpus} \
   --runMode genomeGenerate \
   --genomeDir "index/" \
-  --genomeFastaFiles "$meta_resources_dir/test_data/genome.fasta" #\
-  # --sjdbGTFfile "$meta_resources_dir/test_data/genes.gtf"
+  --genomeFastaFiles "genome.fasta" \
+  --sjdbGTFfile "genes.gtf" \
+  --genomeSAindexNbases 2
   
 #########################################################################################
 mkdir star_align_se
@@ -22,71 +86,84 @@ cd star_align_se
 
 echo "> Run star_align on SE"
 "$meta_executable" \
-  --input "$meta_resources_dir/test_data/a_R1.1.fastq" \
-  --input "$meta_resources_dir/test_data/a_R1.2.fastq" \
+  --input "../reads_R1.fastq" \
   --genomeDir "../index/" \
-  --aligned_reads "output.bam" \
+  --aligned_reads "output.sam" \
   --log "log.txt" \
   --outReadsUnmapped "Fastx" \
-  --unmapped "unmapped.bam" \
-  ${meta_cpus:+---cpus $meta_cpus}
+  --unmapped "unmapped.sam" \
+  ${meta_cpus:+---cpus $meta_cpus} \
+  --quantMode "TranscriptomeSAM;GeneCounts" \
+  --reads_per_gene "reads_per_gene.tsv" \
+  --outSJtype Standard \
+  --splice_junctions "splice_junctions.tsv"
 
-  # optional outputs
-  # \
-  # --quantMode "TranscriptomeSAM;GeneCounts" \
-  # --reads_per_gene "reads_per_gene.tsv" \
-  # --chimOutType "Junctions" \
-  # --chimeric_junctions "chimeric_junctions.tsv" \
-  # --outSJtype Standard \
-  # --splice_junctions "splice_junctions.tsv"
-
-# ↑ automate depending on desired outputs?
+# TODO: Test data doesn't contain any chimeric reads yet
+# --chimOutType "Junctions" \
+# --chimeric_junctions "chimeric_junctions.tsv" \
 
 echo ">> Check if output exists"
-[ ! -f "output.bam" ] && echo ">> output.bam does not exist" && exit 1
-[ ! -f "log.txt" ] && echo ">> log.txt does not exist" && exit 1
-
-# [ ! -f "reads_per_gene.tsv" ] && echo ">> reads_per_gene.tsv does not exist" && exit 1
-# [ ! -f "chimeric_junctions.tsv" ] && echo ">> chimeric_junctions.tsv does not exist" && exit 1
-# [ ! -f "splice_junctions.tsv" ] && echo ">> splice_junctions.tsv does not exist" && exit 1
-[ ! -f "unmapped.bam" ] && echo ">> unmapped.bam does not exist" && exit 1
+assert_file_exists "output.sam"
+assert_file_exists "log.txt"
+assert_file_exists "reads_per_gene.tsv"
+# assert_file_exists "chimeric_junctions.tsv"
+assert_file_exists "splice_junctions.tsv"
+assert_file_exists "unmapped.sam"
+
+echo ">> Check if output contents are not empty"
+assert_file_not_empty "output.sam"
+assert_file_not_empty "log.txt"
+assert_file_not_empty "reads_per_gene.tsv"
+# assert_file_not_empty "chimeric_junctions.tsv"
+# assert_file_not_empty "splice_junctions.tsv" # TODO: test data doesn't contain any splice junctions yet
+assert_file_not_empty "unmapped.sam"
+
+echo ">> Check if output contents are correct"
+assert_file_contains "log.txt" "Number of input reads \\|	2"
+assert_file_contains "log.txt" "Number of reads unmapped: too short \\|	1"
+assert_file_contains "log.txt" "Uniquely mapped reads number \\|	1"
+assert_file_contains "reads_per_gene.tsv" "gene1	1	1	0"
+assert_file_contains "reads_per_gene.tsv" "N_unmapped	1	1	1"
+assert_file_contains "output.sam" "SEQ_ID1	0	chr1	17	255	25M	\\*	0	0	ACGCTGCCTCATAAGCCTCACACAT	IIIIIIIIIIIIIIIIIIIIIIIII	NH:i:1	HI:i:1	AS:i:24	nM:i:0"
+assert_file_contains "unmapped.sam" "@SEQ_ID2 0:N:"
+assert_file_contains "unmapped.sam" "ACCCGCAAGATTAGGCTCCGTACAC"
 
 cd ..
 
-#########################################################################################
-mkdir star_align_pe_minimal
-cd star_align_pe_minimal
-
-echo ">> Run star_align on PE"
-"$meta_executable" \
-  --input "$meta_resources_dir/test_data/a_R1.1.fastq" \
-  --input "$meta_resources_dir/test_data/a_R1.2.fastq" \
-  --input_r2 "$meta_resources_dir/test_data/a_R2.1.fastq" \
-  --input_r2 "$meta_resources_dir/test_data/a_R2.2.fastq" \
-  --genomeDir "../index/" \
-  --aligned_reads "output.bam" \
-  --log "log.txt" \
-  --outReadsUnmapped "Fastx" \
-  --unmapped "unmapped.bam" \
-  --unmapped_r2 "unmapped_r2.bam" \
-  ${meta_cpus:+---cpus $meta_cpus}
-
-echo ">> Check if output exists"
-[ ! -f "output.bam" ] && echo ">> output.bam does not exist" && exit 1
-[ ! -f "log.txt" ] && echo ">> log.txt does not exist" && exit 1
-[ ! -f "unmapped.bam" ] && echo ">> unmapped.bam does not exist" && exit 1
-[ ! -f "unmapped_r2.bam" ] && echo ">> unmapped_r2.bam does not exist" && exit 1
-
-cd ..
-#########################################################################################
-
-# TODO: check whether optional outputs work: 
-#   - quantMode "TranscriptomeSAM;GeneCounts"
-#   - reads_per_gene "reads_per_gene.tsv"
-#   - chimOutType "Junctions"
-#   - chimeric_junctions "chimeric_junctions.tsv"
-#   - outSJtype Standard
-#   - splice_junctions "splice_junctions.tsv"
-# TODO: check whether output contents are correct
-
-echo "> Test successful"
+# #########################################################################################
+# mkdir star_align_pe_minimal
+# cd star_align_pe_minimal
+
+# echo ">> Run star_align on PE"
+# "$meta_executable" \
+#   --input "$meta_resources_dir/test_data/a_R1.1.fastq" \
+#   --input "$meta_resources_dir/test_data/a_R1.2.fastq" \
+#   --input_r2 "$meta_resources_dir/test_data/a_R2.1.fastq" \
+#   --input_r2 "$meta_resources_dir/test_data/a_R2.2.fastq" \
+#   --genomeDir "../index/" \
+#   --aligned_reads "output.sam" \
+#   --log "log.txt" \
+#   --outReadsUnmapped "Fastx" \
+#   --unmapped "unmapped.bam" \
+#   --unmapped_r2 "unmapped_r2.bam" \
+#   ${meta_cpus:+---cpus $meta_cpus}
+
+# echo ">> Check if output exists"
+# [ ! -f "output.sam" ] && echo ">> output.sam does not exist" && exit 1
+# [ ! -f "log.txt" ] && echo ">> log.txt does not exist" && exit 1
+# [ ! -f "unmapped.bam" ] && echo ">> unmapped.bam does not exist" && exit 1
+# [ ! -f "unmapped_r2.bam" ] && echo ">> unmapped_r2.bam does not exist" && exit 1
+
+# cd ..
+# #########################################################################################
+
+# # TODO: check whether optional outputs work: 
+# #   - quantMode "TranscriptomeSAM;GeneCounts"
+# #   - reads_per_gene "reads_per_gene.tsv"
+# #   - chimOutType "Junctions"
+# #   - chimeric_junctions "chimeric_junctions.tsv"
+# #   - outSJtype Standard
+# #   - splice_junctions "splice_junctions.tsv"
+# # TODO: check whether output contents are correct
+
+# echo "> Test successful"