diff --git a/Content.Benchmarks/DeviceNetworkingBenchmark.cs b/Content.Benchmarks/DeviceNetworkingBenchmark.cs
index 16805c2684f..bb2a22312ea 100644
--- a/Content.Benchmarks/DeviceNetworkingBenchmark.cs
+++ b/Content.Benchmarks/DeviceNetworkingBenchmark.cs
@@ -4,8 +4,8 @@
 using Content.IntegrationTests;
 using Content.IntegrationTests.Pair;
 using Content.IntegrationTests.Tests.DeviceNetwork;
-using Content.Server.DeviceNetwork;
 using Content.Server.DeviceNetwork.Systems;
+using Content.Shared.DeviceNetwork;
 using Robust.Shared;
 using Robust.Shared.Analyzers;
 using Robust.Shared.GameObjects;
diff --git a/Content.Client/Audio/BackgroundAudioSystem.cs b/Content.Client/Audio/BackgroundAudioSystem.cs
index 27b2dcb1b73..29279830627 100644
--- a/Content.Client/Audio/BackgroundAudioSystem.cs
+++ b/Content.Client/Audio/BackgroundAudioSystem.cs
@@ -25,8 +25,10 @@ public sealed class BackgroundAudioSystem : EntitySystem
     [Dependency] private readonly IStateManager _stateManager = default!;
 
     private readonly AudioParams _lobbyParams = new(-5f, 1, "Master", 0, 0, 0, true, 0f);
+    private readonly AudioParams _roundEndParams = new(-5f, 1, "Master", 0, 0, 0, false, 0f);
 
-    public EntityUid? LobbyStream;
+    public EntityUid? LobbyMusicStream;
+    public EntityUid? LobbyRoundRestartAudioStream;
 
     public override void Initialize()
     {
@@ -115,7 +117,7 @@ public void RestartLobbyMusic()
 
     public void StartLobbyMusic()
     {
-        if (LobbyStream != null || !_configManager.GetCVar(CCVars.LobbyMusicEnabled))
+        if (LobbyMusicStream != null || !_configManager.GetCVar(CCVars.LobbyMusicEnabled))
             return;
 
         var file = _gameTicker.LobbySong;
@@ -124,18 +126,21 @@ public void StartLobbyMusic()
             return;
         }
 
-        LobbyStream = _audio.PlayGlobal(file, Filter.Local(), false,
+        LobbyMusicStream = _audio.PlayGlobal(
+            file,
+            Filter.Local(),
+            false,
             _lobbyParams.WithVolume(_lobbyParams.Volume + SharedAudioSystem.GainToVolume(_configManager.GetCVar(CCVars.LobbyMusicVolume))))?.Entity;
     }
 
     private void EndLobbyMusic()
     {
-        LobbyStream = _audio.Stop(LobbyStream);
+        LobbyMusicStream = _audio.Stop(LobbyMusicStream);
     }
 
     private void PlayRestartSound(RoundRestartCleanupEvent ev)
     {
-        if (!_configManager.GetCVar(CCVars.LobbyMusicEnabled))
+        if (!_configManager.GetCVar(CCVars.RestartSoundsEnabled))
             return;
 
         var file = _gameTicker.RestartSound;
@@ -144,10 +149,11 @@ private void PlayRestartSound(RoundRestartCleanupEvent ev)
             return;
         }
 
-        var volume = _lobbyParams.WithVolume(_lobbyParams.Volume +
-                                             SharedAudioSystem.GainToVolume(
-                                                 _configManager.GetCVar(CCVars.LobbyMusicVolume)));
-
-        _audio.PlayGlobal(file, Filter.Local(), false, volume);
+        LobbyRoundRestartAudioStream = _audio.PlayGlobal(
+            file,
+            Filter.Local(),
+            false,
+            _roundEndParams.WithVolume(_roundEndParams.Volume + SharedAudioSystem.GainToVolume(_configManager.GetCVar(CCVars.LobbyMusicVolume)))
+        )?.Entity;
     }
 }
diff --git a/Content.Client/Audio/ContentAudioSystem.cs b/Content.Client/Audio/ContentAudioSystem.cs
index 7006524b9e6..6b89e5ccb9e 100644
--- a/Content.Client/Audio/ContentAudioSystem.cs
+++ b/Content.Client/Audio/ContentAudioSystem.cs
@@ -51,15 +51,24 @@ private void OnRoundCleanup(RoundRestartCleanupEvent ev)
         _fadingOut.Clear();
 
         // Preserve lobby music but everything else should get dumped.
-        var lobbyStream = EntityManager.System<BackgroundAudioSystem>().LobbyStream;
-        TryComp(lobbyStream, out AudioComponent? audioComp);
-        var oldGain = audioComp?.Gain;
+        var lobbyMusic = EntityManager.System<BackgroundAudioSystem>().LobbyMusicStream;
+        TryComp(lobbyMusic, out AudioComponent? lobbyMusicComp);
+        var oldMusicGain = lobbyMusicComp?.Gain;
+
+        var restartAudio = EntityManager.System<BackgroundAudioSystem>().LobbyRoundRestartAudioStream;
+        TryComp(restartAudio, out AudioComponent? restartComp);
+        var oldAudioGain = restartComp?.Gain;
 
         SilenceAudio();
 
-        if (oldGain != null)
+        if (oldMusicGain != null)
+        {
+            Audio.SetGain(lobbyMusic, oldMusicGain.Value, lobbyMusicComp);
+        }
+
+        if (oldAudioGain != null)
         {
-            Audio.SetGain(lobbyStream, oldGain.Value, audioComp);
+            Audio.SetGain(restartAudio, oldAudioGain.Value, restartComp);
         }
     }
 
diff --git a/Content.Client/CartridgeLoader/Cartridges/LogProbeUiEntry.xaml b/Content.Client/CartridgeLoader/Cartridges/LogProbeUiEntry.xaml
index 5712b301c38..598acf36e7a 100644
--- a/Content.Client/CartridgeLoader/Cartridges/LogProbeUiEntry.xaml
+++ b/Content.Client/CartridgeLoader/Cartridges/LogProbeUiEntry.xaml
@@ -4,16 +4,16 @@
               Orientation="Vertical">
     <BoxContainer Orientation="Horizontal">
         <Label Name="NumberLabel"
-               Align="Center"
-               SetWidth="60"
+               Align="Right"
+               SetWidth="26"
                ClipText="True"/>
         <Label Name="TimeLabel"
                Align="Center"
-               SetWidth="280"
+               SetWidth="100"
                ClipText="True"/>
         <Label Name="AccessorLabel"
-               Align="Center"
-               SetWidth="110"
+               Align="Left"
+               SetWidth="390"
                ClipText="True"/>
     </BoxContainer>
     <customControls:HSeparator Margin="0 5 0 5"/>
diff --git a/Content.Client/CartridgeLoader/Cartridges/LogProbeUiFragment.xaml b/Content.Client/CartridgeLoader/Cartridges/LogProbeUiFragment.xaml
index d369a33c6ce..d12fb55cdce 100644
--- a/Content.Client/CartridgeLoader/Cartridges/LogProbeUiFragment.xaml
+++ b/Content.Client/CartridgeLoader/Cartridges/LogProbeUiFragment.xaml
@@ -9,10 +9,10 @@
                               BorderColor="#5a5a5a"
                               BorderThickness="0 0 0 1"/>
         </PanelContainer.PanelOverride>
-        <BoxContainer Orientation="Horizontal" Align="Center" Margin="8">
-            <Label HorizontalExpand="True" Text="{Loc 'log-probe-label-number'}"/>
-            <Label HorizontalExpand="True" Text="{Loc 'log-probe-label-time'}"/>
-            <Label HorizontalExpand="True" Text="{Loc 'log-probe-label-accessor'}"/>
+        <BoxContainer Orientation="Horizontal" Margin="4 8">
+            <Label Align="Right" SetWidth="26" ClipText="True" Text="{Loc 'log-probe-label-number'}"/>
+            <Label Align="Center" SetWidth="100" ClipText="True" Text="{Loc 'log-probe-label-time'}"/>
+            <Label Align="Left" SetWidth="390" ClipText="True" Text="{Loc 'log-probe-label-accessor'}"/>
         </BoxContainer>
     </PanelContainer>
     <ScrollContainer VerticalExpand="True" HScrollEnabled="True">
diff --git a/Content.Client/Chat/UI/SpeechBubble.cs b/Content.Client/Chat/UI/SpeechBubble.cs
index 91e8e5a90f0..82eccbcec84 100644
--- a/Content.Client/Chat/UI/SpeechBubble.cs
+++ b/Content.Client/Chat/UI/SpeechBubble.cs
@@ -182,20 +182,9 @@ protected FormattedMessage FormatSpeech(string message, Color? fontColor = null)
             return msg;
         }
 
-        protected string ExtractSpeechSubstring(ChatMessage message, string tag)
-        {
-            var rawmsg = message.WrappedMessage;
-            var tagStart = rawmsg.IndexOf($"[{tag}]");
-            var tagEnd = rawmsg.IndexOf($"[/{tag}]");
-            if (tagStart < 0 || tagEnd < 0) //the above return -1 if the tag's not found, which in turn will cause the below to throw an exception. a blank speech bubble is far more noticeably broken than the bubble not appearing at all -bhijn
-                return "";
-            tagStart += tag.Length + 2;
-            return rawmsg.Substring(tagStart, tagEnd - tagStart);
-        }
-
         protected FormattedMessage ExtractAndFormatSpeechSubstring(ChatMessage message, string tag, Color? fontColor = null)
         {
-            return FormatSpeech(ExtractSpeechSubstring(message, tag), fontColor);
+            return FormatSpeech(SharedChatSystem.GetStringInsideTag(message, tag), fontColor);
         }
 
     }
diff --git a/Content.Client/CriminalRecords/CrimeHistoryWindow.xaml b/Content.Client/CriminalRecords/CrimeHistoryWindow.xaml
new file mode 100644
index 00000000000..358fade2e3c
--- /dev/null
+++ b/Content.Client/CriminalRecords/CrimeHistoryWindow.xaml
@@ -0,0 +1,15 @@
+<controls:FancyWindow xmlns="https://spacestation14.io"
+               xmlns:controls="clr-namespace:Content.Client.UserInterface.Controls"
+               Title="{Loc 'criminal-records-console-crime-history'}"
+               MinSize="660 400">
+    <BoxContainer Orientation="Vertical" HorizontalExpand="True" Margin="5">
+        <BoxContainer Name="Editing" Orientation="Horizontal" HorizontalExpand="True" Align="Center" Margin="5">
+            <Button Name="AddButton" Text="{Loc 'criminal-records-add-history'}"/>
+            <Button Name="DeleteButton" Text="{Loc 'criminal-records-delete-history'}" Disabled="True"/>
+        </BoxContainer>
+        <Label Name="NoHistory" Text="{Loc 'criminal-records-no-history'}" HorizontalExpand="True" HorizontalAlignment="Center"/>
+        <ScrollContainer VerticalExpand="True">
+            <ItemList Name="History"/> <!-- Populated when window opened -->
+        </ScrollContainer>
+    </BoxContainer>
+</controls:FancyWindow>
diff --git a/Content.Client/CriminalRecords/CrimeHistoryWindow.xaml.cs b/Content.Client/CriminalRecords/CrimeHistoryWindow.xaml.cs
new file mode 100644
index 00000000000..1c6e83a359f
--- /dev/null
+++ b/Content.Client/CriminalRecords/CrimeHistoryWindow.xaml.cs
@@ -0,0 +1,107 @@
+using Content.Shared.Administration;
+using Content.Shared.CriminalRecords;
+using Content.Client.UserInterface.Controls;
+using Robust.Client.AutoGenerated;
+using Robust.Client.UserInterface.XAML;
+
+namespace Content.Client.CriminalRecords;
+
+/// <summary>
+/// Window opened when Crime History button is pressed
+/// </summary>
+[GenerateTypedNameReferences]
+public sealed partial class CrimeHistoryWindow : FancyWindow
+{
+    public Action<string>? OnAddHistory;
+    public Action<uint>? OnDeleteHistory;
+
+    private uint _maxLength;
+    private uint? _index;
+    private DialogWindow? _dialog;
+
+    public CrimeHistoryWindow(uint maxLength)
+    {
+        RobustXamlLoader.Load(this);
+
+        _maxLength = maxLength;
+
+        OnClose += () =>
+        {
+            _dialog?.Close();
+            // deselect so when reopening the window it doesnt try to use invalid index
+            _index = null;
+        };
+
+        AddButton.OnPressed += _ =>
+        {
+            if (_dialog != null)
+            {
+                _dialog.MoveToFront();
+                return;
+            }
+
+            var field = "line";
+            var prompt = Loc.GetString("criminal-records-console-reason");
+            var placeholder = Loc.GetString("criminal-records-history-placeholder");
+            var entry = new QuickDialogEntry(field, QuickDialogEntryType.LongText, prompt, placeholder);
+            var entries = new List<QuickDialogEntry> { entry };
+            _dialog = new DialogWindow(Title!, entries);
+
+            _dialog.OnConfirmed += responses =>
+            {
+                var line = responses[field];
+                if (line.Length < 1 || line.Length > _maxLength)
+                    return;
+
+                OnAddHistory?.Invoke(line);
+                // adding deselects so prevent deleting yeah
+                _index = null;
+                DeleteButton.Disabled = true;
+            };
+
+            // prevent MoveToFront being called on a closed window and double closing
+            _dialog.OnClose += () => { _dialog = null; };
+        };
+        DeleteButton.OnPressed += _ =>
+        {
+            if (_index is not {} index)
+                return;
+
+            OnDeleteHistory?.Invoke(index);
+            // prevent total spam wiping
+            History.ClearSelected();
+            _index = null;
+            DeleteButton.Disabled = true;
+        };
+
+        History.OnItemSelected += args =>
+        {
+            _index = (uint) args.ItemIndex;
+            DeleteButton.Disabled = false;
+        };
+        History.OnItemDeselected += args =>
+        {
+            _index = null;
+            DeleteButton.Disabled = true;
+        };
+    }
+
+    public void UpdateHistory(CriminalRecord record, bool access)
+    {
+        History.Clear();
+        Editing.Visible = access;
+
+        NoHistory.Visible = record.History.Count == 0;
+
+        foreach (var entry in record.History)
+        {
+            var time = entry.AddTime;
+            var line = $"{time.Hours:00}:{time.Minutes:00}:{time.Seconds:00} - {entry.Crime}";
+            History.AddItem(line);
+        }
+
+        // deselect if something goes wrong
+        if (_index is {} index && record.History.Count >= index)
+            _index = null;
+    }
+}
diff --git a/Content.Client/CriminalRecords/CriminalRecordsConsoleBoundUserInterface.cs b/Content.Client/CriminalRecords/CriminalRecordsConsoleBoundUserInterface.cs
new file mode 100644
index 00000000000..88b9c90c2ff
--- /dev/null
+++ b/Content.Client/CriminalRecords/CriminalRecordsConsoleBoundUserInterface.cs
@@ -0,0 +1,81 @@
+using Content.Shared.Access.Systems;
+using Content.Shared.CriminalRecords;
+using Content.Shared.CriminalRecords.Components;
+using Content.Shared.Security;
+using Content.Shared.StationRecords;
+using Robust.Client.Player;
+using Robust.Shared.Prototypes;
+using Robust.Shared.Random;
+
+namespace Content.Client.CriminalRecords;
+
+public sealed class CriminalRecordsConsoleBoundUserInterface : BoundUserInterface
+{
+    [Dependency] private readonly IPrototypeManager _proto = default!;
+    [Dependency] private readonly IRobustRandom _random = default!;
+    [Dependency] private readonly IPlayerManager _playerManager = default!;
+    private readonly AccessReaderSystem _accessReader;
+
+    private CriminalRecordsConsoleWindow? _window;
+    private CrimeHistoryWindow? _historyWindow;
+
+    public CriminalRecordsConsoleBoundUserInterface(EntityUid owner, Enum uiKey) : base(owner, uiKey)
+    {
+        _accessReader = EntMan.System<AccessReaderSystem>();
+    }
+
+    protected override void Open()
+    {
+        base.Open();
+
+        var comp = EntMan.GetComponent<CriminalRecordsConsoleComponent>(Owner);
+
+        _window = new(Owner, comp.MaxStringLength, _playerManager, _proto, _random, _accessReader);
+        _window.OnKeySelected += key =>
+            SendMessage(new SelectStationRecord(key));
+        _window.OnFiltersChanged += (type, filterValue) =>
+            SendMessage(new SetStationRecordFilter(type, filterValue));
+        _window.OnStatusSelected += status =>
+            SendMessage(new CriminalRecordChangeStatus(status, null));
+        _window.OnDialogConfirmed += (_, reason) =>
+            SendMessage(new CriminalRecordChangeStatus(SecurityStatus.Wanted, reason));
+        _window.OnHistoryUpdated += UpdateHistory;
+        _window.OnHistoryClosed += () => _historyWindow?.Close();
+        _window.OnClose += Close;
+
+        _historyWindow = new(comp.MaxStringLength);
+        _historyWindow.OnAddHistory += line => SendMessage(new CriminalRecordAddHistory(line));
+        _historyWindow.OnDeleteHistory += index => SendMessage(new CriminalRecordDeleteHistory(index));
+
+        _historyWindow.Close(); // leave closed until user opens it
+    }
+
+    /// <summary>
+    /// Updates or opens a new history window.
+    /// </summary>
+    private void UpdateHistory(CriminalRecord record, bool access, bool open)
+    {
+        _historyWindow!.UpdateHistory(record, access);
+
+        if (open)
+            _historyWindow.OpenCentered();
+    }
+
+    protected override void UpdateState(BoundUserInterfaceState state)
+    {
+        base.UpdateState(state);
+
+        if (state is not CriminalRecordsConsoleState cast)
+            return;
+
+        _window?.UpdateState(cast);
+    }
+
+    protected override void Dispose(bool disposing)
+    {
+        base.Dispose(disposing);
+
+        _window?.Close();
+        _historyWindow?.Close();
+    }
+}
diff --git a/Content.Client/CriminalRecords/CriminalRecordsConsoleWindow.xaml b/Content.Client/CriminalRecords/CriminalRecordsConsoleWindow.xaml
new file mode 100644
index 00000000000..77da0ba1b06
--- /dev/null
+++ b/Content.Client/CriminalRecords/CriminalRecordsConsoleWindow.xaml
@@ -0,0 +1,37 @@
+<controls:FancyWindow xmlns="https://spacestation14.io"
+               xmlns:controls="clr-namespace:Content.Client.UserInterface.Controls"
+               Title="{Loc 'criminal-records-console-window-title'}"
+               MinSize="660 400">
+    <BoxContainer Orientation="Vertical">
+        <!-- Record search bar
+             TODO: make this into a control shared with general records -->
+        <BoxContainer Margin="5 5 5 10" HorizontalExpand="true" VerticalAlignment="Center">
+            <OptionButton Name="FilterType" MinWidth="200" Margin="0 0 10 0"/> <!-- Populated in constructor -->
+            <LineEdit Name="FilterText" PlaceHolder="{Loc 'criminal-records-filter-placeholder'}" HorizontalExpand="True"/>
+        </BoxContainer>
+        <BoxContainer Orientation="Horizontal" VerticalExpand="True">
+            <!-- Record listing -->
+            <BoxContainer Orientation="Vertical" Margin="5" MinWidth="250" MaxWidth="250">
+                <Label Name="RecordListingTitle" Text="{Loc 'criminal-records-console-records-list-title'}" HorizontalExpand="True" Align="Center"/>
+                <Label Name="NoRecords" Text="{Loc 'criminal-records-console-no-records'}" HorizontalExpand="True" Align="Center" FontColorOverride="DarkGray"/>
+                <ScrollContainer VerticalExpand="True">
+                    <ItemList Name="RecordListing"/> <!-- Populated when loading state -->
+                </ScrollContainer>
+            </BoxContainer>
+            <Label Name="RecordUnselected" Text="{Loc 'criminal-records-console-select-record-info'}" HorizontalExpand="True" Align="Center" FontColorOverride="DarkGray"/>
+            <!-- Selected record info -->
+            <BoxContainer Name="PersonContainer" Orientation="Vertical" Margin="5" Visible="False">
+                <Label Name="PersonName" StyleClasses="LabelBig"/>
+                <Label Name="PersonPrints"/>
+                <Label Name="PersonDna"/>
+                <PanelContainer StyleClasses="LowDivider" Margin="0 5 0 5" />
+                <BoxContainer Orientation="Horizontal" Margin="5 5 5 5">
+                    <Label Name="StatusLabel" Text="{Loc 'criminal-records-console-status'}" FontColorOverride="DarkGray"/>
+                    <OptionButton Name="StatusOptionButton"/> <!-- Populated in constructor -->
+                </BoxContainer>
+                <RichTextLabel Name="WantedReason" Visible="False"/>
+                <Button Name="HistoryButton" Text="{Loc 'criminal-records-console-crime-history'}"/>
+            </BoxContainer>
+        </BoxContainer>
+    </BoxContainer>
+</controls:FancyWindow>
diff --git a/Content.Client/CriminalRecords/CriminalRecordsConsoleWindow.xaml.cs b/Content.Client/CriminalRecords/CriminalRecordsConsoleWindow.xaml.cs
new file mode 100644
index 00000000000..61b5c383315
--- /dev/null
+++ b/Content.Client/CriminalRecords/CriminalRecordsConsoleWindow.xaml.cs
@@ -0,0 +1,264 @@
+using Content.Client.UserInterface.Controls;
+using Content.Shared.Access.Systems;
+using Content.Shared.Administration;
+using Content.Shared.CriminalRecords;
+using Content.Shared.Dataset;
+using Content.Shared.Security;
+using Content.Shared.StationRecords;
+using Robust.Client.AutoGenerated;
+using Robust.Client.Player;
+using Robust.Client.UserInterface.XAML;
+using Robust.Shared.Prototypes;
+using Robust.Shared.Random;
+using Robust.Shared.Utility;
+
+namespace Content.Client.CriminalRecords;
+
+// TODO: dedupe shitcode from general records theres a lot
+[GenerateTypedNameReferences]
+public sealed partial class CriminalRecordsConsoleWindow : FancyWindow
+{
+    private readonly IPlayerManager _player;
+    private readonly IPrototypeManager _proto;
+    private readonly IRobustRandom _random;
+    private readonly AccessReaderSystem _accessReader;
+
+    public readonly EntityUid Console;
+
+    [ValidatePrototypeId<DatasetPrototype>]
+    private const string ReasonPlaceholders = "CriminalRecordsWantedReasonPlaceholders";
+
+    public Action<uint?>? OnKeySelected;
+    public Action<StationRecordFilterType, string>? OnFiltersChanged;
+    public Action<SecurityStatus>? OnStatusSelected;
+    public Action<CriminalRecord, bool, bool>? OnHistoryUpdated;
+    public Action? OnHistoryClosed;
+    public Action<SecurityStatus, string>? OnDialogConfirmed;
+
+    private uint _maxLength;
+    private bool _isPopulating;
+    private bool _access;
+    private uint? _selectedKey;
+    private CriminalRecord? _selectedRecord;
+
+    private DialogWindow? _reasonDialog;
+
+    private StationRecordFilterType _currentFilterType;
+
+    public CriminalRecordsConsoleWindow(EntityUid console, uint maxLength, IPlayerManager playerManager, IPrototypeManager prototypeManager, IRobustRandom robustRandom, AccessReaderSystem accessReader)
+    {
+        RobustXamlLoader.Load(this);
+
+        Console = console;
+        _player = playerManager;
+        _proto = prototypeManager;
+        _random = robustRandom;
+        _accessReader = accessReader;
+
+        _maxLength = maxLength;
+        _currentFilterType = StationRecordFilterType.Name;
+
+        OpenCentered();
+
+        foreach (var item in Enum.GetValues<StationRecordFilterType>())
+        {
+            FilterType.AddItem(GetTypeFilterLocals(item), (int)item);
+        }
+
+        foreach (var status in Enum.GetValues<SecurityStatus>())
+        {
+            AddStatusSelect(status);
+        }
+
+        OnClose += () => _reasonDialog?.Close();
+
+        RecordListing.OnItemSelected += args =>
+        {
+            if (_isPopulating || RecordListing[args.ItemIndex].Metadata is not uint cast)
+                return;
+
+            OnKeySelected?.Invoke(cast);
+        };
+
+        RecordListing.OnItemDeselected += _ =>
+        {
+            if (!_isPopulating)
+                OnKeySelected?.Invoke(null);
+        };
+
+        FilterType.OnItemSelected += eventArgs =>
+        {
+            var type = (StationRecordFilterType)eventArgs.Id;
+
+            if (_currentFilterType != type)
+            {
+                _currentFilterType = type;
+                FilterListingOfRecords(FilterText.Text);
+            }
+        };
+
+        FilterText.OnTextEntered += args =>
+        {
+            FilterListingOfRecords(args.Text);
+        };
+
+        StatusOptionButton.OnItemSelected += args =>
+        {
+            SetStatus((SecurityStatus) args.Id);
+        };
+
+        HistoryButton.OnPressed += _ =>
+        {
+            if (_selectedRecord is {} record)
+                OnHistoryUpdated?.Invoke(record, _access, true);
+        };
+    }
+
+    public void UpdateState(CriminalRecordsConsoleState state)
+    {
+        if (state.Filter != null)
+        {
+            if (state.Filter.Type != _currentFilterType)
+            {
+                _currentFilterType = state.Filter.Type;
+            }
+
+            if (state.Filter.Value != FilterText.Text)
+            {
+                FilterText.Text = state.Filter.Value;
+            }
+        }
+
+        _selectedKey = state.SelectedKey;
+
+        FilterType.SelectId((int)_currentFilterType);
+
+        // set up the records listing panel
+        RecordListing.Clear();
+
+        var hasRecords = state.RecordListing != null && state.RecordListing.Count > 0;
+        NoRecords.Visible = !hasRecords;
+        if (hasRecords)
+            PopulateRecordListing(state.RecordListing!);
+
+        // set up the selected person's record
+        var selected = _selectedKey != null;
+
+        PersonContainer.Visible = selected;
+        RecordUnselected.Visible = !selected;
+
+        _access = _player.LocalSession?.AttachedEntity is {} player
+            && _accessReader.IsAllowed(player, Console);
+
+        // hide access-required editing parts when no access
+        var editing = _access && selected;
+        StatusOptionButton.Disabled = !editing;
+
+        if (state is { CriminalRecord: not null, StationRecord: not null })
+        {
+            PopulateRecordContainer(state.StationRecord, state.CriminalRecord);
+            OnHistoryUpdated?.Invoke(state.CriminalRecord, _access, false);
+            _selectedRecord = state.CriminalRecord;
+        }
+        else
+        {
+            _selectedRecord = null;
+            OnHistoryClosed?.Invoke();
+        }
+    }
+
+    private void PopulateRecordListing(Dictionary<uint, string> listing)
+    {
+        _isPopulating = true;
+
+        foreach (var (key, name) in listing)
+        {
+            var item = RecordListing.AddItem(name);
+            item.Metadata = key;
+            item.Selected = key == _selectedKey;
+        }
+        _isPopulating = false;
+
+        RecordListing.SortItemsByText();
+    }
+
+    private void PopulateRecordContainer(GeneralStationRecord stationRecord, CriminalRecord criminalRecord)
+    {
+        var na = Loc.GetString("generic-not-available-shorthand");
+        PersonName.Text = stationRecord.Name;
+        PersonPrints.Text = Loc.GetString("general-station-record-console-record-fingerprint", ("fingerprint", stationRecord.Fingerprint ?? na));
+        PersonDna.Text = Loc.GetString("general-station-record-console-record-dna", ("dna", stationRecord.DNA ?? na));
+
+        StatusOptionButton.SelectId((int) criminalRecord.Status);
+        if (criminalRecord.Reason is {} reason)
+        {
+            var message = FormattedMessage.FromMarkup(Loc.GetString("criminal-records-console-wanted-reason"));
+            message.AddText($": {reason}");
+            WantedReason.SetMessage(message);
+            WantedReason.Visible = true;
+        }
+        else
+        {
+            WantedReason.Visible = false;
+        }
+    }
+
+    private void AddStatusSelect(SecurityStatus status)
+    {
+        var name = Loc.GetString($"criminal-records-status-{status.ToString().ToLower()}");
+        StatusOptionButton.AddItem(name, (int)status);
+    }
+
+    private void FilterListingOfRecords(string text = "")
+    {
+        if (!_isPopulating)
+        {
+            OnFiltersChanged?.Invoke(_currentFilterType, text);
+        }
+    }
+
+    private void SetStatus(SecurityStatus status)
+    {
+        if (status == SecurityStatus.Wanted)
+        {
+            GetWantedReason();
+            return;
+        }
+
+        OnStatusSelected?.Invoke(status);
+    }
+
+    private void GetWantedReason()
+    {
+        if (_reasonDialog != null)
+        {
+            _reasonDialog.MoveToFront();
+            return;
+        }
+
+        var field = "reason";
+        var title = Loc.GetString("criminal-records-status-wanted");
+        var placeholders = _proto.Index<DatasetPrototype>(ReasonPlaceholders);
+        var placeholder = Loc.GetString("criminal-records-console-reason-placeholder", ("placeholder", _random.Pick(placeholders.Values))); // just funny it doesn't actually get used
+        var prompt = Loc.GetString("criminal-records-console-reason");
+        var entry = new QuickDialogEntry(field, QuickDialogEntryType.LongText, prompt, placeholder);
+        var entries = new List<QuickDialogEntry>() { entry };
+        _reasonDialog = new DialogWindow(title, entries);
+
+        _reasonDialog.OnConfirmed += responses =>
+        {
+            var reason = responses[field];
+            if (reason.Length < 1 || reason.Length > _maxLength)
+                return;
+
+            OnDialogConfirmed?.Invoke(SecurityStatus.Wanted, reason);
+        };
+
+        _reasonDialog.OnClose += () => { _reasonDialog = null; };
+    }
+
+    private string GetTypeFilterLocals(StationRecordFilterType type)
+    {
+        return Loc.GetString($"criminal-records-{type.ToString().ToLower()}-filter");
+    }
+}
diff --git a/Content.Client/CriminalRecords/Systems/CriminalRecordsConsoleSystem.cs b/Content.Client/CriminalRecords/Systems/CriminalRecordsConsoleSystem.cs
new file mode 100644
index 00000000000..2a34376f6a6
--- /dev/null
+++ b/Content.Client/CriminalRecords/Systems/CriminalRecordsConsoleSystem.cs
@@ -0,0 +1,7 @@
+using Content.Shared.CriminalRecords.Systems;
+
+namespace Content.Client.CriminalRecords.Systems;
+
+public sealed class CriminalRecordsConsoleSystem : SharedCriminalRecordsConsoleSystem
+{
+}
diff --git a/Content.Client/DeviceLinking/DeviceLinkSystem.cs b/Content.Client/DeviceLinking/DeviceLinkSystem.cs
new file mode 100644
index 00000000000..3356e346f6a
--- /dev/null
+++ b/Content.Client/DeviceLinking/DeviceLinkSystem.cs
@@ -0,0 +1,8 @@
+using Content.Shared.DeviceLinking;
+
+namespace Content.Client.DeviceLinking;
+
+public sealed class DeviceLinkSystem : SharedDeviceLinkSystem
+{
+
+}
diff --git a/Content.Client/GameTicking/Managers/ClientGameTicker.cs b/Content.Client/GameTicking/Managers/ClientGameTicker.cs
index a33a7a8e722..1154dca350c 100644
--- a/Content.Client/GameTicking/Managers/ClientGameTicker.cs
+++ b/Content.Client/GameTicking/Managers/ClientGameTicker.cs
@@ -20,8 +20,6 @@ public sealed class ClientGameTicker : SharedGameTicker
     {
         [Dependency] private readonly IStateManager _stateManager = default!;
         [Dependency] private readonly IEntityManager _entityManager = default!;
-        [Dependency] private readonly IConfigurationManager _configManager = default!;
-        [Dependency] private readonly SharedAudioSystem _audio = default!;
 
         [ViewVariables] private bool _initialized;
         private Dictionary<NetEntity, Dictionary<string, uint?>>  _jobsAvailable = new();
diff --git a/Content.Client/Guidebook/Controls/GuidebookWindow.xaml.cs b/Content.Client/Guidebook/Controls/GuidebookWindow.xaml.cs
index 113c192beb9..4776386c1dd 100644
--- a/Content.Client/Guidebook/Controls/GuidebookWindow.xaml.cs
+++ b/Content.Client/Guidebook/Controls/GuidebookWindow.xaml.cs
@@ -98,22 +98,33 @@ public void UpdateGuides(
         }
     }
 
-    private IEnumerable<GuideEntry> GetSortedRootEntries(List<string>? rootEntries)
+    private IEnumerable<GuideEntry> GetSortedEntries(List<string>? rootEntries)
     {
         if (rootEntries == null)
         {
             HashSet<string> entries = new(_entries.Keys);
             foreach (var entry in _entries.Values)
             {
+                if (entry.Children.Count > 0)
+                {
+                    var sortedChildren = entry.Children
+                        .Select(childId => _entries[childId])
+                        .OrderBy(childEntry => childEntry.Priority)
+                        .ThenBy(childEntry => Loc.GetString(childEntry.Name))
+                        .Select(childEntry => childEntry.Id)
+                        .ToList();
+
+                    entry.Children = sortedChildren;
+                }
                 entries.ExceptWith(entry.Children);
             }
             rootEntries = entries.ToList();
         }
 
         return rootEntries
-            .Select(x => _entries[x])
-            .OrderBy(x => x.Priority)
-            .ThenBy(x => Loc.GetString(x.Name));
+            .Select(rootEntryId => _entries[rootEntryId])
+            .OrderBy(rootEntry => rootEntry.Priority)
+            .ThenBy(rootEntry => Loc.GetString(rootEntry.Name));
     }
 
     private void RepopulateTree(List<string>? roots = null, string? forcedRoot = null)
@@ -123,7 +134,7 @@ private void RepopulateTree(List<string>? roots = null, string? forcedRoot = nul
         HashSet<string> addedEntries = new();
 
         TreeItem? parent = forcedRoot == null ? null : AddEntry(forcedRoot, null, addedEntries);
-        foreach (var entry in GetSortedRootEntries(roots))
+        foreach (var entry in GetSortedEntries(roots))
         {
             AddEntry(entry.Id, parent, addedEntries);
         }
diff --git a/Content.Client/HealthAnalyzer/UI/HealthAnalyzerWindow.xaml b/Content.Client/HealthAnalyzer/UI/HealthAnalyzerWindow.xaml
index b78c3c6a567..28872ef1d5d 100644
--- a/Content.Client/HealthAnalyzer/UI/HealthAnalyzerWindow.xaml
+++ b/Content.Client/HealthAnalyzer/UI/HealthAnalyzerWindow.xaml
@@ -1,4 +1,6 @@
-<DefaultWindow xmlns="https://spacestation14.io"
+<controls:FancyWindow
+    xmlns="https://spacestation14.io"
+    xmlns:controls="clr-namespace:Content.Client.UserInterface.Controls"
     SetSize="250 100">
     <ScrollContainer
         VerticalExpand="True">
@@ -12,6 +14,16 @@
                 Name="PatientDataContainer"
                 Orientation="Vertical"
                 Margin="0 0 5 10">
+                <BoxContainer Name="ScanModePanel" HorizontalExpand="True" Visible="False" Margin="0 5 0 0">
+                    <Label
+                    Name="ScanMode"
+                    Align="Left"
+                    Text="{Loc health-analyzer-window-scan-mode-text}"/>
+                    <Label
+                    Name="ScanModeText"
+                    Align="Right"
+                    HorizontalExpand="True"/>
+                </BoxContainer>
                 <Label
                     Name="PatientName"/>
                 <Label
@@ -30,4 +42,4 @@
             </BoxContainer>
         </BoxContainer>
     </ScrollContainer>
-</DefaultWindow>
\ No newline at end of file
+</controls:FancyWindow>
diff --git a/Content.Client/HealthAnalyzer/UI/HealthAnalyzerWindow.xaml.cs b/Content.Client/HealthAnalyzer/UI/HealthAnalyzerWindow.xaml.cs
index 588eb88502e..2f19cd0a050 100644
--- a/Content.Client/HealthAnalyzer/UI/HealthAnalyzerWindow.xaml.cs
+++ b/Content.Client/HealthAnalyzer/UI/HealthAnalyzerWindow.xaml.cs
@@ -1,5 +1,6 @@
 using System.Linq;
 using System.Numerics;
+using Content.Client.UserInterface.Controls;
 using Content.Shared.Damage;
 using Content.Shared.Damage.Prototypes;
 using Content.Shared.FixedPoint;
@@ -7,7 +8,6 @@
 using Content.Shared.MedicalScanner;
 using Content.Shared.Nutrition.Components;
 using Robust.Client.AutoGenerated;
-using Robust.Client.UserInterface.CustomControls;
 using Robust.Client.UserInterface.XAML;
 using Robust.Client.GameObjects;
 using Robust.Client.Graphics;
@@ -20,7 +20,7 @@
 namespace Content.Client.HealthAnalyzer.UI
 {
     [GenerateTypedNameReferences]
-    public sealed partial class HealthAnalyzerWindow : DefaultWindow
+    public sealed partial class HealthAnalyzerWindow : FancyWindow
     {
         private readonly IEntityManager _entityManager;
         private readonly SpriteSystem _spriteSystem;
@@ -62,6 +62,17 @@ public void Populate(HealthAnalyzerScannedUserMessage msg)
                 entityName = Identity.Name(target.Value, _entityManager);
             }
 
+            if (msg.ScanMode.HasValue)
+            {
+                ScanModePanel.Visible = true;
+                ScanModeText.Text = Loc.GetString(msg.ScanMode.Value ? "health-analyzer-window-scan-mode-active" : "health-analyzer-window-scan-mode-inactive");
+                ScanModeText.FontColorOverride = msg.ScanMode.Value ? Color.Green : Color.Red;
+            }
+            else
+            {
+                ScanModePanel.Visible = false;
+            }
+
             PatientName.Text = Loc.GetString(
                 "health-analyzer-window-entity-health-text",
                 ("entityName", entityName)
diff --git a/Content.Client/Options/UI/Tabs/MiscTab.xaml b/Content.Client/Options/UI/Tabs/MiscTab.xaml
index db176db456c..fc94ab7b0a6 100644
--- a/Content.Client/Options/UI/Tabs/MiscTab.xaml
+++ b/Content.Client/Options/UI/Tabs/MiscTab.xaml
@@ -22,6 +22,7 @@
                    FontColorOverride="{xNamespace:Static s:StyleNano.NanoGold}"
                    StyleClasses="LabelKeyText"/>
             <CheckBox Name="ReducedMotionCheckBox" Text="{Loc 'ui-options-reduced-motion'}" />
+            <CheckBox Name="EnableColorNameCheckBox" Text="{Loc 'ui-options-enable-color-name'}" />
             <BoxContainer Orientation="Horizontal">
                 <Label Text="{Loc 'ui-options-screen-shake-intensity'}" Margin="8 0" />
                 <Slider Name="ScreenShakeIntensitySlider"
diff --git a/Content.Client/Options/UI/Tabs/MiscTab.xaml.cs b/Content.Client/Options/UI/Tabs/MiscTab.xaml.cs
index b5dcf6477b7..d7a600dd79d 100644
--- a/Content.Client/Options/UI/Tabs/MiscTab.xaml.cs
+++ b/Content.Client/Options/UI/Tabs/MiscTab.xaml.cs
@@ -63,6 +63,7 @@ public MiscTab()
             OpaqueStorageWindowCheckBox.OnToggled += OnCheckBoxToggled;
             FancySpeechBubblesCheckBox.OnToggled += OnCheckBoxToggled;
             FancyNameBackgroundsCheckBox.OnToggled += OnCheckBoxToggled;
+            EnableColorNameCheckBox.OnToggled += OnCheckBoxToggled;
             ReducedMotionCheckBox.OnToggled += OnCheckBoxToggled;
             ScreenShakeIntensitySlider.OnValueChanged += OnScreenShakeIntensitySliderChanged;
             // ToggleWalk.OnToggled += OnCheckBoxToggled;
@@ -76,6 +77,7 @@ public MiscTab()
             OpaqueStorageWindowCheckBox.Pressed = _cfg.GetCVar(CCVars.OpaqueStorageWindow);
             FancySpeechBubblesCheckBox.Pressed = _cfg.GetCVar(CCVars.ChatEnableFancyBubbles);
             FancyNameBackgroundsCheckBox.Pressed = _cfg.GetCVar(CCVars.ChatFancyNameBackground);
+            EnableColorNameCheckBox.Pressed = _cfg.GetCVar(CCVars.ChatEnableColorName);
             ReducedMotionCheckBox.Pressed = _cfg.GetCVar(CCVars.ReducedMotion);
             ScreenShakeIntensitySlider.Value = _cfg.GetCVar(CCVars.ScreenShakeIntensity) * 100f;
             // ToggleWalk.Pressed = _cfg.GetCVar(CCVars.ToggleWalk);
@@ -120,6 +122,7 @@ private void OnApplyButtonPressed(BaseButton.ButtonEventArgs args)
             _cfg.SetCVar(CCVars.LoocAboveHeadShow, ShowLoocAboveHeadCheckBox.Pressed);
             _cfg.SetCVar(CCVars.ChatEnableFancyBubbles, FancySpeechBubblesCheckBox.Pressed);
             _cfg.SetCVar(CCVars.ChatFancyNameBackground, FancyNameBackgroundsCheckBox.Pressed);
+            _cfg.SetCVar(CCVars.ChatEnableColorName, EnableColorNameCheckBox.Pressed);
             _cfg.SetCVar(CCVars.ReducedMotion, ReducedMotionCheckBox.Pressed);
             _cfg.SetCVar(CCVars.ScreenShakeIntensity, ScreenShakeIntensitySlider.Value / 100f);
             // _cfg.SetCVar(CCVars.ToggleWalk, ToggleWalk.Pressed);
@@ -145,6 +148,7 @@ private void UpdateApplyButton()
             var isLoocShowSame = ShowLoocAboveHeadCheckBox.Pressed == _cfg.GetCVar(CCVars.LoocAboveHeadShow);
             var isFancyChatSame = FancySpeechBubblesCheckBox.Pressed == _cfg.GetCVar(CCVars.ChatEnableFancyBubbles);
             var isFancyBackgroundSame = FancyNameBackgroundsCheckBox.Pressed == _cfg.GetCVar(CCVars.ChatFancyNameBackground);
+            var isEnableColorNameSame = EnableColorNameCheckBox.Pressed == _cfg.GetCVar(CCVars.ChatEnableColorName);
             var isReducedMotionSame = ReducedMotionCheckBox.Pressed == _cfg.GetCVar(CCVars.ReducedMotion);
             var isScreenShakeIntensitySame = Math.Abs(ScreenShakeIntensitySlider.Value / 100f - _cfg.GetCVar(CCVars.ScreenShakeIntensity)) < 0.01f;
             // var isToggleWalkSame = ToggleWalk.Pressed == _cfg.GetCVar(CCVars.ToggleWalk);
@@ -159,6 +163,7 @@ private void UpdateApplyButton()
                                    isLoocShowSame &&
                                    isFancyChatSame &&
                                    isFancyBackgroundSame &&
+                                   isEnableColorNameSame &&
                                    isReducedMotionSame &&
                                    isScreenShakeIntensitySame &&
                                    // isToggleWalkSame &&
diff --git a/Content.Client/Pointing/Components/PointingArrowComponent.cs b/Content.Client/Pointing/Components/PointingArrowComponent.cs
index 0d3bc4a5cc2..4156f84aac7 100644
--- a/Content.Client/Pointing/Components/PointingArrowComponent.cs
+++ b/Content.Client/Pointing/Components/PointingArrowComponent.cs
@@ -1,19 +1,12 @@
-using System.Numerics;
 using Content.Shared.Pointing.Components;
+using System.Numerics;
 
 namespace Content.Client.Pointing.Components;
 [RegisterComponent]
 public sealed partial class PointingArrowComponent : SharedPointingArrowComponent
 {
     /// <summary>
-    /// How long it takes to go from the bottom of the animation to the top.
-    /// </summary>
-    [ViewVariables(VVAccess.ReadWrite)]
-    [DataField("animationTime")]
-    public float AnimationTime = 0.5f;
-
-    /// <summary>
-    /// How far it goes in any direction.
+    /// How far the arrow moves up and down during the floating phase.
     /// </summary>
     [ViewVariables(VVAccess.ReadWrite)]
     [DataField("offset")]
diff --git a/Content.Client/Pointing/PointingSystem.Visualizer.cs b/Content.Client/Pointing/PointingSystem.Visualizer.cs
new file mode 100644
index 00000000000..63ce882e060
--- /dev/null
+++ b/Content.Client/Pointing/PointingSystem.Visualizer.cs
@@ -0,0 +1,62 @@
+using Content.Client.Pointing.Components;
+using Content.Shared.Pointing;
+using Robust.Client.GameObjects;
+using Robust.Client.Animations;
+using Robust.Shared.Animations;
+using System.Numerics;
+
+namespace Content.Client.Pointing;
+
+public sealed partial class PointingSystem : SharedPointingSystem
+{
+    [Dependency] private readonly AnimationPlayerSystem _animationPlayer = default!;
+
+    public void InitializeVisualizer()
+    {
+        SubscribeLocalEvent<PointingArrowComponent, AnimationCompletedEvent>(OnAnimationCompleted);
+    }
+
+    private void OnAnimationCompleted(EntityUid uid, PointingArrowComponent component, AnimationCompletedEvent args)
+    {
+        if (args.Key == component.AnimationKey)
+            _animationPlayer.Stop(uid, component.AnimationKey);
+    }
+
+    private void BeginPointAnimation(EntityUid uid, Vector2 startPosition, Vector2 offset, string animationKey)
+    {
+        if (_animationPlayer.HasRunningAnimation(uid, animationKey))
+            return;
+
+        var animation = new Animation
+        {
+            Length = PointDuration,
+            AnimationTracks =
+            {
+                new AnimationTrackComponentProperty
+                {
+                    ComponentType = typeof(SpriteComponent),
+                    Property = nameof(SpriteComponent.Offset),
+                    InterpolationMode = AnimationInterpolationMode.Cubic,
+                    KeyFrames =
+                    {
+                        // We pad here to prevent improper looping and tighten the overshoot, just a touch
+                        new AnimationTrackProperty.KeyFrame(startPosition, 0f),
+                        new AnimationTrackProperty.KeyFrame(Vector2.Lerp(startPosition, offset, 0.9f), PointKeyTimeMove),
+                        new AnimationTrackProperty.KeyFrame(offset, PointKeyTimeMove),
+                        new AnimationTrackProperty.KeyFrame(Vector2.Zero, PointKeyTimeMove),
+                        new AnimationTrackProperty.KeyFrame(offset, PointKeyTimeHover),
+                        new AnimationTrackProperty.KeyFrame(Vector2.Zero, PointKeyTimeHover),
+                        new AnimationTrackProperty.KeyFrame(offset, PointKeyTimeHover),
+                        new AnimationTrackProperty.KeyFrame(Vector2.Zero, PointKeyTimeHover),
+                        new AnimationTrackProperty.KeyFrame(offset, PointKeyTimeHover),
+                        new AnimationTrackProperty.KeyFrame(Vector2.Zero, PointKeyTimeHover),
+                        new AnimationTrackProperty.KeyFrame(offset, PointKeyTimeHover),
+                        new AnimationTrackProperty.KeyFrame(Vector2.Zero, PointKeyTimeHover),
+                    }
+                }
+            }
+        };
+
+        _animationPlayer.Play(uid, animation, animationKey);
+    }
+}
diff --git a/Content.Client/Pointing/PointingSystem.cs b/Content.Client/Pointing/PointingSystem.cs
index 82b12fbf36a..a86b6e21b52 100644
--- a/Content.Client/Pointing/PointingSystem.cs
+++ b/Content.Client/Pointing/PointingSystem.cs
@@ -1,32 +1,25 @@
 using Content.Client.Pointing.Components;
-using Content.Client.Gravity;
-using Content.Shared.Mobs.Systems;
 using Content.Shared.Pointing;
 using Content.Shared.Verbs;
 using Robust.Client.GameObjects;
+using Robust.Shared.GameStates;
 using Robust.Shared.Utility;
 using DrawDepth = Content.Shared.DrawDepth.DrawDepth;
 
 namespace Content.Client.Pointing;
 
-public sealed class PointingSystem : SharedPointingSystem
+public sealed partial class PointingSystem : SharedPointingSystem
 {
-    [Dependency] private readonly MobStateSystem _mobState = default!;
-    [Dependency] private readonly FloatingVisualizerSystem _floatingSystem = default!;
-
     public override void Initialize()
     {
         base.Initialize();
 
         SubscribeLocalEvent<GetVerbsEvent<Verb>>(AddPointingVerb);
         SubscribeLocalEvent<PointingArrowComponent, ComponentStartup>(OnArrowStartup);
-        SubscribeLocalEvent<PointingArrowComponent, AnimationCompletedEvent>(OnArrowAnimation);
         SubscribeLocalEvent<RoguePointingArrowComponent, ComponentStartup>(OnRogueArrowStartup);
-    }
+        SubscribeLocalEvent<PointingArrowComponent, ComponentHandleState>(HandleCompState);
 
-    private void OnArrowAnimation(EntityUid uid, PointingArrowComponent component, AnimationCompletedEvent args)
-    {
-        _floatingSystem.FloatAnimation(uid, component.Offset, component.AnimationKey, component.AnimationTime);
+        InitializeVisualizer();
     }
 
     private void AddPointingVerb(GetVerbsEvent<Verb> args)
@@ -38,15 +31,11 @@ private void AddPointingVerb(GetVerbsEvent<Verb> args)
         // I'm just adding this verb exclusively to clients so that the verb-loading pop-in on the verb menu isn't
         // as bad. Important for this verb seeing as its usually an option on just about any entity.
 
+        // this is a pointing arrow. no pointing here...
         if (HasComp<PointingArrowComponent>(args.Target))
-        {
-            // this is a pointing arrow. no pointing here...
             return;
-        }
 
-        // Can the user point? Checking mob state directly instead of some action blocker, as many action blockers are blocked for
-        // ghosts and there is no obvious choice for pointing (unless ghosts CanEmote?).
-        if (_mobState.IsIncapacitated(args.User))
+        if (!CanPoint(args.User))
             return;
 
         // We won't check in range or visibility, as this verb is currently only executable via the context menu,
@@ -66,11 +55,9 @@ private void AddPointingVerb(GetVerbsEvent<Verb> args)
     private void OnArrowStartup(EntityUid uid, PointingArrowComponent component, ComponentStartup args)
     {
         if (TryComp<SpriteComponent>(uid, out var sprite))
-        {
             sprite.DrawDepth = (int) DrawDepth.Overlays;
-        }
 
-        _floatingSystem.FloatAnimation(uid, component.Offset, component.AnimationKey, component.AnimationTime);
+        BeginPointAnimation(uid, component.StartPosition, component.Offset, component.AnimationKey);
     }
 
     private void OnRogueArrowStartup(EntityUid uid, RoguePointingArrowComponent arrow, ComponentStartup args)
@@ -81,4 +68,13 @@ private void OnRogueArrowStartup(EntityUid uid, RoguePointingArrowComponent arro
             sprite.NoRotation = false;
         }
     }
+
+    private void HandleCompState(Entity<PointingArrowComponent> entity, ref ComponentHandleState args)
+    {
+        if (args.Current is not SharedPointingArrowComponentState state)
+            return;
+
+        entity.Comp.StartPosition = state.StartPosition;
+        entity.Comp.EndTime = state.EndTime;
+    }
 }
diff --git a/Content.Client/Popups/PopupOverlay.cs b/Content.Client/Popups/PopupOverlay.cs
index 5adc2e1ff0c..1305d8bb947 100644
--- a/Content.Client/Popups/PopupOverlay.cs
+++ b/Content.Client/Popups/PopupOverlay.cs
@@ -1,12 +1,6 @@
-using System.Numerics;
-using Content.Client.Examine;
-using Content.Shared.CCVar;
 using Content.Shared.Examine;
-using Content.Shared.Interaction;
-using Content.Shared.Popups;
 using Robust.Client.Graphics;
 using Robust.Client.Player;
-using Robust.Client.ResourceManagement;
 using Robust.Client.UserInterface;
 using Robust.Shared;
 using Robust.Shared.Configuration;
@@ -26,11 +20,9 @@ public sealed class PopupOverlay : Overlay
     private readonly IPlayerManager _playerMgr;
     private readonly IUserInterfaceManager _uiManager;
     private readonly PopupSystem _popup;
+    private readonly PopupUIController _controller;
 
     private readonly ShaderInstance _shader;
-    private readonly Font _smallFont;
-    private readonly Font _mediumFont;
-    private readonly Font _largeFont;
 
     public override OverlaySpace Space => OverlaySpace.ScreenSpace;
 
@@ -39,8 +31,8 @@ public PopupOverlay(
         IEntityManager entManager,
         IPlayerManager playerMgr,
         IPrototypeManager protoManager,
-        IResourceCache cache,
         IUserInterfaceManager uiManager,
+        PopupUIController controller,
         PopupSystem popup)
     {
         _configManager = configManager;
@@ -48,11 +40,9 @@ public PopupOverlay(
         _playerMgr = playerMgr;
         _uiManager = uiManager;
         _popup = popup;
+        _controller = controller;
 
         _shader = protoManager.Index<ShaderPrototype>("unshaded").Instance();
-        _smallFont = new VectorFont(cache.GetResource<FontResource>("/Fonts/NotoSans/NotoSans-Italic.ttf"), 10);
-        _mediumFont = new VectorFont(cache.GetResource<FontResource>("/Fonts/NotoSans/NotoSans-Italic.ttf"), 12);
-        _largeFont = new VectorFont(cache.GetResource<FontResource>("/Fonts/NotoSans/NotoSans-BoldItalic.ttf"), 14);
     }
 
     protected override void Draw(in OverlayDrawArgs args)
@@ -68,19 +58,18 @@ protected override void Draw(in OverlayDrawArgs args)
             scale = _uiManager.DefaultUIScale;
 
         DrawWorld(args.ScreenHandle, args, scale);
-        DrawScreen(args.ScreenHandle, args, scale);
 
         args.DrawingHandle.UseShader(null);
     }
 
     private void DrawWorld(DrawingHandleScreen worldHandle, OverlayDrawArgs args, float scale)
     {
-        if (_popup.WorldLabels.Count == 0)
+        if (_popup.WorldLabels.Count == 0 || args.ViewportControl == null)
             return;
 
-        var matrix = args.ViewportControl!.GetWorldToScreenMatrix();
+        var matrix = args.ViewportControl.GetWorldToScreenMatrix();
         var viewPos = new MapCoordinates(args.WorldAABB.Center, args.MapId);
-        var ourEntity = _playerMgr.LocalPlayer?.ControlledEntity;
+        var ourEntity = _playerMgr.LocalEntity;
 
         foreach (var popup in _popup.WorldLabels)
         {
@@ -92,62 +81,12 @@ private void DrawWorld(DrawingHandleScreen worldHandle, OverlayDrawArgs args, fl
             var distance = (mapPos.Position - args.WorldBounds.Center).Length();
 
             // Should handle fade here too wyci.
-            if (!args.WorldAABB.Contains(mapPos.Position) || !ExamineSystemShared.InRangeUnOccluded(viewPos, mapPos, distance,
+            if (!args.WorldBounds.Contains(mapPos.Position) || !ExamineSystemShared.InRangeUnOccluded(viewPos, mapPos, distance,
                     e => e == popup.InitialPos.EntityId || e == ourEntity, entMan: _entManager))
                 continue;
 
             var pos = matrix.Transform(mapPos.Position);
-            DrawPopup(popup, worldHandle, pos, scale);
+            _controller.DrawPopup(popup, worldHandle, pos, scale);
         }
     }
-
-    private void DrawScreen(DrawingHandleScreen screenHandle, OverlayDrawArgs args, float scale)
-    {
-        foreach (var popup in _popup.CursorLabels)
-        {
-            // Different window
-            if (popup.InitialPos.Window != args.ViewportControl?.Window?.Id)
-                continue;
-
-            DrawPopup(popup, screenHandle, popup.InitialPos.Position, scale);
-        }
-    }
-
-    private void DrawPopup(PopupSystem.PopupLabel popup, DrawingHandleScreen handle, Vector2 position, float scale)
-    {
-        var lifetime = PopupSystem.GetPopupLifetime(popup);
-
-        // Keep alpha at 1 until TotalTime passes half its lifetime, then gradually decrease to 0.
-        var alpha = MathF.Min(1f, 1f - MathF.Max(0f, popup.TotalTime - lifetime / 2) * 2 / lifetime);
-
-        var updatedPosition = position - new Vector2(0f, MathF.Min(8f, 12f * (popup.TotalTime * popup.TotalTime + popup.TotalTime)));
-        var font = _smallFont;
-        var color = Color.White.WithAlpha(alpha);
-
-        switch (popup.Type)
-        {
-            case PopupType.SmallCaution:
-                color = Color.Red;
-                break;
-            case PopupType.Medium:
-                font = _mediumFont;
-                color = Color.LightGray;
-                break;
-            case PopupType.MediumCaution:
-                font = _mediumFont;
-                color = Color.Red;
-                break;
-            case PopupType.Large:
-                font = _largeFont;
-                color = Color.LightGray;
-                break;
-            case PopupType.LargeCaution:
-                font = _largeFont;
-                color = Color.Red;
-                break;
-        }
-
-        var dimensions = handle.GetDimensions(font, popup.Text, scale);
-        handle.DrawString(font, updatedPosition - dimensions / 2f, popup.Text, scale, color.WithAlpha(alpha));
-    }
 }
diff --git a/Content.Client/Popups/PopupSystem.cs b/Content.Client/Popups/PopupSystem.cs
index d9e66c79fa9..2c923ae3a71 100644
--- a/Content.Client/Popups/PopupSystem.cs
+++ b/Content.Client/Popups/PopupSystem.cs
@@ -23,7 +23,6 @@ public sealed class PopupSystem : SharedPopupSystem
         [Dependency] private readonly IOverlayManager _overlay = default!;
         [Dependency] private readonly IPlayerManager _playerManager = default!;
         [Dependency] private readonly IPrototypeManager _prototype = default!;
-        [Dependency] private readonly IResourceCache _resource = default!;
         [Dependency] private readonly IGameTiming _timing = default!;
         [Dependency] private readonly IUserInterfaceManager _uiManager = default!;
         [Dependency] private readonly IReplayRecordingManager _replayRecording = default!;
@@ -45,7 +44,14 @@ public override void Initialize()
             SubscribeNetworkEvent<PopupEntityEvent>(OnPopupEntityEvent);
             SubscribeNetworkEvent<RoundRestartCleanupEvent>(OnRoundRestart);
             _overlay
-                .AddOverlay(new PopupOverlay(_configManager, EntityManager, _playerManager, _prototype, _resource, _uiManager, this));
+                .AddOverlay(new PopupOverlay(
+                    _configManager,
+                    EntityManager,
+                    _playerManager,
+                    _prototype,
+                    _uiManager,
+                    _uiManager.GetUIController<PopupUIController>(),
+                    this));
         }
 
         public override void Shutdown()
diff --git a/Content.Client/Popups/PopupUIController.cs b/Content.Client/Popups/PopupUIController.cs
new file mode 100644
index 00000000000..8ce8ae21e19
--- /dev/null
+++ b/Content.Client/Popups/PopupUIController.cs
@@ -0,0 +1,121 @@
+using System.Numerics;
+using Content.Client.Gameplay;
+using Content.Shared.Popups;
+using Robust.Client.Graphics;
+using Robust.Client.ResourceManagement;
+using Robust.Client.UserInterface;
+using Robust.Client.UserInterface.Controllers;
+
+namespace Content.Client.Popups;
+
+/// <summary>
+/// Handles screens-space popups. World popups are handled via PopupOverlay.
+/// </summary>
+public sealed class PopupUIController : UIController, IOnStateEntered<GameplayState>, IOnStateExited<GameplayState>
+{
+    [UISystemDependency] private readonly PopupSystem? _popup = default!;
+
+    private Font _smallFont = default!;
+    private Font _mediumFont = default!;
+    private Font _largeFont = default!;
+
+    private PopupRootControl? _popupControl;
+
+    public override void Initialize()
+    {
+        base.Initialize();
+        var cache = IoCManager.Resolve<IResourceCache>();
+
+        _smallFont = new VectorFont(cache.GetResource<FontResource>("/Fonts/NotoSans/NotoSans-Italic.ttf"), 10);
+        _mediumFont = new VectorFont(cache.GetResource<FontResource>("/Fonts/NotoSans/NotoSans-Italic.ttf"), 12);
+        _largeFont = new VectorFont(cache.GetResource<FontResource>("/Fonts/NotoSans/NotoSans-BoldItalic.ttf"), 14);
+    }
+
+    public void OnStateEntered(GameplayState state)
+    {
+        _popupControl = new PopupRootControl(_popup, this);
+
+        UIManager.RootControl.AddChild(_popupControl);
+    }
+
+    public void OnStateExited(GameplayState state)
+    {
+        if (_popupControl == null)
+            return;
+
+        UIManager.RootControl.RemoveChild(_popupControl);
+        _popupControl = null;
+    }
+
+    public void DrawPopup(PopupSystem.PopupLabel popup, DrawingHandleScreen handle, Vector2 position, float scale)
+    {
+        var lifetime = PopupSystem.GetPopupLifetime(popup);
+
+        // Keep alpha at 1 until TotalTime passes half its lifetime, then gradually decrease to 0.
+        var alpha = MathF.Min(1f, 1f - MathF.Max(0f, popup.TotalTime - lifetime / 2) * 2 / lifetime);
+
+        var updatedPosition = position - new Vector2(0f, MathF.Min(8f, 12f * (popup.TotalTime * popup.TotalTime + popup.TotalTime)));
+        var font = _smallFont;
+        var color = Color.White.WithAlpha(alpha);
+
+        switch (popup.Type)
+        {
+            case PopupType.SmallCaution:
+                color = Color.Red;
+                break;
+            case PopupType.Medium:
+                font = _mediumFont;
+                color = Color.LightGray;
+                break;
+            case PopupType.MediumCaution:
+                font = _mediumFont;
+                color = Color.Red;
+                break;
+            case PopupType.Large:
+                font = _largeFont;
+                color = Color.LightGray;
+                break;
+            case PopupType.LargeCaution:
+                font = _largeFont;
+                color = Color.Red;
+                break;
+        }
+
+        var dimensions = handle.GetDimensions(font, popup.Text, scale);
+        handle.DrawString(font, updatedPosition - dimensions / 2f, popup.Text, scale, color.WithAlpha(alpha));
+    }
+
+    /// <summary>
+    /// Handles drawing all screen popups.
+    /// </summary>
+    private sealed class PopupRootControl : Control
+    {
+        private readonly PopupSystem? _popup;
+        private readonly PopupUIController _controller;
+
+        public PopupRootControl(PopupSystem? system, PopupUIController controller)
+        {
+            _popup = system;
+            _controller = controller;
+        }
+
+        protected override void Draw(DrawingHandleScreen handle)
+        {
+            base.Draw(handle);
+
+            if (_popup == null)
+                return;
+
+            // Different window
+            var windowId = UserInterfaceManager.RootControl.Window.Id;
+
+            foreach (var popup in _popup.CursorLabels)
+            {
+                if (popup.InitialPos.Window != windowId)
+                    continue;
+
+                _controller.DrawPopup(popup, handle, popup.InitialPos.Position, UIScale);
+            }
+        }
+    }
+}
diff --git a/Content.Client/StationRecords/GeneralStationRecordConsoleBoundUserInterface.cs b/Content.Client/StationRecords/GeneralStationRecordConsoleBoundUserInterface.cs
index 841ea7e79e1..3be3d98778d 100644
--- a/Content.Client/StationRecords/GeneralStationRecordConsoleBoundUserInterface.cs
+++ b/Content.Client/StationRecords/GeneralStationRecordConsoleBoundUserInterface.cs
@@ -1,5 +1,4 @@
 using Content.Shared.StationRecords;
-using Robust.Client.GameObjects;
 
 namespace Content.Client.StationRecords;
 
@@ -17,33 +16,21 @@ protected override void Open()
         base.Open();
 
         _window = new();
-        _window.OnKeySelected += OnKeySelected;
-        _window.OnFiltersChanged += OnFiltersChanged;
+        _window.OnKeySelected += key =>
+            SendMessage(new SelectStationRecord(key));
+        _window.OnFiltersChanged += (type, filterValue) =>
+            SendMessage(new SetStationRecordFilter(type, filterValue));
         _window.OnClose += Close;
 
         _window.OpenCentered();
     }
 
-    private void OnKeySelected((NetEntity, uint)? key)
-    {
-        SendMessage(new SelectGeneralStationRecord(key));
-    }
-
-    private void OnFiltersChanged(
-        GeneralStationRecordFilterType type, string filterValue)
-    {
-        GeneralStationRecordsFilterMsg msg = new(type, filterValue);
-        SendMessage(msg);
-    }
-
     protected override void UpdateState(BoundUserInterfaceState state)
     {
         base.UpdateState(state);
 
         if (state is not GeneralStationRecordConsoleState cast)
-        {
             return;
-        }
 
         _window?.UpdateState(cast);
     }
diff --git a/Content.Client/StationRecords/GeneralStationRecordConsoleWindow.xaml.cs b/Content.Client/StationRecords/GeneralStationRecordConsoleWindow.xaml.cs
index c71b115c7a9..fbdd6c2f0b5 100644
--- a/Content.Client/StationRecords/GeneralStationRecordConsoleWindow.xaml.cs
+++ b/Content.Client/StationRecords/GeneralStationRecordConsoleWindow.xaml.cs
@@ -1,4 +1,3 @@
-using System.Linq;
 using Content.Shared.StationRecords;
 using Robust.Client.AutoGenerated;
 using Robust.Client.UserInterface;
@@ -11,31 +10,29 @@ namespace Content.Client.StationRecords;
 [GenerateTypedNameReferences]
 public sealed partial class GeneralStationRecordConsoleWindow : DefaultWindow
 {
-    public Action<(NetEntity, uint)?>? OnKeySelected;
+    public Action<uint?>? OnKeySelected;
 
-    public Action<GeneralStationRecordFilterType, string>? OnFiltersChanged;
+    public Action<StationRecordFilterType, string>? OnFiltersChanged;
 
     private bool _isPopulating;
 
-    private GeneralStationRecordFilterType _currentFilterType;
+    private StationRecordFilterType _currentFilterType;
 
     public GeneralStationRecordConsoleWindow()
     {
         RobustXamlLoader.Load(this);
 
-        _currentFilterType = GeneralStationRecordFilterType.Name;
+        _currentFilterType = StationRecordFilterType.Name;
 
-        foreach (var item in Enum.GetValues<GeneralStationRecordFilterType>())
+        foreach (var item in Enum.GetValues<StationRecordFilterType>())
         {
             StationRecordsFilterType.AddItem(GetTypeFilterLocals(item), (int)item);
         }
 
         RecordListing.OnItemSelected += args =>
         {
-            if (_isPopulating || RecordListing[args.ItemIndex].Metadata is not ValueTuple<NetEntity, uint> cast)
-            {
+            if (_isPopulating || RecordListing[args.ItemIndex].Metadata is not uint cast)
                 return;
-            }
 
             OnKeySelected?.Invoke(cast);
         };
@@ -48,7 +45,7 @@ public GeneralStationRecordConsoleWindow()
 
         StationRecordsFilterType.OnItemSelected += eventArgs =>
         {
-            var type = (GeneralStationRecordFilterType)eventArgs.Id;
+            var type = (StationRecordFilterType) eventArgs.Id;
 
             if (_currentFilterType != type)
             {
@@ -123,7 +120,7 @@ public void UpdateState(GeneralStationRecordConsoleState state)
             RecordContainer.RemoveAllChildren();
         }
     }
-    private void PopulateRecordListing(Dictionary<(NetEntity, uint), string> listing, (NetEntity, uint)? selected)
+    private void PopulateRecordListing(Dictionary<uint, string> listing, uint? selected)
     {
         RecordListing.Clear();
         RecordListing.ClearSelected();
@@ -134,10 +131,7 @@ private void PopulateRecordListing(Dictionary<(NetEntity, uint), string> listing
         {
             var item = RecordListing.AddItem(name);
             item.Metadata = key;
-            if (selected != null && key.Item1 == selected.Value.Item1 && key.Item2 == selected.Value.Item2)
-            {
-                item.Selected = true;
-            }
+            item.Selected = key == selected;
         }
         _isPopulating = false;
 
@@ -197,7 +191,7 @@ private void FilterListingOfRecords(string text = "")
         }
     }
 
-    private string GetTypeFilterLocals(GeneralStationRecordFilterType type)
+    private string GetTypeFilterLocals(StationRecordFilterType type)
     {
         return Loc.GetString($"general-station-record-{type.ToString().ToLower()}-filter");
     }
diff --git a/Content.Client/Storage/Systems/EntityStorageSystem.cs b/Content.Client/Storage/Systems/EntityStorageSystem.cs
index 6d37beb0781..dd3f8d38605 100644
--- a/Content.Client/Storage/Systems/EntityStorageSystem.cs
+++ b/Content.Client/Storage/Systems/EntityStorageSystem.cs
@@ -17,6 +17,7 @@ public sealed class EntityStorageSystem : SharedEntityStorageSystem
     public override void Initialize()
     {
         base.Initialize();
+        SubscribeLocalEvent<EntityStorageComponent, EntityUnpausedEvent>(OnEntityUnpausedEvent);
         SubscribeLocalEvent<EntityStorageComponent, ComponentInit>(OnComponentInit);
         SubscribeLocalEvent<EntityStorageComponent, ComponentStartup>(OnComponentStartup);
         SubscribeLocalEvent<EntityStorageComponent, ActivateInWorldEvent>(OnInteract, after: new[] { typeof(LockSystem) });
diff --git a/Content.Client/Store/Ui/StoreBoundUserInterface.cs b/Content.Client/Store/Ui/StoreBoundUserInterface.cs
index 6774ef35a02..b549918d7c4 100644
--- a/Content.Client/Store/Ui/StoreBoundUserInterface.cs
+++ b/Content.Client/Store/Ui/StoreBoundUserInterface.cs
@@ -48,6 +48,11 @@ protected override void Open()
         {
             SendMessage(new StoreRequestUpdateInterfaceMessage());
         };
+
+        _menu.OnRefundAttempt += (_) =>
+        {
+            SendMessage(new StoreRequestRefundMessage());
+        };
     }
     protected override void UpdateState(BoundUserInterfaceState state)
     {
@@ -64,6 +69,7 @@ protected override void UpdateState(BoundUserInterfaceState state)
 
                 _menu.UpdateListing(msg.Listings.ToList());
                 _menu.SetFooterVisibility(msg.ShowFooter);
+                _menu.UpdateRefund(msg.AllowRefund);
                 break;
             case StoreInitializeState msg:
                 _windowName = msg.Name;
diff --git a/Content.Client/Store/Ui/StoreMenu.xaml b/Content.Client/Store/Ui/StoreMenu.xaml
index a454e3e2b7f..4b38352a44a 100644
--- a/Content.Client/Store/Ui/StoreMenu.xaml
+++ b/Content.Client/Store/Ui/StoreMenu.xaml
@@ -22,6 +22,11 @@
                     MinWidth="64"
                     HorizontalAlignment="Right"
                     Text="{Loc 'store-ui-default-withdraw-text'}" />
+                <Button
+                    Name="RefundButton"
+                    MinWidth="64"
+                    HorizontalAlignment="Right"
+                    Text="Refund" />
             </BoxContainer>
             <PanelContainer VerticalExpand="True">
                 <PanelContainer.PanelOverride>
diff --git a/Content.Client/Store/Ui/StoreMenu.xaml.cs b/Content.Client/Store/Ui/StoreMenu.xaml.cs
index d938dbfe542..5dc1ab246bd 100644
--- a/Content.Client/Store/Ui/StoreMenu.xaml.cs
+++ b/Content.Client/Store/Ui/StoreMenu.xaml.cs
@@ -31,6 +31,7 @@ public sealed partial class StoreMenu : DefaultWindow
     public event Action<BaseButton.ButtonEventArgs, string>? OnCategoryButtonPressed;
     public event Action<BaseButton.ButtonEventArgs, string, int>? OnWithdrawAttempt;
     public event Action<BaseButton.ButtonEventArgs>? OnRefreshButtonPressed;
+    public event Action<BaseButton.ButtonEventArgs>? OnRefundAttempt;
 
     public Dictionary<string, FixedPoint2> Balance = new();
     public string CurrentCategory = string.Empty;
@@ -44,6 +45,8 @@ public StoreMenu(string name)
 
         WithdrawButton.OnButtonDown += OnWithdrawButtonDown;
         RefreshButton.OnButtonDown += OnRefreshButtonDown;
+        RefundButton.OnButtonDown += OnRefundButtonDown;
+
         if (Window != null)
             Window.Title = name;
     }
@@ -116,6 +119,11 @@ private void OnWithdrawButtonDown(BaseButton.ButtonEventArgs args)
         _withdrawWindow.OnWithdrawAttempt += OnWithdrawAttempt;
     }
 
+    private void OnRefundButtonDown(BaseButton.ButtonEventArgs args)
+    {
+        OnRefundAttempt?.Invoke(args);
+    }
+
     private void AddListingGui(ListingData listing)
     {
         if (!listing.Categories.Contains(CurrentCategory))
@@ -262,6 +270,11 @@ public override void Close()
         _withdrawWindow?.Close();
     }
 
+    public void UpdateRefund(bool allowRefund)
+    {
+        RefundButton.Disabled = !allowRefund;
+    }
+
     private sealed class StoreCategoryButton : Button
     {
         public string? Id;
diff --git a/Content.Client/UserInterface/Systems/Chat/ChatUIController.cs b/Content.Client/UserInterface/Systems/Chat/ChatUIController.cs
index 502a86b6dc9..ec3d138bd30 100644
--- a/Content.Client/UserInterface/Systems/Chat/ChatUIController.cs
+++ b/Content.Client/UserInterface/Systems/Chat/ChatUIController.cs
@@ -15,10 +15,12 @@
 using Content.Shared.Administration;
 using Content.Shared.CCVar;
 using Content.Shared.Chat;
+using Content.Shared.Decals;
 using Content.Shared.Damage.ForceSay;
 using Content.Shared.Examine;
 using Content.Shared.Input;
 using Content.Shared.Radio;
+using Robust.Client.GameObjects;
 using Robust.Client.Graphics;
 using Robust.Client.Input;
 using Robust.Client.Player;
@@ -27,9 +29,11 @@
 using Robust.Client.UserInterface.Controllers;
 using Robust.Client.UserInterface.Controls;
 using Robust.Shared.Configuration;
+using Robust.Shared.GameObjects.Components.Localization;
 using Robust.Shared.Input.Binding;
 using Robust.Shared.Map;
 using Robust.Shared.Network;
+using Robust.Shared.Prototypes;
 using Robust.Shared.Replays;
 using Robust.Shared.Timing;
 using Robust.Shared.Utility;
@@ -42,9 +46,11 @@ public sealed class ChatUIController : UIController
     [Dependency] private readonly IChatManager _manager = default!;
     [Dependency] private readonly IConfigurationManager _config = default!;
     [Dependency] private readonly IEyeManager _eye = default!;
+    [Dependency] private readonly IEntityManager _ent = default!;
     [Dependency] private readonly IInputManager _input = default!;
     [Dependency] private readonly IClientNetManager _net = default!;
     [Dependency] private readonly IPlayerManager _player = default!;
+    [Dependency] private readonly IPrototypeManager _prototypeManager = default!;
     [Dependency] private readonly IStateManager _state = default!;
     [Dependency] private readonly IGameTiming _timing = default!;
     [Dependency] private readonly IReplayRecordingManager _replayRecording = default!;
@@ -55,6 +61,11 @@ public sealed class ChatUIController : UIController
     [UISystemDependency] private readonly TypingIndicatorSystem? _typingIndicator = default;
     [UISystemDependency] private readonly ChatSystem? _chatSys = default;
 
+    [ValidatePrototypeId<ColorPalettePrototype>]
+    private const string ChatNamePalette = "ChatNames";
+    private string[] _chatNameColors = default!;
+    private bool _chatNameColorsEnabled;
+
     private ISawmill _sawmill = default!;
 
     public static readonly Dictionary<char, ChatSelectChannel> PrefixToChannel = new()
@@ -168,6 +179,8 @@ public override void Initialize()
         _net.RegisterNetMessage<MsgChatMessage>(OnChatMessage);
         _net.RegisterNetMessage<MsgDeleteChatMessagesBy>(OnDeleteChatMessagesBy);
         SubscribeNetworkEvent<DamageForceSayEvent>(OnDamageForceSay);
+        _cfg.OnValueChanged(CCVars.ChatEnableColorName, (value) => { _chatNameColorsEnabled = value; });
+        _chatNameColorsEnabled = _cfg.GetCVar(CCVars.ChatEnableColorName);
 
         _speechBubbleRoot = new LayoutContainer();
 
@@ -212,6 +225,13 @@ public override void Initialize()
         var gameplayStateLoad = UIManager.GetUIController<GameplayStateLoadController>();
         gameplayStateLoad.OnScreenLoad += OnScreenLoad;
         gameplayStateLoad.OnScreenUnload += OnScreenUnload;
+
+        var nameColors = _prototypeManager.Index<ColorPalettePrototype>(ChatNamePalette).Colors.Values.ToArray();
+        _chatNameColors = new string[nameColors.Length];
+        for (var i = 0; i < nameColors.Length; i++)
+        {
+            _chatNameColors[i] = nameColors[i].ToHex();
+        }
     }
 
     public void OnScreenLoad()
@@ -757,6 +777,14 @@ private void OnChatMessage(MsgChatMessage message)
 
     public void ProcessChatMessage(ChatMessage msg, bool speechBubble = true)
     {
+        // color the name unless it's something like "the old man"
+        if ((msg.Channel == ChatChannel.Local || msg.Channel == ChatChannel.Whisper) && _chatNameColorsEnabled)
+        {
+            var grammar = _ent.GetComponentOrNull<GrammarComponent>(_ent.GetEntity(msg.SenderEntity));
+            if (grammar != null && grammar.ProperNoun == true)
+                msg.WrappedMessage = SharedChatSystem.InjectTagInsideTag(msg, "Name", "color", GetNameColor(SharedChatSystem.GetStringInsideTag(msg, "Name")));
+        }
+
         // Log all incoming chat to repopulate when filter is un-toggled
         if (!msg.HideChat)
         {
@@ -852,6 +880,17 @@ public void Repopulate()
         }
     }
 
+    /// <summary>
+    /// Returns the chat name color for a mob
+    /// </summary>
+    /// <param name="name">Name of the mob</param>
+    /// <returns>Hex value of the color</returns>
+    public string GetNameColor(string name)
+    {
+        var colorIdx = Math.Abs(name.GetHashCode() % _chatNameColors.Length);
+        return _chatNameColors[colorIdx];
+    }
+
     private readonly record struct SpeechBubbleData(ChatMessage Message, SpeechBubble.SpeechType Type);
 
     private sealed class SpeechBubbleQueueData
diff --git a/Content.Client/UserInterface/Systems/Sandbox/SandboxUIController.cs b/Content.Client/UserInterface/Systems/Sandbox/SandboxUIController.cs
index 3ab36a9166a..752c89ca970 100644
--- a/Content.Client/UserInterface/Systems/Sandbox/SandboxUIController.cs
+++ b/Content.Client/UserInterface/Systems/Sandbox/SandboxUIController.cs
@@ -30,6 +30,7 @@ public sealed class SandboxUIController : UIController, IOnStateChanged<Gameplay
     [Dependency] private readonly IEyeManager _eye = default!;
     [Dependency] private readonly IInputManager _input = default!;
     [Dependency] private readonly ILightManager _light = default!;
+    [Dependency] private readonly IClientAdminManager _admin = default!;
 
     [UISystemDependency] private readonly DebugPhysicsSystem _debugPhysics = default!;
     [UISystemDependency] private readonly MarkerSystem _marker = default!;
@@ -53,13 +54,28 @@ public void OnStateEntered(GameplayState state)
         CheckSandboxVisibility();
 
         _input.SetInputCommand(ContentKeyFunctions.OpenEntitySpawnWindow,
-            InputCmdHandler.FromDelegate(_ => EntitySpawningController.ToggleWindow()));
+            InputCmdHandler.FromDelegate(_ =>
+            {
+                if (!_admin.CanAdminPlace())
+                    return;
+                EntitySpawningController.ToggleWindow();
+            }));
         _input.SetInputCommand(ContentKeyFunctions.OpenSandboxWindow,
             InputCmdHandler.FromDelegate(_ => ToggleWindow()));
         _input.SetInputCommand(ContentKeyFunctions.OpenTileSpawnWindow,
-            InputCmdHandler.FromDelegate(_ => TileSpawningController.ToggleWindow()));
+            InputCmdHandler.FromDelegate(_ =>
+            {
+                if (!_admin.CanAdminPlace())
+                    return;
+                TileSpawningController.ToggleWindow();
+            }));
         _input.SetInputCommand(ContentKeyFunctions.OpenDecalSpawnWindow,
-            InputCmdHandler.FromDelegate(_ => DecalPlacerController.ToggleWindow()));
+            InputCmdHandler.FromDelegate(_ =>
+            {
+                if (!_admin.CanAdminPlace())
+                    return;
+                DecalPlacerController.ToggleWindow();
+            }));
 
         CommandBinds.Builder
             .Bind(ContentKeyFunctions.EditorCopyObject, new PointerInputCmdHandler(Copy))
diff --git a/Content.IntegrationTests/Tests/DeviceNetwork/DeviceNetworkTest.cs b/Content.IntegrationTests/Tests/DeviceNetwork/DeviceNetworkTest.cs
index 1d994624a6d..26ea726211b 100644
--- a/Content.IntegrationTests/Tests/DeviceNetwork/DeviceNetworkTest.cs
+++ b/Content.IntegrationTests/Tests/DeviceNetwork/DeviceNetworkTest.cs
@@ -2,6 +2,7 @@
 using Content.Server.DeviceNetwork;
 using Content.Server.DeviceNetwork.Components;
 using Content.Server.DeviceNetwork.Systems;
+using Content.Shared.DeviceNetwork;
 using Robust.Shared.GameObjects;
 using Robust.Shared.IoC;
 using Robust.Shared.Map;
diff --git a/Content.IntegrationTests/Tests/DeviceNetwork/DeviceNetworkTestSystem.cs b/Content.IntegrationTests/Tests/DeviceNetwork/DeviceNetworkTestSystem.cs
index 6e3db254047..400d85f2ccb 100644
--- a/Content.IntegrationTests/Tests/DeviceNetwork/DeviceNetworkTestSystem.cs
+++ b/Content.IntegrationTests/Tests/DeviceNetwork/DeviceNetworkTestSystem.cs
@@ -1,7 +1,6 @@
-
-using Content.Server.DeviceNetwork;
 using Content.Server.DeviceNetwork.Components;
 using Content.Server.DeviceNetwork.Systems;
+using Content.Shared.DeviceNetwork;
 using Robust.Shared.GameObjects;
 using Robust.Shared.Reflection;
 
diff --git a/Content.IntegrationTests/Tests/Puller/PullerTest.cs b/Content.IntegrationTests/Tests/Puller/PullerTest.cs
new file mode 100644
index 00000000000..ba91f54ff77
--- /dev/null
+++ b/Content.IntegrationTests/Tests/Puller/PullerTest.cs
@@ -0,0 +1,45 @@
+using Content.Shared.Hands.Components;
+using Content.Shared.Prototypes;
+using Content.Shared.Pulling.Components;
+using Robust.Shared.GameObjects;
+using Robust.Shared.Prototypes;
+
+namespace Content.IntegrationTests.Tests.Puller;
+
+#nullable enable
+
+[TestFixture]
+public sealed class PullerTest
+{
+    /// <summary>
+    /// Checks that needsHands on PullerComponent is not set on mobs that don't even have hands.
+    /// </summary>
+    [Test]
+    public async Task PullerSanityTest()
+    {
+        await using var pair = await PoolManager.GetServerClient();
+        var server = pair.Server;
+
+        var compFactory = server.ResolveDependency<IComponentFactory>();
+        var protoManager = server.ResolveDependency<IPrototypeManager>();
+
+        await server.WaitAssertion(() =>
+        {
+            Assert.Multiple(() =>
+            {
+                foreach (var proto in protoManager.EnumeratePrototypes<EntityPrototype>())
+                {
+                    if (!proto.TryGetComponent(out SharedPullerComponent? puller))
+                        continue;
+
+                    if (!puller.NeedsHands)
+                        continue;
+
+                    Assert.That(proto.HasComponent<HandsComponent>(compFactory), $"Found puller {proto} with NeedsHand pulling but has no hands?");
+                }
+            });
+        });
+
+        await pair.CleanReturnAsync();
+    }
+}
diff --git a/Content.IntegrationTests/Tests/Storage/EntityStorageTests.cs b/Content.IntegrationTests/Tests/Storage/EntityStorageTests.cs
new file mode 100644
index 00000000000..45ee69a9efa
--- /dev/null
+++ b/Content.IntegrationTests/Tests/Storage/EntityStorageTests.cs
@@ -0,0 +1,81 @@
+using Content.Server.Storage.EntitySystems;
+using Content.Shared.Damage;
+using Robust.Shared.Containers;
+using Robust.Shared.GameObjects;
+
+namespace Content.IntegrationTests.Tests.Storage;
+
+[TestFixture]
+public sealed class EntityStorageTests
+{
+    [TestPrototypes]
+    private const string Prototypes = @"
+- type: entity
+  id: EntityStorageTest
+  name: box
+  components:
+  - type: EntityStorage
+  - type: Damageable
+    damageContainer: Inorganic
+  - type: Destructible
+    thresholds:
+    - trigger:
+        !type:DamageTrigger
+        damage: 10
+      behaviors:
+      - !type:DoActsBehavior
+        acts: [ Destruction ]
+";
+
+    [Test]
+    public async Task TestContainerDestruction()
+    {
+        await using var pair = await PoolManager.GetServerClient();
+        var server = pair.Server;
+        var map = await pair.CreateTestMap();
+
+        EntityUid box = default;
+        EntityUid crowbar = default;
+        await server.WaitPost(() => box = server.EntMan.SpawnEntity("EntityStorageTest", map.GridCoords));
+        await server.WaitPost(() => crowbar = server.EntMan.SpawnEntity("Crowbar", map.GridCoords));
+
+        // Initially the crowbar is not in a contaienr.
+        var sys = server.System<SharedContainerSystem>();
+        Assert.That(sys.IsEntityInContainer(crowbar), Is.False);
+
+        // Open then close the storage entity
+        var storage = server.System<EntityStorageSystem>();
+        await server.WaitPost(() =>
+        {
+            storage.OpenStorage(box);
+            storage.CloseStorage(box);
+        });
+
+        // Crowbar is now in the box
+        Assert.That(sys.IsEntityInContainer(crowbar));
+
+        // Damage the box
+        var damage = new DamageSpecifier();
+        damage.DamageDict.Add("Blunt", 100);
+        await server.WaitPost(() => server.System<DamageableSystem>().TryChangeDamage(box, damage));
+
+        // Box has been destroyed, contents have been emptied. Destruction uses deffered deletion.
+        Assert.That(server.EntMan.IsQueuedForDeletion(box));
+        Assert.That(sys.IsEntityInContainer(crowbar), Is.False);
+
+        // Opening and closing the soon-to-be-deleted box should not re-insert the crowbar
+        await server.WaitPost(() =>
+        {
+            storage.OpenStorage(box);
+            storage.CloseStorage(box);
+        });
+        Assert.That(sys.IsEntityInContainer(crowbar), Is.False);
+
+        // Entity gets deleted after a few ticks
+        await server.WaitRunTicks(5);
+        Assert.That(server.EntMan.Deleted(box));
+        Assert.That(server.EntMan.Deleted(crowbar), Is.False);
+
+        await pair.CleanReturnAsync();
+    }
+}
diff --git a/Content.Server/Access/Systems/AgentIDCardSystem.cs b/Content.Server/Access/Systems/AgentIDCardSystem.cs
index 4d242e8f81d..29657b509a9 100644
--- a/Content.Server/Access/Systems/AgentIDCardSystem.cs
+++ b/Content.Server/Access/Systems/AgentIDCardSystem.cs
@@ -7,6 +7,8 @@
 using Content.Shared.StatusIcon;
 using Robust.Server.GameObjects;
 using Robust.Shared.Prototypes;
+using Content.Shared.Roles;
+using System.Diagnostics.CodeAnalysis;
 
 namespace Content.Server.Access.Systems
 {
@@ -98,6 +100,24 @@ private void OnJobIconChanged(EntityUid uid, AgentIDCardComponent comp, AgentIDC
             }
 
             _cardSystem.TryChangeJobIcon(uid, jobIcon, idCard);
+
+            if (TryFindJobProtoFromIcon(jobIcon, out var job))
+                _cardSystem.TryChangeJobDepartment(uid, job, idCard);
+        }
+
+        private bool TryFindJobProtoFromIcon(StatusIconPrototype jobIcon, [NotNullWhen(true)] out JobPrototype? job)
+        {
+            foreach (var jobPrototype in _prototypeManager.EnumeratePrototypes<JobPrototype>())
+            {
+                if(jobPrototype.Icon == jobIcon.ID)
+                {
+                    job = jobPrototype;
+                    return true;
+                }
+            }
+
+            job = null;
+            return false;
         }
     }
 }
diff --git a/Content.Server/Access/Systems/IdCardConsoleSystem.cs b/Content.Server/Access/Systems/IdCardConsoleSystem.cs
index 10bf65d0c61..791159f972b 100644
--- a/Content.Server/Access/Systems/IdCardConsoleSystem.cs
+++ b/Content.Server/Access/Systems/IdCardConsoleSystem.cs
@@ -1,4 +1,3 @@
-using Content.Server.Station.Systems;
 using Content.Server.StationRecords.Systems;
 using Content.Shared.Access.Components;
 using Content.Shared.Access.Systems;
@@ -21,7 +20,6 @@ public sealed class IdCardConsoleSystem : SharedIdCardConsoleSystem
 {
     [Dependency] private readonly IPrototypeManager _prototype = default!;
     [Dependency] private readonly StationRecordsSystem _record = default!;
-    [Dependency] private readonly StationSystem _station = default!;
     [Dependency] private readonly UserInterfaceSystem _userInterface = default!;
     [Dependency] private readonly AccessReaderSystem _accessReader = default!;
     [Dependency] private readonly AccessSystem _access = default!;
@@ -85,10 +83,9 @@ private void UpdateUserInterface(EntityUid uid, IdCardConsoleComponent component
             var targetAccessComponent = EntityManager.GetComponent<AccessComponent>(targetId);
 
             var jobProto = string.Empty;
-            if (_station.GetOwningStation(uid) is { } station
-                && EntityManager.TryGetComponent<StationRecordKeyStorageComponent>(targetId, out var keyStorage)
-                && keyStorage.Key != null
-                && _record.TryGetRecord<GeneralStationRecord>(station, keyStorage.Key.Value, out var record))
+            if (TryComp<StationRecordKeyStorageComponent>(targetId, out var keyStorage)
+                && keyStorage.Key is {} key
+                && _record.TryGetRecord<GeneralStationRecord>(key, out var record))
             {
                 jobProto = record.JobPrototype;
             }
@@ -103,7 +100,7 @@ private void UpdateUserInterface(EntityUid uid, IdCardConsoleComponent component
                 possibleAccess,
                 jobProto,
                 privilegedIdName,
-                EntityManager.GetComponent<MetaDataComponent>(targetId).EntityName);
+                Name(targetId));
         }
 
         _userInterface.TrySetUiState(uid, IdCardConsoleUiKey.Key, newState);
@@ -134,6 +131,7 @@ private void TryWriteToTargetId(EntityUid uid,
             && _prototype.TryIndex<StatusIconPrototype>(job.Icon, out var jobIcon))
         {
             _idCard.TryChangeJobIcon(targetId, jobIcon, player: player);
+            _idCard.TryChangeJobDepartment(targetId, job);
         }
 
         if (!newAccessList.TrueForAll(x => component.AccessLevels.Contains(x)))
@@ -184,7 +182,7 @@ private bool PrivilegedIdIsAuthorized(EntityUid uid, IdCardConsoleComponent? com
         if (!Resolve(uid, ref component))
             return true;
 
-        if (!EntityManager.TryGetComponent<AccessReaderComponent>(uid, out var reader))
+        if (!TryComp<AccessReaderComponent>(uid, out var reader))
             return true;
 
         var privilegedId = component.PrivilegedIdSlot.Item;
@@ -193,10 +191,9 @@ private bool PrivilegedIdIsAuthorized(EntityUid uid, IdCardConsoleComponent? com
 
     private void UpdateStationRecord(EntityUid uid, EntityUid targetId, string newFullName, string newJobTitle, JobPrototype? newJobProto)
     {
-        if (_station.GetOwningStation(uid) is not { } station
-            || !EntityManager.TryGetComponent<StationRecordKeyStorageComponent>(targetId, out var keyStorage)
+        if (!TryComp<StationRecordKeyStorageComponent>(targetId, out var keyStorage)
             || keyStorage.Key is not { } key
-            || !_record.TryGetRecord<GeneralStationRecord>(station, key, out var record))
+            || !_record.TryGetRecord<GeneralStationRecord>(key, out var record))
         {
             return;
         }
@@ -210,6 +207,6 @@ private void UpdateStationRecord(EntityUid uid, EntityUid targetId, string newFu
             record.JobIcon = newJobProto.Icon;
         }
 
-        _record.Synchronize(station);
+        _record.Synchronize(key);
     }
 }
diff --git a/Content.Server/Access/Systems/IdCardSystem.cs b/Content.Server/Access/Systems/IdCardSystem.cs
index 1c1e6874172..def5e950d2c 100644
--- a/Content.Server/Access/Systems/IdCardSystem.cs
+++ b/Content.Server/Access/Systems/IdCardSystem.cs
@@ -149,6 +149,7 @@ public bool TryChangeJobDepartment(EntityUid uid, JobPrototype job, IdCardCompon
         if (!Resolve(uid, ref id))
             return false;
 
+        id.JobDepartments.Clear();
         foreach (var department in _prototypeManager.EnumeratePrototypes<DepartmentPrototype>())
         {
             if (department.Roles.Contains(job.ID))
diff --git a/Content.Server/Administration/Commands/FollowCommand.cs b/Content.Server/Administration/Commands/FollowCommand.cs
index 1ced6cf8dde..9f94f83b4d3 100644
--- a/Content.Server/Administration/Commands/FollowCommand.cs
+++ b/Content.Server/Administration/Commands/FollowCommand.cs
@@ -11,8 +11,8 @@ public sealed class FollowCommand : IConsoleCommand
     [Dependency] private readonly IEntityManager _entManager = default!;
 
     public string Command => "follow";
-    public string Description => Loc.GetString("add-uplink-command-description");
-    public string Help => Loc.GetString("add-uplink-command-help");
+    public string Description => Loc.GetString("follow-command-description");
+    public string Help => Loc.GetString("follow-command-help");
 
     public void Execute(IConsoleShell shell, string argStr, string[] args)
     {
diff --git a/Content.Server/Administration/Systems/AdminSystem.cs b/Content.Server/Administration/Systems/AdminSystem.cs
index 0e109119a37..263b968008e 100644
--- a/Content.Server/Administration/Systems/AdminSystem.cs
+++ b/Content.Server/Administration/Systems/AdminSystem.cs
@@ -359,7 +359,7 @@ public void Erase(ICommonSession player)
                     if (TryComp(item, out PdaComponent? pda) &&
                         TryComp(pda.ContainedId, out StationRecordKeyStorageComponent? keyStorage) &&
                         keyStorage.Key is { } key &&
-                        _stationRecords.TryGetRecord(key.OriginStation, key, out GeneralStationRecord? record))
+                        _stationRecords.TryGetRecord(key, out GeneralStationRecord? record))
                     {
                         if (TryComp(entity, out DnaComponent? dna) &&
                             dna.DNA != record.DNA)
@@ -373,7 +373,7 @@ keyStorage.Key is { } key &&
                             continue;
                         }
 
-                        _stationRecords.RemoveRecord(key.OriginStation, key);
+                        _stationRecords.RemoveRecord(key);
                         Del(item);
                     }
                 }
diff --git a/Content.Server/Atmos/Monitor/Systems/AirAlarmSystem.cs b/Content.Server/Atmos/Monitor/Systems/AirAlarmSystem.cs
index b346fd63b0d..2922d0796a9 100644
--- a/Content.Server/Atmos/Monitor/Systems/AirAlarmSystem.cs
+++ b/Content.Server/Atmos/Monitor/Systems/AirAlarmSystem.cs
@@ -15,6 +15,7 @@
 using Content.Shared.Atmos.Monitor.Components;
 using Content.Shared.Atmos.Piping.Unary.Components;
 using Content.Shared.DeviceLinking;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.DeviceNetwork.Systems;
 using Content.Shared.Interaction;
 using Content.Shared.Wires;
diff --git a/Content.Server/Atmos/Monitor/Systems/AtmosAlarmableSystem.cs b/Content.Server/Atmos/Monitor/Systems/AtmosAlarmableSystem.cs
index 27e64a9956d..2875d4a3d5d 100644
--- a/Content.Server/Atmos/Monitor/Systems/AtmosAlarmableSystem.cs
+++ b/Content.Server/Atmos/Monitor/Systems/AtmosAlarmableSystem.cs
@@ -6,6 +6,7 @@
 using Content.Server.DeviceNetwork.Systems;
 using Content.Server.Power.Components;
 using Content.Shared.Atmos.Monitor;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Tag;
 using Robust.Server.Audio;
 using Robust.Server.GameObjects;
diff --git a/Content.Server/Atmos/Monitor/Systems/AtmosDeviceNetwork.cs b/Content.Server/Atmos/Monitor/Systems/AtmosDeviceNetwork.cs
index 0b73ea5f351..33e4eafc741 100644
--- a/Content.Server/Atmos/Monitor/Systems/AtmosDeviceNetwork.cs
+++ b/Content.Server/Atmos/Monitor/Systems/AtmosDeviceNetwork.cs
@@ -1,6 +1,7 @@
 using Content.Server.DeviceNetwork;
 using Content.Server.DeviceNetwork.Systems;
 using Content.Shared.Atmos.Monitor.Components;
+using Content.Shared.DeviceNetwork;
 
 namespace Content.Server.Atmos.Monitor.Systems;
 
diff --git a/Content.Server/Atmos/Monitor/Systems/AtmosMonitoringSystem.cs b/Content.Server/Atmos/Monitor/Systems/AtmosMonitoringSystem.cs
index 1fcb7734d8b..28a0a01c99a 100644
--- a/Content.Server/Atmos/Monitor/Systems/AtmosMonitoringSystem.cs
+++ b/Content.Server/Atmos/Monitor/Systems/AtmosMonitoringSystem.cs
@@ -8,6 +8,7 @@
 using Content.Server.Power.EntitySystems;
 using Content.Shared.Atmos;
 using Content.Shared.Atmos.Monitor;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Tag;
 using Robust.Shared.Prototypes;
 
diff --git a/Content.Server/Atmos/Piping/Binary/EntitySystems/GasVolumePumpSystem.cs b/Content.Server/Atmos/Piping/Binary/EntitySystems/GasVolumePumpSystem.cs
index 4ae0d70f5e7..10b9cccc099 100644
--- a/Content.Server/Atmos/Piping/Binary/EntitySystems/GasVolumePumpSystem.cs
+++ b/Content.Server/Atmos/Piping/Binary/EntitySystems/GasVolumePumpSystem.cs
@@ -13,6 +13,7 @@
 using Content.Shared.Atmos.Visuals;
 using Content.Shared.Audio;
 using Content.Shared.Database;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Examine;
 using Content.Shared.Interaction;
 using Content.Shared.Popups;
diff --git a/Content.Server/Atmos/Piping/Unary/EntitySystems/GasThermoMachineSystem.cs b/Content.Server/Atmos/Piping/Unary/EntitySystems/GasThermoMachineSystem.cs
index ee0dca0fb0a..645b2ecc459 100644
--- a/Content.Server/Atmos/Piping/Unary/EntitySystems/GasThermoMachineSystem.cs
+++ b/Content.Server/Atmos/Piping/Unary/EntitySystems/GasThermoMachineSystem.cs
@@ -17,6 +17,7 @@
 using Content.Shared.UserInterface;
 using Content.Shared.Administration.Logs;
 using Content.Shared.Database;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Examine;
 
 namespace Content.Server.Atmos.Piping.Unary.EntitySystems
diff --git a/Content.Server/Atmos/Piping/Unary/EntitySystems/GasVentPumpSystem.cs b/Content.Server/Atmos/Piping/Unary/EntitySystems/GasVentPumpSystem.cs
index a35c6b1aa6e..3a3ccf75234 100644
--- a/Content.Server/Atmos/Piping/Unary/EntitySystems/GasVentPumpSystem.cs
+++ b/Content.Server/Atmos/Piping/Unary/EntitySystems/GasVentPumpSystem.cs
@@ -16,6 +16,7 @@
 using Content.Shared.Atmos.Piping.Unary.Components;
 using Content.Shared.Atmos.Visuals;
 using Content.Shared.Audio;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Examine;
 using Content.Shared.Tools.Systems;
 using JetBrains.Annotations;
diff --git a/Content.Server/Atmos/Piping/Unary/EntitySystems/GasVentScrubberSystem.cs b/Content.Server/Atmos/Piping/Unary/EntitySystems/GasVentScrubberSystem.cs
index ecf7d1d0b45..32591e9c540 100644
--- a/Content.Server/Atmos/Piping/Unary/EntitySystems/GasVentScrubberSystem.cs
+++ b/Content.Server/Atmos/Piping/Unary/EntitySystems/GasVentScrubberSystem.cs
@@ -15,6 +15,7 @@
 using Content.Shared.Atmos.Monitor;
 using Content.Shared.Atmos.Piping.Unary.Components;
 using Content.Shared.Audio;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Tools.Systems;
 using JetBrains.Annotations;
 using Robust.Server.GameObjects;
diff --git a/Content.Server/Body/Systems/BodySystem.cs b/Content.Server/Body/Systems/BodySystem.cs
index 1630d4cb10d..0e9b295f718 100644
--- a/Content.Server/Body/Systems/BodySystem.cs
+++ b/Content.Server/Body/Systems/BodySystem.cs
@@ -15,6 +15,7 @@
 using Robust.Shared.Random;
 using Robust.Shared.Timing;
 using System.Numerics;
+using Content.Shared.Gibbing.Components;
 using Content.Shared.Movement.Systems;
 using Robust.Shared.Audio.Systems;
 
@@ -106,7 +107,17 @@ protected override void RemovePart(
         _humanoidSystem.SetLayersVisibility(bodyUid, layers, false, true, humanoid);
     }
 
-    public override HashSet<EntityUid> GibBody(EntityUid bodyId, bool gibOrgans = false, BodyComponent? body = null, bool deleteItems = false, bool deleteBrain = false)
+    public override HashSet<EntityUid> GibBody(
+        EntityUid bodyId,
+        bool gibOrgans = false,
+        BodyComponent? body = null ,
+        bool deleteItems = false,
+        bool launchGibs = true,
+        Vector2? splatDirection = null,
+        float splatModifier = 1,
+        Angle splatCone = default,
+        SoundSpecifier? gibSoundOverride = null
+    )
     {
         if (!Resolve(bodyId, ref body, false))
             return new HashSet<EntityUid>();
@@ -118,28 +129,8 @@ public override HashSet<EntityUid> GibBody(EntityUid bodyId, bool gibOrgans = fa
         if (xform.MapUid == null)
             return new HashSet<EntityUid>();
 
-        var gibs = base.GibBody(bodyId, gibOrgans, body, deleteItems, deleteBrain);
-
-        var coordinates = xform.Coordinates;
-        var filter = Filter.Pvs(bodyId, entityManager: EntityManager);
-        var audio = AudioParams.Default.WithVariation(0.025f);
-
-        _audio.PlayStatic(body.GibSound, filter, coordinates, true, audio);
-
-        foreach (var entity in gibs)
-        {
-            if (deleteItems)
-            {
-                if (!HasComp<BrainComponent>(entity) || deleteBrain)
-                {
-                    QueueDel(entity);
-                }
-            }
-            else
-            {
-                SharedTransform.SetCoordinates(entity, coordinates.Offset(_random.NextVector2(.3f)));
-            }
-        }
+        var gibs = base.GibBody(bodyId, gibOrgans, body, deleteItems, launchGibs: launchGibs,
+            splatDirection: splatDirection, splatModifier: splatModifier, splatCone:splatCone);
         RaiseLocalEvent(bodyId, new BeingGibbedEvent(gibs));
         QueueDel(bodyId);
 
diff --git a/Content.Server/Body/Systems/BrainSystem.cs b/Content.Server/Body/Systems/BrainSystem.cs
index b55274808d7..abb54971209 100644
--- a/Content.Server/Body/Systems/BrainSystem.cs
+++ b/Content.Server/Body/Systems/BrainSystem.cs
@@ -4,6 +4,7 @@
 using Content.Shared.Body.Events;
 using Content.Shared.Mind;
 using Content.Shared.Mind.Components;
+using Content.Shared.Pointing;
 
 namespace Content.Server.Body.Systems
 {
@@ -17,6 +18,7 @@ public override void Initialize()
 
             SubscribeLocalEvent<BrainComponent, AddedToPartInBodyEvent>((uid, _, args) => HandleMind(args.Body, uid));
             SubscribeLocalEvent<BrainComponent, RemovedFromPartInBodyEvent>((uid, _, args) => HandleMind(uid, args.OldBody));
+            SubscribeLocalEvent<BrainComponent, PointAttemptEvent>(OnPointAttempt);
         }
 
         private void HandleMind(EntityUid newEntity, EntityUid oldEntity)
@@ -36,5 +38,10 @@ private void HandleMind(EntityUid newEntity, EntityUid oldEntity)
 
             _mindSystem.TransferTo(mindId, newEntity, mind: mind);
         }
+
+        private void OnPointAttempt(EntityUid uid, BrainComponent component, PointAttemptEvent args)
+        {
+            args.Cancel();
+        }
     }
 }
diff --git a/Content.Server/Botany/Systems/MutationSystem.cs b/Content.Server/Botany/Systems/MutationSystem.cs
index cfa944a221a..c7ce5d47efa 100644
--- a/Content.Server/Botany/Systems/MutationSystem.cs
+++ b/Content.Server/Botany/Systems/MutationSystem.cs
@@ -131,7 +131,7 @@ public SeedData Cross(SeedData a, SeedData b)
 
         // Hybrids have a high chance of being seedless. Balances very
         // effective hybrid crossings.
-        if (a.Name == result.Name && Random(0.7f))
+        if (a.Name != result.Name && Random(0.7f))
         {
             result.Seedless = true;
         }
diff --git a/Content.Server/Chat/Systems/ChatSystem.cs b/Content.Server/Chat/Systems/ChatSystem.cs
index 60e1f92960d..69b7f6f7969 100644
--- a/Content.Server/Chat/Systems/ChatSystem.cs
+++ b/Content.Server/Chat/Systems/ChatSystem.cs
@@ -13,7 +13,6 @@
 using Content.Shared.CCVar;
 using Content.Shared.Chat;
 using Content.Shared.Database;
-using Content.Shared.Decals;
 using Content.Shared.Ghost;
 using Content.Shared.Humanoid;
 using Content.Shared.IdentityManagement;
@@ -27,7 +26,6 @@
 using Robust.Shared.Audio.Systems;
 using Robust.Shared.Configuration;
 using Robust.Shared.Console;
-using Robust.Shared.GameObjects.Components.Localization;
 using Robust.Shared.Network;
 using Robust.Shared.Player;
 using Robust.Shared.Prototypes;
@@ -71,10 +69,6 @@ public sealed partial class ChatSystem : SharedChatSystem
     private bool _critLoocEnabled;
     private readonly bool _adminLoocEnabled = true;
 
-    [ValidatePrototypeId<ColorPalettePrototype>]
-    private const string _chatNamePalette = "Material";
-    private string[] _chatNameColors = default!;
-
     public override void Initialize()
     {
         base.Initialize();
@@ -84,13 +78,6 @@ public override void Initialize()
         _configurationManager.OnValueChanged(CCVars.CritLoocEnabled, OnCritLoocEnabledChanged, true);
 
         SubscribeLocalEvent<GameRunLevelChangedEvent>(OnGameChange);
-
-        var nameColors = _prototypeManager.Index<ColorPalettePrototype>(_chatNamePalette).Colors.Values.ToArray();
-        _chatNameColors = new string[nameColors.Length];
-        for (var i = 0; i < nameColors.Length; i++)
-        {
-            _chatNameColors[i] = nameColors[i].ToHex();
-        }
     }
 
     public override void Shutdown()
@@ -426,13 +413,8 @@ private void SendEntitySpeak(
 
         name = FormattedMessage.EscapeText(name);
 
-        // color the name unless it's something like "the old man"
-        string coloredName = name;
-        if (!TryComp<GrammarComponent>(source, out var grammar) || grammar.ProperNoun == true)
-            coloredName = $"[color={GetNameColor(name)}]{name}[/color]";
-
         var wrappedMessage = Loc.GetString(speech.Bold ? "chat-manager-entity-say-bold-wrap-message" : "chat-manager-entity-say-wrap-message",
-            ("entityName", coloredName),
+            ("entityName", name),
             ("verb", Loc.GetString(_random.Pick(speech.SpeechVerbStrings))),
             ("fontType", speech.FontId),
             ("fontSize", speech.FontSize),
@@ -501,10 +483,6 @@ private void SendEntityWhisper(
         }
         name = FormattedMessage.EscapeText(name);
 
-        // color the name unless it's something like "the old man"
-        if (!TryComp<GrammarComponent>(source, out var grammar) || grammar.ProperNoun == true)
-            name = $"[color={GetNameColor(name)}]{name}[/color]";
-
         var wrappedMessage = Loc.GetString("chat-manager-entity-whisper-wrap-message",
             ("entityName", name), ("message", FormattedMessage.EscapeText(message)));
 
@@ -645,17 +623,6 @@ private void SendDeadChat(EntityUid source, ICommonSession player, string messag
 
     #region Utility
 
-    /// <summary>
-    /// Returns the chat name color for a mob
-    /// </summary>
-    /// <param name="name">Name of the mob</param>
-    /// <returns>Hex value of the color</returns>
-    public string GetNameColor(string name)
-    {
-        var colorIdx = Math.Abs(name.GetHashCode() % _chatNameColors.Length);
-        return _chatNameColors[colorIdx];
-    }
-
     private enum MessageRangeCheckResult
     {
         Disallowed,
diff --git a/Content.Server/Communications/CommunicationsConsoleSystem.cs b/Content.Server/Communications/CommunicationsConsoleSystem.cs
index 4fa60563bdd..6b0b13c410e 100644
--- a/Content.Server/Communications/CommunicationsConsoleSystem.cs
+++ b/Content.Server/Communications/CommunicationsConsoleSystem.cs
@@ -19,6 +19,7 @@
 using Content.Shared.Chat;
 using Content.Shared.Communications;
 using Content.Shared.Database;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Emag.Components;
 using Content.Shared.Popups;
 using Robust.Server.GameObjects;
diff --git a/Content.Server/CriminalRecords/Systems/CriminalRecordsConsoleSystem.cs b/Content.Server/CriminalRecords/Systems/CriminalRecordsConsoleSystem.cs
new file mode 100644
index 00000000000..84f8ffc2e50
--- /dev/null
+++ b/Content.Server/CriminalRecords/Systems/CriminalRecordsConsoleSystem.cs
@@ -0,0 +1,232 @@
+using Content.Server.Popups;
+using Content.Server.Radio.EntitySystems;
+using Content.Server.Station.Systems;
+using Content.Server.StationRecords;
+using Content.Server.StationRecords.Systems;
+using Content.Shared.Access.Systems;
+using Content.Shared.CriminalRecords;
+using Content.Shared.CriminalRecords.Components;
+using Content.Shared.CriminalRecords.Systems;
+using Content.Shared.Security;
+using Content.Shared.StationRecords;
+using Robust.Server.GameObjects;
+using Robust.Shared.Player;
+using System.Diagnostics.CodeAnalysis;
+
+namespace Content.Server.CriminalRecords.Systems;
+
+/// <summary>
+/// Handles all UI for criminal records console
+/// </summary>
+public sealed class CriminalRecordsConsoleSystem : SharedCriminalRecordsConsoleSystem
+{
+    [Dependency] private readonly AccessReaderSystem _access = default!;
+    [Dependency] private readonly CriminalRecordsSystem _criminalRecords = default!;
+    [Dependency] private readonly PopupSystem _popup = default!;
+    [Dependency] private readonly RadioSystem _radio = default!;
+    [Dependency] private readonly SharedIdCardSystem _idCard = default!;
+    [Dependency] private readonly StationRecordsSystem _stationRecords = default!;
+    [Dependency] private readonly StationSystem _station = default!;
+    [Dependency] private readonly UserInterfaceSystem _ui = default!;
+
+    public override void Initialize()
+    {
+        SubscribeLocalEvent<CriminalRecordsConsoleComponent, RecordModifiedEvent>(UpdateUserInterface);
+        SubscribeLocalEvent<CriminalRecordsConsoleComponent, AfterGeneralRecordCreatedEvent>(UpdateUserInterface);
+
+        Subs.BuiEvents<CriminalRecordsConsoleComponent>(CriminalRecordsConsoleKey.Key, subs =>
+        {
+            subs.Event<BoundUIOpenedEvent>(UpdateUserInterface);
+            subs.Event<SelectStationRecord>(OnKeySelected);
+            subs.Event<SetStationRecordFilter>(OnFiltersChanged);
+            subs.Event<CriminalRecordChangeStatus>(OnChangeStatus);
+            subs.Event<CriminalRecordAddHistory>(OnAddHistory);
+            subs.Event<CriminalRecordDeleteHistory>(OnDeleteHistory);
+        });
+    }
+
+    private void UpdateUserInterface<T>(Entity<CriminalRecordsConsoleComponent> ent, ref T args)
+    {
+        // TODO: this is probably wasteful, maybe better to send a message to modify the exact state?
+        UpdateUserInterface(ent);
+    }
+
+    private void OnKeySelected(Entity<CriminalRecordsConsoleComponent> ent, ref SelectStationRecord msg)
+    {
+        // no concern of sus client since record retrieval will fail if invalid id is given
+        ent.Comp.ActiveKey = msg.SelectedKey;
+        UpdateUserInterface(ent);
+    }
+
+    private void OnFiltersChanged(Entity<CriminalRecordsConsoleComponent> ent, ref SetStationRecordFilter msg)
+    {
+        if (ent.Comp.Filter == null ||
+            ent.Comp.Filter.Type != msg.Type || ent.Comp.Filter.Value != msg.Value)
+        {
+            ent.Comp.Filter = new StationRecordsFilter(msg.Type, msg.Value);
+            UpdateUserInterface(ent);
+        }
+    }
+
+    private void OnChangeStatus(Entity<CriminalRecordsConsoleComponent> ent, ref CriminalRecordChangeStatus msg)
+    {
+        // prevent malf client violating wanted/reason nullability
+        if ((msg.Status == SecurityStatus.Wanted) != (msg.Reason != null))
+            return;
+
+        if (!CheckSelected(ent, msg.Session, out var mob, out var key))
+            return;
+
+        if (!_stationRecords.TryGetRecord<CriminalRecord>(key.Value, out var record) || record.Status == msg.Status)
+            return;
+
+        // validate the reason
+        string? reason = null;
+        if (msg.Reason != null)
+        {
+            reason = msg.Reason.Trim();
+            if (reason.Length < 1 || reason.Length > ent.Comp.MaxStringLength)
+                return;
+        }
+
+        // when arresting someone add it to history automatically
+        // fallback exists if the player was not set to wanted beforehand
+        if (msg.Status == SecurityStatus.Detained)
+        {
+            var oldReason = record.Reason ?? Loc.GetString("criminal-records-console-unspecified-reason");
+            var history = Loc.GetString("criminal-records-console-auto-history", ("reason", oldReason));
+            _criminalRecords.TryAddHistory(key.Value, history);
+        }
+
+        var oldStatus = record.Status;
+
+        // will probably never fail given the checks above
+        _criminalRecords.TryChangeStatus(key.Value, msg.Status, msg.Reason);
+
+        var name = RecordName(key.Value);
+        var officer = Loc.GetString("criminal-records-console-unknown-officer");
+        if (_idCard.TryFindIdCard(mob.Value, out var id) && id.Comp.FullName is {} fullName)
+            officer = fullName;
+
+        (string, object)[] args;
+        if (reason != null)
+            args = new (string, object)[] { ("name", name), ("officer", officer), ("reason", reason) };
+        else
+            args = new (string, object)[] { ("name", name), ("officer", officer) };
+
+        // figure out which radio message to send depending on transition
+        var statusString = (oldStatus, msg.Status) switch
+        {
+            // going from wanted or detained on the spot
+            (_, SecurityStatus.Detained) => "detained",
+            // prisoner did their time
+            (SecurityStatus.Detained, SecurityStatus.None) => "released",
+            // going from wanted to none, must have been a mistake
+            (_, SecurityStatus.None) => "not-wanted",
+            // going from none or detained, AOS or prisonbreak / lazy secoff never set them to released and they reoffended
+            (_, SecurityStatus.Wanted) => "wanted",
+            // this is impossible
+            _ => "not-wanted"
+        };
+        _radio.SendRadioMessage(ent, Loc.GetString($"criminal-records-console-{statusString}", args), ent.Comp.SecurityChannel, ent);
+
+        UpdateUserInterface(ent);
+    }
+
+    private void OnAddHistory(Entity<CriminalRecordsConsoleComponent> ent, ref CriminalRecordAddHistory msg)
+    {
+        if (!CheckSelected(ent, msg.Session, out _, out var key))
+            return;
+
+        var line = msg.Line.Trim();
+        if (line.Length < 1 || line.Length > ent.Comp.MaxStringLength)
+            return;
+
+        if (!_criminalRecords.TryAddHistory(key.Value, line))
+            return;
+
+        // no radio message since its not crucial to officers patrolling
+
+        UpdateUserInterface(ent);
+    }
+
+    private void OnDeleteHistory(Entity<CriminalRecordsConsoleComponent> ent, ref CriminalRecordDeleteHistory msg)
+    {
+        if (!CheckSelected(ent, msg.Session, out _, out var key))
+            return;
+
+        if (!_criminalRecords.TryDeleteHistory(key.Value, msg.Index))
+            return;
+
+        // a bit sus but not crucial to officers patrolling
+
+        UpdateUserInterface(ent);
+    }
+
+    private void UpdateUserInterface(Entity<CriminalRecordsConsoleComponent> ent)
+    {
+        var (uid, console) = ent;
+        var owningStation = _station.GetOwningStation(uid);
+
+        if (!TryComp<StationRecordsComponent>(owningStation, out var stationRecords))
+        {
+            _ui.TrySetUiState(uid, CriminalRecordsConsoleKey.Key, new CriminalRecordsConsoleState());
+            return;
+        }
+
+        var listing = _stationRecords.BuildListing((owningStation.Value, stationRecords), console.Filter);
+
+        var state = new CriminalRecordsConsoleState(listing, console.Filter);
+        if (console.ActiveKey is {} id)
+        {
+            // get records to display when a crewmember is selected
+            var key = new StationRecordKey(id, owningStation.Value);
+            _stationRecords.TryGetRecord(key, out state.StationRecord, stationRecords);
+            _stationRecords.TryGetRecord(key, out state.CriminalRecord, stationRecords);
+            state.SelectedKey = id;
+        }
+
+        _ui.TrySetUiState(uid, CriminalRecordsConsoleKey.Key, state);
+    }
+
+    /// <summary>
+    /// Boilerplate that most actions use, if they require that a record be selected.
+    /// Obviously shouldn't be used for selecting records.
+    /// </summary>
+    private bool CheckSelected(Entity<CriminalRecordsConsoleComponent> ent, ICommonSession session,
+        [NotNullWhen(true)] out EntityUid? mob, [NotNullWhen(true)] out StationRecordKey? key)
+    {
+        key = null;
+        mob = null;
+        if (session.AttachedEntity is not {} user)
+            return false;
+
+        if (!_access.IsAllowed(user, ent))
+        {
+            _popup.PopupEntity(Loc.GetString("criminal-records-permission-denied"), ent, session);
+            return false;
+        }
+
+        if (ent.Comp.ActiveKey is not {} id)
+            return false;
+
+        // checking the console's station since the user might be off-grid using on-grid console
+        if (_station.GetOwningStation(ent) is not {} station)
+            return false;
+
+        key = new StationRecordKey(id, station);
+        mob = user;
+        return true;
+    }
+
+    /// <summary>
+    /// Gets the name from a record, or empty string if this somehow fails.
+    /// </summary>
+    private string RecordName(StationRecordKey key)
+    {
+        if (!_stationRecords.TryGetRecord<GeneralStationRecord>(key, out var record))
+            return "";
+
+        return record.Name;
+    }
+}
diff --git a/Content.Server/CriminalRecords/Systems/CriminalRecordsSystem.cs b/Content.Server/CriminalRecords/Systems/CriminalRecordsSystem.cs
new file mode 100644
index 00000000000..efec18485c2
--- /dev/null
+++ b/Content.Server/CriminalRecords/Systems/CriminalRecordsSystem.cs
@@ -0,0 +1,93 @@
+using System.Diagnostics.CodeAnalysis;
+using Content.Server.StationRecords.Systems;
+using Content.Shared.CriminalRecords;
+using Content.Shared.Security;
+using Content.Shared.StationRecords;
+using Robust.Shared.Timing;
+
+namespace Content.Server.CriminalRecords.Systems;
+
+/// <summary>
+///     Criminal records
+///
+///     Criminal Records inherit Station Records' core and add role-playing tools for Security:
+///         - Ability to track a person's status (Detained/Wanted/None)
+///         - See security officers' actions in Criminal Records in the radio
+///         - See reasons for any action with no need to ask the officer personally
+/// </summary>
+public sealed class CriminalRecordsSystem : EntitySystem
+{
+    [Dependency] private readonly IGameTiming _timing = default!;
+    [Dependency] private readonly StationRecordsSystem _stationRecords = default!;
+
+    public override void Initialize()
+    {
+        base.Initialize();
+
+        SubscribeLocalEvent<AfterGeneralRecordCreatedEvent>(OnGeneralRecordCreated);
+    }
+
+    private void OnGeneralRecordCreated(AfterGeneralRecordCreatedEvent ev)
+    {
+        _stationRecords.AddRecordEntry(ev.Key, new CriminalRecord());
+        _stationRecords.Synchronize(ev.Key);
+    }
+
+    /// <summary>
+    /// Tries to change the status of the record found by the StationRecordKey.
+    /// Reason should only be passed if status is Wanted.
+    /// </summary>
+    /// <returns>True if the status is changed, false if not</returns>
+    public bool TryChangeStatus(StationRecordKey key, SecurityStatus status, string? reason)
+    {
+        // don't do anything if its the same status
+        if (!_stationRecords.TryGetRecord<CriminalRecord>(key, out var record)
+            || status == record.Status)
+            return false;
+
+        record.Status = status;
+        record.Reason = reason;
+
+        _stationRecords.Synchronize(key);
+
+        return true;
+    }
+
+    /// <summary>
+    /// Tries to add a history entry to a criminal record.
+    /// </summary>
+    /// <returns>True if adding succeeded, false if not</returns>
+    public bool TryAddHistory(StationRecordKey key, CrimeHistory entry)
+    {
+        if (!_stationRecords.TryGetRecord<CriminalRecord>(key, out var record))
+            return false;
+
+        record.History.Add(entry);
+        return true;
+    }
+
+    /// <summary>
+    /// Creates and tries to add a history entry using the current time.
+    /// </summary>
+    public bool TryAddHistory(StationRecordKey key, string line)
+    {
+        var entry = new CrimeHistory(_timing.CurTime, line);
+        return TryAddHistory(key, entry);
+    }
+
+    /// <summary>
+    /// Tries to delete a sepcific line of history from a criminal record, by index.
+    /// </summary>
+    /// <returns>True if the line was removed, false if not</returns>
+    public bool TryDeleteHistory(StationRecordKey key, uint index)
+    {
+        if (!_stationRecords.TryGetRecord<CriminalRecord>(key, out var record))
+            return false;
+
+        if (index >= record.History.Count)
+            return false;
+
+        record.History.RemoveAt((int) index);
+        return true;
+    }
+}
diff --git a/Content.Server/DeviceLinking/Components/TwoWayLeverComponent.cs b/Content.Server/DeviceLinking/Components/TwoWayLeverComponent.cs
deleted file mode 100644
index bbf78b6876b..00000000000
--- a/Content.Server/DeviceLinking/Components/TwoWayLeverComponent.cs
+++ /dev/null
@@ -1,24 +0,0 @@
-using Content.Shared.DeviceLinking;
-using Robust.Shared.Serialization.TypeSerializers.Implementations.Custom.Prototype;
-
-namespace Content.Server.DeviceLinking.Components
-{
-    [RegisterComponent]
-    public sealed partial class TwoWayLeverComponent : Component
-    {
-        [DataField("state")]
-        public TwoWayLeverState State;
-
-        [DataField("nextSignalLeft")]
-        public bool NextSignalLeft;
-
-        [DataField("leftPort", customTypeSerializer: typeof(PrototypeIdSerializer<SourcePortPrototype>))]
-        public string LeftPort = "Left";
-
-        [DataField("rightPort", customTypeSerializer: typeof(PrototypeIdSerializer<SourcePortPrototype>))]
-        public string RightPort = "Right";
-
-        [DataField("middlePort", customTypeSerializer: typeof(PrototypeIdSerializer<SourcePortPrototype>))]
-        public string MiddlePort = "Middle";
-    }
-}
diff --git a/Content.Server/DeviceLinking/Events/SignalReceivedEvent.cs b/Content.Server/DeviceLinking/Events/SignalReceivedEvent.cs
index c1928575feb..c8c611103d9 100644
--- a/Content.Server/DeviceLinking/Events/SignalReceivedEvent.cs
+++ b/Content.Server/DeviceLinking/Events/SignalReceivedEvent.cs
@@ -1,4 +1,5 @@
 using Content.Server.DeviceNetwork;
+using Content.Shared.DeviceNetwork;
 
 namespace Content.Server.DeviceLinking.Events;
 
diff --git a/Content.Server/DeviceLinking/Systems/DeviceLinkSystem.cs b/Content.Server/DeviceLinking/Systems/DeviceLinkSystem.cs
index 47f632843d3..e54e21316f2 100644
--- a/Content.Server/DeviceLinking/Systems/DeviceLinkSystem.cs
+++ b/Content.Server/DeviceLinking/Systems/DeviceLinkSystem.cs
@@ -4,6 +4,7 @@
 using Content.Server.DeviceNetwork.Components;
 using Content.Server.DeviceNetwork.Systems;
 using Content.Shared.DeviceLinking;
+using Content.Shared.DeviceNetwork;
 
 namespace Content.Server.DeviceLinking.Systems;
 
@@ -35,15 +36,7 @@ public override void Update(float frameTime)
     }
 
     #region Sending & Receiving
-    /// <summary>
-    /// Sends a network payload directed at the sink entity.
-    /// Just raises a <see cref="SignalReceivedEvent"/> without data if the source or the sink doesn't have a <see cref="DeviceNetworkComponent"/>
-    /// </summary>
-    /// <param name="uid">The source uid that invokes the port</param>
-    /// <param name="port">The port to invoke</param>
-    /// <param name="data">Optional data to send along</param>
-    /// <param name="sourceComponent"></param>
-    public void InvokePort(EntityUid uid, string port, NetworkPayload? data = null, DeviceLinkSourceComponent? sourceComponent = null)
+    public override void InvokePort(EntityUid uid, string port, NetworkPayload? data = null, DeviceLinkSourceComponent? sourceComponent = null)
     {
         if (!Resolve(uid, ref sourceComponent) || !sourceComponent.Outputs.TryGetValue(port, out var sinks))
             return;
diff --git a/Content.Server/DeviceLinking/Systems/DoorSignalControlSystem.cs b/Content.Server/DeviceLinking/Systems/DoorSignalControlSystem.cs
index 56a754a7562..40feda32f2b 100644
--- a/Content.Server/DeviceLinking/Systems/DoorSignalControlSystem.cs
+++ b/Content.Server/DeviceLinking/Systems/DoorSignalControlSystem.cs
@@ -1,6 +1,7 @@
 using Content.Server.DeviceLinking.Components;
 using Content.Server.DeviceNetwork;
 using Content.Server.Doors.Systems;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Doors.Components;
 using Content.Shared.Doors;
 using JetBrains.Annotations;
@@ -59,8 +60,7 @@ private void OnSignalReceived(EntityUid uid, DoorSignalControlComponent componen
             {
                 if (state == SignalState.High || state == SignalState.Momentary)
                 {
-                    if (door.State is DoorState.Closed or DoorState.Open)
-                        _doorSystem.TryToggleDoor(uid, door);
+                    _doorSystem.TryToggleDoor(uid, door);
                 }
             }
             else if (args.Port == component.InBolt)
diff --git a/Content.Server/DeviceLinking/Systems/SignalTimerSystem.cs b/Content.Server/DeviceLinking/Systems/SignalTimerSystem.cs
index 0426ee7cc36..f9c2d3430e9 100644
--- a/Content.Server/DeviceLinking/Systems/SignalTimerSystem.cs
+++ b/Content.Server/DeviceLinking/Systems/SignalTimerSystem.cs
@@ -68,7 +68,7 @@ public void Trigger(EntityUid uid, SignalTimerComponent signalTimer)
 
         if (TryComp<AppearanceComponent>(uid, out var appearance))
         {
-            _appearanceSystem.SetData(uid, TextScreenVisuals.ScreenText, new[] { signalTimer.Label }, appearance);
+            _appearanceSystem.SetData(uid, TextScreenVisuals.ScreenText, signalTimer.Label, appearance);
         }
 
         _audio.PlayPvs(signalTimer.DoneSound, uid);
@@ -142,7 +142,7 @@ private void OnTextChangedMessage(EntityUid uid, SignalTimerComponent component,
         component.Label = args.Text[..Math.Min(5, args.Text.Length)];
 
         if (!HasComp<ActiveSignalTimerComponent>(uid))
-            _appearanceSystem.SetData(uid, TextScreenVisuals.ScreenText, new string?[] { component.Label });
+            _appearanceSystem.SetData(uid, TextScreenVisuals.ScreenText, component.Label);
     }
 
     /// <summary>
@@ -186,7 +186,7 @@ public void OnStartTimer(EntityUid uid, SignalTimerComponent component)
         if (appearance != null)
         {
             _appearanceSystem.SetData(uid, TextScreenVisuals.TargetTime, timer.TriggerTime, appearance);
-            _appearanceSystem.SetData(uid, TextScreenVisuals.ScreenText, new string?[] { }, appearance);
+            _appearanceSystem.SetData(uid, TextScreenVisuals.ScreenText, string.Empty, appearance);
         }
 
         _signalSystem.InvokePort(uid, component.StartPort);
diff --git a/Content.Server/DeviceNetwork/NetworkPayload.cs b/Content.Server/DeviceNetwork/NetworkPayload.cs
deleted file mode 100644
index eefbaa6eea5..00000000000
--- a/Content.Server/DeviceNetwork/NetworkPayload.cs
+++ /dev/null
@@ -1,26 +0,0 @@
-using Robust.Shared.Utility;
-using System.Diagnostics.CodeAnalysis;
-
-namespace Content.Server.DeviceNetwork
-{
-    public sealed class NetworkPayload : Dictionary<string, object?>
-    {
-        /// <summary>
-        /// Tries to get a value from the payload and checks if that value is of type  T.
-        /// </summary>
-        /// <typeparam name="T">The type that should be casted to</typeparam>
-        /// <returns>Whether the value was present in the payload and of the required type</returns>
-        public bool TryGetValue<T>(string key, [NotNullWhen(true)] out T? value)
-        {
-            if (this.TryCastValue(key, out T? result))
-            {
-                value = result;
-                return true;
-            }
-
-            value = default;
-            return false;
-        }
-    }
-
-}
diff --git a/Content.Server/DeviceNetwork/Systems/Devices/ApcNetSwitchSystem.cs b/Content.Server/DeviceNetwork/Systems/Devices/ApcNetSwitchSystem.cs
index 11dc628df1c..9a4a81a4c0a 100644
--- a/Content.Server/DeviceNetwork/Systems/Devices/ApcNetSwitchSystem.cs
+++ b/Content.Server/DeviceNetwork/Systems/Devices/ApcNetSwitchSystem.cs
@@ -1,5 +1,6 @@
 using Content.Server.DeviceNetwork.Components;
 using Content.Server.DeviceNetwork.Components.Devices;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Interaction;
 
 namespace Content.Server.DeviceNetwork.Systems.Devices
diff --git a/Content.Server/Disposal/Mailing/MailingUnitSystem.cs b/Content.Server/Disposal/Mailing/MailingUnitSystem.cs
index 1a819ab0fb1..001abad3dcd 100644
--- a/Content.Server/Disposal/Mailing/MailingUnitSystem.cs
+++ b/Content.Server/Disposal/Mailing/MailingUnitSystem.cs
@@ -4,6 +4,7 @@
 using Content.Server.DeviceNetwork.Systems;
 using Content.Server.Disposal.Unit.EntitySystems;
 using Content.Server.Power.Components;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Disposal;
 using Content.Shared.Interaction;
 using Robust.Server.GameObjects;
diff --git a/Content.Server/Disposal/Unit/EntitySystems/DisposableSystem.cs b/Content.Server/Disposal/Unit/EntitySystems/DisposableSystem.cs
index cc9d2f711b3..eb3cda4db9b 100644
--- a/Content.Server/Disposal/Unit/EntitySystems/DisposableSystem.cs
+++ b/Content.Server/Disposal/Unit/EntitySystems/DisposableSystem.cs
@@ -36,8 +36,6 @@ public sealed class DisposableSystem : EntitySystem
         private EntityQuery<PhysicsComponent> _physicsQuery;
         private EntityQuery<TransformComponent> _xformQuery;
 
-        private List<EntityUid> _entList = new();
-
         public override void Initialize()
         {
             base.Initialize();
@@ -119,15 +117,17 @@ public void ExitDisposals(EntityUid uid, DisposalHolderComponent? holder = null,
                 }
             }
 
-            _entList.Clear();
-            _entList.AddRange(holder.Container.ContainedEntities);
-
-            foreach (var entity in _entList)
+            // We're purposely iterating over all the holder's children
+            // because the holder might have something teleported into it,
+            // outside the usual container insertion logic.
+            var children = holderTransform.ChildEnumerator;
+            while (children.MoveNext(out var entity))
             {
                 RemComp<BeingDisposedComponent>(entity);
 
                 var meta = _metaQuery.GetComponent(entity);
-                _containerSystem.Remove((entity, null, meta), holder.Container, reparent: false, force: true);
+                if (holder.Container.Contains(entity))
+                    _containerSystem.Remove((entity, null, meta), holder.Container, reparent: false, force: true);
 
                 var xform = _xformQuery.GetComponent(entity);
                 if (xform.ParentUid != uid)
diff --git a/Content.Server/Doors/Systems/DoorSystem.cs b/Content.Server/Doors/Systems/DoorSystem.cs
index fffc0a4e1fa..d59ea596229 100644
--- a/Content.Server/Doors/Systems/DoorSystem.cs
+++ b/Content.Server/Doors/Systems/DoorSystem.cs
@@ -136,13 +136,13 @@ protected override void HandleCollide(EntityUid uid, DoorComponent door, ref Sta
         if (!door.BumpOpen)
             return;
 
-        if (door.State != DoorState.Closed)
+        if (door.State is not (DoorState.Closed or DoorState.Denying))
             return;
 
         var otherUid = args.OtherEntity;
 
         if (Tags.HasTag(otherUid, "DoorBumpOpener"))
-            TryOpen(uid, door, otherUid);
+            TryOpen(uid, door, otherUid, quiet: door.State == DoorState.Denying);
     }
     private void OnEmagged(EntityUid uid, DoorComponent door, ref GotEmaggedEvent args)
     {
diff --git a/Content.Server/Electrocution/ElectrocutionSystem.cs b/Content.Server/Electrocution/ElectrocutionSystem.cs
index aac500f34f8..f71f8b69742 100644
--- a/Content.Server/Electrocution/ElectrocutionSystem.cs
+++ b/Content.Server/Electrocution/ElectrocutionSystem.cs
@@ -62,9 +62,7 @@ public sealed class ElectrocutionSystem : SharedElectrocutionSystem
     [ValidatePrototypeId<DamageTypePrototype>]
     private const string DamageType = "Shock";
 
-    // Yes, this is absurdly small for a reason.
-    private const float ElectrifiedScalePerWatt = 1E-6f;
-
+    // Multiply and shift the log scale for shock damage.
     private const float RecursiveDamageMultiplier = 0.75f;
     private const float RecursiveTimeMultiplier = 0.8f;
 
@@ -214,6 +212,16 @@ private void OnElectrifiedInteractUsing(EntityUid uid, ElectrifiedComponent elec
         TryDoElectrifiedAct(uid, args.User, siemens, electrified);
     }
 
+    private float CalculateElectrifiedDamageScale(float power)
+    {
+        // A logarithm allows a curve of damage that grows quickly, but slows down dramatically past a value. This keeps the damage to a reasonable range.
+        const float DamageShift = 1.67f; // Shifts the curve for an overall higher or lower damage baseline
+        const float CeilingCoefficent = 1.35f; // Adjusts the approach to maximum damage, higher = Higher top damage
+        const float LogGrowth = 0.00001f; // Adjusts the growth speed of the curve
+
+        return DamageShift + MathF.Log(power * LogGrowth) * CeilingCoefficent;
+    }
+
     public bool TryDoElectrifiedAct(EntityUid uid, EntityUid targetUid,
         float siemens = 1,
         ElectrifiedComponent? electrified = null,
@@ -264,7 +272,9 @@ public bool TryDoElectrifiedAct(EntityUid uid, EntityUid targetUid,
             return false;
 
         // Initial damage scales off of the available supply on the principle that the victim has shorted the entire powernet through their body.
-        var damageScale = supp * ElectrifiedScalePerWatt;
+        var damageScale = CalculateElectrifiedDamageScale(supp);
+        if (damageScale <= 0f)
+            return false;
 
         {
             var lastRet = true;
@@ -275,7 +285,7 @@ public bool TryDoElectrifiedAct(EntityUid uid, EntityUid targetUid,
                     entity,
                     uid,
                     node,
-                    (int) (electrified.ShockDamage * damageScale * MathF.Pow(RecursiveDamageMultiplier, depth)),
+                    (int) MathF.Ceiling(electrified.ShockDamage * damageScale * MathF.Pow(RecursiveDamageMultiplier, depth)),
                     TimeSpan.FromSeconds(electrified.ShockTime * MathF.Min(1f + MathF.Log2(1f + damageScale), 3f) * MathF.Pow(RecursiveTimeMultiplier, depth)),
                     true,
                     electrified.SiemensCoefficient);
diff --git a/Content.Server/Fax/FaxSystem.cs b/Content.Server/Fax/FaxSystem.cs
index f25fb625425..5fee750c1d9 100644
--- a/Content.Server/Fax/FaxSystem.cs
+++ b/Content.Server/Fax/FaxSystem.cs
@@ -12,6 +12,7 @@
 using Content.Shared.Administration.Logs;
 using Content.Shared.Containers.ItemSlots;
 using Content.Shared.Database;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Emag.Components;
 using Content.Shared.Emag.Systems;
 using Content.Shared.Fax;
diff --git a/Content.Server/Fluids/EntitySystems/PuddleSystem.Evaporation.cs b/Content.Server/Fluids/EntitySystems/PuddleSystem.Evaporation.cs
index f3489ba7c6b..2a80c338360 100644
--- a/Content.Server/Fluids/EntitySystems/PuddleSystem.Evaporation.cs
+++ b/Content.Server/Fluids/EntitySystems/PuddleSystem.Evaporation.cs
@@ -13,10 +13,7 @@ public sealed partial class PuddleSystem
     [ValidatePrototypeId<ReagentPrototype>]
     private const string Water = "Water";
 
-    [ValidatePrototypeId<ReagentPrototype>]
-    private const string SoapyWater = "SoapyWater";
-
-    public static string[] EvaporationReagents = new[] { Water, SoapyWater };
+    public static string[] EvaporationReagents = new[] { Water };
 
     private void OnEvaporationMapInit(Entity<EvaporationComponent> entity, ref MapInitEvent args)
     {
diff --git a/Content.Server/GameTicking/GameTicker.RoundFlow.cs b/Content.Server/GameTicking/GameTicker.RoundFlow.cs
index 4f1c21706f0..02a58ed23df 100644
--- a/Content.Server/GameTicking/GameTicker.RoundFlow.cs
+++ b/Content.Server/GameTicking/GameTicker.RoundFlow.cs
@@ -527,9 +527,6 @@ private void ResettingCleanup()
             {
                 _playerGameStatuses[session.UserId] = LobbyEnabled ? PlayerGameStatus.NotReadyToPlay : PlayerGameStatus.ReadyToPlay;
             }
-
-            // Put a bangin' donk on it.
-            _audio.PlayGlobal(_audio.GetSound(new SoundCollectionSpecifier("RoundEnd")), Filter.Broadcast(), true);
         }
 
         public bool DelayStart(TimeSpan time)
diff --git a/Content.Server/Glue/GlueSystem.cs b/Content.Server/Glue/GlueSystem.cs
index 9409a423c44..6bb6aca3ad2 100644
--- a/Content.Server/Glue/GlueSystem.cs
+++ b/Content.Server/Glue/GlueSystem.cs
@@ -77,13 +77,16 @@ public override void Update(float frameTime)
     {
         base.Update(frameTime);
 
-        var query = EntityQueryEnumerator<GluedComponent, UnremoveableComponent>();
-        while (query.MoveNext(out var uid, out var glue, out _))
+        var query = EntityQueryEnumerator<GluedComponent, UnremoveableComponent, MetaDataComponent>();
+        while (query.MoveNext(out var uid, out var glue, out var _, out var meta))
         {
             if (_timing.CurTime < glue.Until)
                 continue;
 
-            _metaData.SetEntityName(uid, glue.BeforeGluedEntityName);
+            // Instead of string matching, just reconstruct the expected name and compare
+            if (meta.EntityName == Loc.GetString("glued-name-prefix", ("target", glue.BeforeGluedEntityName)))
+                _metaData.SetEntityName(uid, glue.BeforeGluedEntityName);
+
             RemComp<UnremoveableComponent>(uid);
             RemComp<GluedComponent>(uid);
         }
diff --git a/Content.Server/Implants/SubdermalImplantSystem.cs b/Content.Server/Implants/SubdermalImplantSystem.cs
index 7f6f6fd0459..ac415a04342 100644
--- a/Content.Server/Implants/SubdermalImplantSystem.cs
+++ b/Content.Server/Implants/SubdermalImplantSystem.cs
@@ -131,6 +131,7 @@ private void OnScramImplant(EntityUid uid, SubdermalImplantComponent component,
                 break;
         }
         _xform.SetWorldPosition(ent, targetCoords.Position);
+        _xform.AttachToGridOrMap(ent, xform);
         _audio.PlayPvs(implant.TeleportSound, ent);
 
         args.Handled = true;
diff --git a/Content.Server/Medical/Components/HealthAnalyzerComponent.cs b/Content.Server/Medical/Components/HealthAnalyzerComponent.cs
index 39b1df573f2..0002f275c5b 100644
--- a/Content.Server/Medical/Components/HealthAnalyzerComponent.cs
+++ b/Content.Server/Medical/Components/HealthAnalyzerComponent.cs
@@ -1,32 +1,54 @@
-using Content.Server.UserInterface;
-using Content.Shared.MedicalScanner;
-using Robust.Server.GameObjects;
 using Robust.Shared.Audio;
+using Robust.Shared.Serialization.TypeSerializers.Implementations.Custom;
 
-namespace Content.Server.Medical.Components
+namespace Content.Server.Medical.Components;
+
+/// <summary>
+/// After scanning, retrieves the target Uid to use with its related UI.
+/// </summary>
+[RegisterComponent]
+[Access(typeof(HealthAnalyzerSystem))]
+public sealed partial class HealthAnalyzerComponent : Component
 {
     /// <summary>
-    ///    After scanning, retrieves the target Uid to use with its related UI.
+    /// When should the next update be sent for the patient
+    /// </summary>
+    [DataField(customTypeSerializer: typeof(TimeOffsetSerializer))]
+    public TimeSpan NextUpdate = TimeSpan.Zero;
+
+    /// <summary>
+    /// The delay between patient health updates
+    /// </summary>
+    [DataField]
+    public TimeSpan UpdateInterval = TimeSpan.FromSeconds(1);
+
+    /// <summary>
+    /// How long it takes to scan someone.
+    /// </summary>
+    [DataField]
+    public TimeSpan ScanDelay = TimeSpan.FromSeconds(0.8);
+
+    /// <summary>
+    /// Which entity has been scanned, for continuous updates
+    /// </summary>
+    [DataField]
+    public EntityUid? ScannedEntity;
+
+    /// <summary>
+    /// The maximum range in tiles at which the analyzer can receive continuous updates
+    /// </summary>
+    [DataField]
+    public float MaxScanRange = 2.5f;
+
+    /// <summary>
+    /// Sound played on scanning begin
+    /// </summary>
+    [DataField]
+    public SoundSpecifier? ScanningBeginSound;
+
+    /// <summary>
+    /// Sound played on scanning end
     /// </summary>
-    [RegisterComponent]
-    public sealed partial class HealthAnalyzerComponent : Component
-    {
-        /// <summary>
-        /// How long it takes to scan someone.
-        /// </summary>
-        [DataField("scanDelay")]
-        public float ScanDelay = 0.8f;
-
-        /// <summary>
-        ///     Sound played on scanning begin
-        /// </summary>
-        [DataField("scanningBeginSound")]
-        public SoundSpecifier? ScanningBeginSound;
-
-        /// <summary>
-        ///     Sound played on scanning end
-        /// </summary>
-        [DataField("scanningEndSound")]
-        public SoundSpecifier? ScanningEndSound;
-    }
+    [DataField]
+    public SoundSpecifier? ScanningEndSound;
 }
diff --git a/Content.Server/Medical/CrewMonitoring/CrewMonitoringServerSystem.cs b/Content.Server/Medical/CrewMonitoring/CrewMonitoringServerSystem.cs
index 785ef60af90..bff7f1565a1 100644
--- a/Content.Server/Medical/CrewMonitoring/CrewMonitoringServerSystem.cs
+++ b/Content.Server/Medical/CrewMonitoring/CrewMonitoringServerSystem.cs
@@ -4,6 +4,7 @@
 using Content.Server.Medical.SuitSensors;
 using Content.Server.Power.Components;
 using Content.Server.Station.Systems;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Medical.SuitSensor;
 using Robust.Shared.Timing;
 
diff --git a/Content.Server/Medical/CryoPodSystem.cs b/Content.Server/Medical/CryoPodSystem.cs
index 2f08dfddd17..25a47933a84 100644
--- a/Content.Server/Medical/CryoPodSystem.cs
+++ b/Content.Server/Medical/CryoPodSystem.cs
@@ -195,7 +195,8 @@ private void OnActivateUI(Entity<CryoPodComponent> entity, ref AfterActivatableU
             (bloodstream != null && _solutionContainerSystem.ResolveSolution(entity.Comp.BodyContainer.ContainedEntity.Value,
                 bloodstream.BloodSolutionName, ref bloodstream.BloodSolution, out var bloodSolution))
                 ? bloodSolution.FillFraction
-                : 0
+                : 0,
+            null
         ));
     }
 
diff --git a/Content.Server/Medical/HealthAnalyzerSystem.cs b/Content.Server/Medical/HealthAnalyzerSystem.cs
index d9559a96264..5c7d265e615 100644
--- a/Content.Server/Medical/HealthAnalyzerSystem.cs
+++ b/Content.Server/Medical/HealthAnalyzerSystem.cs
@@ -6,94 +6,195 @@
 using Content.Shared.Damage;
 using Content.Shared.DoAfter;
 using Content.Shared.Interaction;
+using Content.Shared.Interaction.Events;
 using Content.Shared.MedicalScanner;
 using Content.Shared.Mobs.Components;
+using Content.Shared.PowerCell;
 using Robust.Server.GameObjects;
 using Robust.Shared.Audio.Systems;
+using Robust.Shared.Containers;
 using Robust.Shared.Player;
+using Robust.Shared.Timing;
 
-namespace Content.Server.Medical
+namespace Content.Server.Medical;
+
+public sealed class HealthAnalyzerSystem : EntitySystem
 {
-    public sealed class HealthAnalyzerSystem : EntitySystem
+    [Dependency] private readonly IGameTiming _timing = default!;
+    [Dependency] private readonly PowerCellSystem _cell = default!;
+    [Dependency] private readonly SharedAudioSystem _audio = default!;
+    [Dependency] private readonly SharedDoAfterSystem _doAfterSystem = default!;
+    [Dependency] private readonly SolutionContainerSystem _solutionContainerSystem = default!;
+    [Dependency] private readonly UserInterfaceSystem _uiSystem = default!;
+    [Dependency] private readonly TransformSystem _transformSystem = default!;
+
+    public override void Initialize()
     {
-        [Dependency] private readonly PowerCellSystem _cell = default!;
-        [Dependency] private readonly SharedAudioSystem _audio = default!;
-        [Dependency] private readonly SharedDoAfterSystem _doAfterSystem = default!;
-        [Dependency] private readonly SolutionContainerSystem _solutionContainerSystem = default!;
-        [Dependency] private readonly UserInterfaceSystem _uiSystem = default!;
+        SubscribeLocalEvent<HealthAnalyzerComponent, EntityUnpausedEvent>(OnEntityUnpaused);
+        SubscribeLocalEvent<HealthAnalyzerComponent, AfterInteractEvent>(OnAfterInteract);
+        SubscribeLocalEvent<HealthAnalyzerComponent, HealthAnalyzerDoAfterEvent>(OnDoAfter);
+        SubscribeLocalEvent<HealthAnalyzerComponent, EntGotInsertedIntoContainerMessage>(OnInsertedIntoContainer);
+        SubscribeLocalEvent<HealthAnalyzerComponent, PowerCellSlotEmptyEvent>(OnPowerCellSlotEmpty);
+        SubscribeLocalEvent<HealthAnalyzerComponent, DroppedEvent>(OnDropped);
+    }
 
-        public override void Initialize()
+    public override void Update(float frameTime)
+    {
+        var analyzerQuery = EntityQueryEnumerator<HealthAnalyzerComponent, TransformComponent>();
+        while (analyzerQuery.MoveNext(out var uid, out var component, out var transform))
         {
-            base.Initialize();
-            SubscribeLocalEvent<HealthAnalyzerComponent, AfterInteractEvent>(OnAfterInteract);
-            SubscribeLocalEvent<HealthAnalyzerComponent, HealthAnalyzerDoAfterEvent>(OnDoAfter);
-        }
+            //Update rate limited to 1 second
+            if (component.NextUpdate > _timing.CurTime)
+                continue;
 
-        private void OnAfterInteract(Entity<HealthAnalyzerComponent> entity, ref AfterInteractEvent args)
-        {
-            if (args.Target == null || !args.CanReach || !HasComp<MobStateComponent>(args.Target) || !_cell.HasActivatableCharge(entity.Owner, user: args.User))
-                return;
+            if (component.ScannedEntity is not {} patient)
+                continue;
 
-            _audio.PlayPvs(entity.Comp.ScanningBeginSound, entity);
+            component.NextUpdate = _timing.CurTime + component.UpdateInterval;
 
-            _doAfterSystem.TryStartDoAfter(new DoAfterArgs(EntityManager, args.User, TimeSpan.FromSeconds(entity.Comp.ScanDelay), new HealthAnalyzerDoAfterEvent(), entity.Owner, target: args.Target, used: entity.Owner)
+            //Get distance between health analyzer and the scanned entity
+            var patientCoordinates = Transform(patient).Coordinates;
+            if (!patientCoordinates.InRange(EntityManager, _transformSystem, transform.Coordinates, component.MaxScanRange))
             {
-                BreakOnTargetMove = true,
-                BreakOnUserMove = true,
-                NeedHand = true
-            });
+                //Range too far, disable updates
+                StopAnalyzingEntity((uid, component), patient);
+                continue;
+            }
+
+            UpdateScannedUser(uid, patient, true);
         }
+    }
 
-        private void OnDoAfter(Entity<HealthAnalyzerComponent> entity, ref HealthAnalyzerDoAfterEvent args)
-        {
-            if (args.Handled || args.Cancelled || args.Target == null || !_cell.TryUseActivatableCharge(entity.Owner, user: args.User))
-                return;
+    private void OnEntityUnpaused(Entity<HealthAnalyzerComponent> ent, ref EntityUnpausedEvent args)
+    {
+        ent.Comp.NextUpdate += args.PausedTime;
+    }
 
-            _audio.PlayPvs(entity.Comp.ScanningEndSound, args.User);
+    /// <summary>
+    /// Trigger the doafter for scanning
+    /// </summary>
+    private void OnAfterInteract(Entity<HealthAnalyzerComponent> uid, ref AfterInteractEvent args)
+    {
+        if (args.Target == null || !args.CanReach || !HasComp<MobStateComponent>(args.Target) || !_cell.HasDrawCharge(uid, user: args.User))
+            return;
 
-            UpdateScannedUser(entity, args.User, args.Target.Value, entity.Comp);
-            args.Handled = true;
-        }
+        _audio.PlayPvs(uid.Comp.ScanningBeginSound, uid);
 
-        private void OpenUserInterface(EntityUid user, EntityUid analyzer)
+        _doAfterSystem.TryStartDoAfter(new DoAfterArgs(EntityManager, args.User, uid.Comp.ScanDelay, new HealthAnalyzerDoAfterEvent(), uid, target: args.Target, used: uid)
         {
-            if (!TryComp<ActorComponent>(user, out var actor) || !_uiSystem.TryGetUi(analyzer, HealthAnalyzerUiKey.Key, out var ui))
-                return;
+            BreakOnTargetMove = true,
+            BreakOnUserMove = true,
+            NeedHand = true
+        });
+    }
 
-            _uiSystem.OpenUi(ui ,actor.PlayerSession);
-        }
+    private void OnDoAfter(Entity<HealthAnalyzerComponent> uid, ref HealthAnalyzerDoAfterEvent args)
+    {
+        if (args.Handled || args.Cancelled || args.Target == null || !_cell.HasDrawCharge(uid, user: args.User))
+            return;
 
-        public void UpdateScannedUser(EntityUid uid, EntityUid user, EntityUid? target, HealthAnalyzerComponent? healthAnalyzer)
-        {
-            if (!Resolve(uid, ref healthAnalyzer))
-                return;
-
-            if (target == null || !_uiSystem.TryGetUi(uid, HealthAnalyzerUiKey.Key, out var ui))
-                return;
-
-            if (!HasComp<DamageableComponent>(target))
-                return;
-
-            float bodyTemperature;
-            if (TryComp<TemperatureComponent>(target, out var temp))
-                bodyTemperature = temp.CurrentTemperature;
-            else
-                bodyTemperature = float.NaN;
-
-            float bloodAmount;
-            if (TryComp<BloodstreamComponent>(target, out var bloodstream) &&
-                _solutionContainerSystem.ResolveSolution(target.Value, bloodstream.BloodSolutionName, ref bloodstream.BloodSolution, out var bloodSolution))
-                bloodAmount = bloodSolution.FillFraction;
-            else
-                bloodAmount = float.NaN;
-
-            OpenUserInterface(user, uid);
-
-            _uiSystem.SendUiMessage(ui, new HealthAnalyzerScannedUserMessage(
-                GetNetEntity(target),
-                bodyTemperature,
-                bloodAmount
-            ));
-        }
+        _audio.PlayPvs(uid.Comp.ScanningEndSound, uid);
+
+        OpenUserInterface(args.User, uid);
+        BeginAnalyzingEntity(uid, args.Target.Value);
+        args.Handled = true;
+    }
+
+    /// <summary>
+    /// Turn off when placed into a storage item or moved between slots/hands
+    /// </summary>
+    private void OnInsertedIntoContainer(Entity<HealthAnalyzerComponent> uid, ref EntGotInsertedIntoContainerMessage args)
+    {
+        if (uid.Comp.ScannedEntity is { } patient)
+            StopAnalyzingEntity(uid, patient);
+    }
+
+    /// <summary>
+    /// Disable continuous updates once battery is dead
+    /// </summary>
+    private void OnPowerCellSlotEmpty(Entity<HealthAnalyzerComponent> uid, ref PowerCellSlotEmptyEvent args)
+    {
+        if (uid.Comp.ScannedEntity is { } patient)
+            StopAnalyzingEntity(uid, patient);
+    }
+
+    /// <summary>
+    /// Turn off the analyser when dropped
+    /// </summary>
+    private void OnDropped(Entity<HealthAnalyzerComponent> uid, ref DroppedEvent args)
+    {
+        if (uid.Comp.ScannedEntity is { } patient)
+            StopAnalyzingEntity(uid, patient);
+    }
+
+    private void OpenUserInterface(EntityUid user, EntityUid analyzer)
+    {
+        if (!TryComp<ActorComponent>(user, out var actor) || !_uiSystem.TryGetUi(analyzer, HealthAnalyzerUiKey.Key, out var ui))
+            return;
+
+        _uiSystem.OpenUi(ui, actor.PlayerSession);
+    }
+
+    /// <summary>
+    /// Mark the entity as having its health analyzed, and link the analyzer to it
+    /// </summary>
+    /// <param name="healthAnalyzer">The health analyzer that should receive the updates</param>
+    /// <param name="target">The entity to start analyzing</param>
+    private void BeginAnalyzingEntity(Entity<HealthAnalyzerComponent> healthAnalyzer, EntityUid target)
+    {
+        //Link the health analyzer to the scanned entity
+        healthAnalyzer.Comp.ScannedEntity = target;
+
+        _cell.SetPowerCellDrawEnabled(healthAnalyzer, true);
+
+        UpdateScannedUser(healthAnalyzer, target, true);
+    }
+
+    /// <summary>
+    /// Remove the analyzer from the active list, and remove the component if it has no active analyzers
+    /// </summary>
+    /// <param name="healthAnalyzer">The health analyzer that's receiving the updates</param>
+    /// <param name="target">The entity to analyze</param>
+    private void StopAnalyzingEntity(Entity<HealthAnalyzerComponent> healthAnalyzer, EntityUid target)
+    {
+        //Unlink the analyzer
+        healthAnalyzer.Comp.ScannedEntity = null;
+
+        _cell.SetPowerCellDrawEnabled(target, false);
+
+        UpdateScannedUser(healthAnalyzer, target, false);
+    }
+
+    /// <summary>
+    /// Send an update for the target to the healthAnalyzer
+    /// </summary>
+    /// <param name="healthAnalyzer">The health analyzer</param>
+    /// <param name="target">The entity being scanned</param>
+    /// <param name="scanMode">True makes the UI show ACTIVE, False makes the UI show INACTIVE</param>
+    public void UpdateScannedUser(EntityUid healthAnalyzer, EntityUid target, bool scanMode)
+    {
+        if (!_uiSystem.TryGetUi(healthAnalyzer, HealthAnalyzerUiKey.Key, out var ui))
+            return;
+
+        if (!HasComp<DamageableComponent>(target))
+            return;
+
+        var bodyTemperature = float.NaN;
+
+        if (TryComp<TemperatureComponent>(target, out var temp))
+            bodyTemperature = temp.CurrentTemperature;
+
+        var bloodAmount = float.NaN;
+
+        if (TryComp<BloodstreamComponent>(target, out var bloodstream) &&
+            _solutionContainerSystem.ResolveSolution(target, bloodstream.BloodSolutionName, ref bloodstream.BloodSolution, out var bloodSolution))
+            bloodAmount = bloodSolution.FillFraction;
+
+        _uiSystem.SendUiMessage(ui, new HealthAnalyzerScannedUserMessage(
+            GetNetEntity(target),
+            bodyTemperature,
+            bloodAmount,
+            scanMode
+        ));
     }
 }
diff --git a/Content.Server/Medical/SuitSensors/SuitSensorComponent.cs b/Content.Server/Medical/SuitSensors/SuitSensorComponent.cs
index 32b81e2921a..5de11f848cd 100644
--- a/Content.Server/Medical/SuitSensors/SuitSensorComponent.cs
+++ b/Content.Server/Medical/SuitSensors/SuitSensorComponent.cs
@@ -72,4 +72,17 @@ public sealed partial class SuitSensorComponent : Component
     /// </summary>
     [DataField("server")]
     public string? ConnectedServer = null;
+
+    /// <summary>
+    /// The previous mode of the suit. This is used to restore the state when an EMP effect ends.
+    /// </summary>
+    [DataField, ViewVariables]
+    public SuitSensorMode PreviousMode = SuitSensorMode.SensorOff;
+
+    /// <summary>
+    ///  The previous locked status of the controls.  This is used to restore the state when an EMP effect ends.
+    ///  This keeps prisoner jumpsuits/internal implants from becoming unlocked after an EMP.
+    /// </summary>
+    [DataField, ViewVariables]
+    public bool PreviousControlsLocked = false;
 }
diff --git a/Content.Server/Medical/SuitSensors/SuitSensorSystem.cs b/Content.Server/Medical/SuitSensors/SuitSensorSystem.cs
index bb662a15ea2..38a7b0a4517 100644
--- a/Content.Server/Medical/SuitSensors/SuitSensorSystem.cs
+++ b/Content.Server/Medical/SuitSensors/SuitSensorSystem.cs
@@ -2,11 +2,14 @@
 using Content.Server.DeviceNetwork;
 using Content.Server.DeviceNetwork.Components;
 using Content.Server.DeviceNetwork.Systems;
+using Content.Server.Emp;
 using Content.Server.GameTicking;
 using Content.Server.Medical.CrewMonitoring;
 using Content.Server.Popups;
 using Content.Server.Station.Systems;
 using Content.Shared.Damage;
+using Content.Shared.DeviceNetwork;
+using Content.Shared.Emp;
 using Content.Shared.Examine;
 using Content.Shared.Inventory.Events;
 using Content.Shared.Medical.SuitSensor;
@@ -44,6 +47,8 @@ public override void Initialize()
         SubscribeLocalEvent<SuitSensorComponent, GetVerbsEvent<Verb>>(OnVerb);
         SubscribeLocalEvent<SuitSensorComponent, EntGotInsertedIntoContainerMessage>(OnInsert);
         SubscribeLocalEvent<SuitSensorComponent, EntGotRemovedFromContainerMessage>(OnRemove);
+        SubscribeLocalEvent<SuitSensorComponent, EmpPulseEvent>(OnEmpPulse);
+        SubscribeLocalEvent<SuitSensorComponent, EmpDisabledRemoved>(OnEmpFinished);
     }
 
     private void OnUnpaused(EntityUid uid, SuitSensorComponent component, ref EntityUnpausedEvent args)
@@ -239,6 +244,24 @@ private void OnRemove(EntityUid uid, SuitSensorComponent component, EntGotRemove
         component.User = null;
     }
 
+    private void OnEmpPulse(EntityUid uid, SuitSensorComponent component, ref EmpPulseEvent args)
+    {
+        args.Affected = true;
+        args.Disabled = true;
+
+        component.PreviousMode = component.Mode;
+        SetSensor(uid, SuitSensorMode.SensorOff, null, component);
+
+        component.PreviousControlsLocked = component.ControlsLocked;
+        component.ControlsLocked = true;
+    }
+
+    private void OnEmpFinished(EntityUid uid, SuitSensorComponent component, ref EmpDisabledRemoved args)
+    {
+        SetSensor(uid, component.PreviousMode, null, component);
+        component.ControlsLocked = component.PreviousControlsLocked;
+    }
+
     private Verb CreateVerb(EntityUid uid, SuitSensorComponent component, EntityUid userUid, SuitSensorMode mode)
     {
         return new Verb()
diff --git a/Content.Server/Mind/Commands/RenameCommand.cs b/Content.Server/Mind/Commands/RenameCommand.cs
index bb7d89ddf59..834453fb198 100644
--- a/Content.Server/Mind/Commands/RenameCommand.cs
+++ b/Content.Server/Mind/Commands/RenameCommand.cs
@@ -68,18 +68,14 @@ public void Execute(IConsoleShell shell, string argStr, string[] args)
                 // This is done here because ID cards are linked to station records
                 if (_entManager.TrySystem<StationRecordsSystem>(out var recordsSystem)
                     && _entManager.TryGetComponent(idCard, out StationRecordKeyStorageComponent? keyStorage)
-                    && keyStorage.Key != null)
+                    && keyStorage.Key is {} key)
                 {
-                    var origin = keyStorage.Key.Value.OriginStation;
-
-                    if (recordsSystem.TryGetRecord<GeneralStationRecord>(origin,
-                            keyStorage.Key.Value,
-                            out var generalRecord))
+                    if (recordsSystem.TryGetRecord<GeneralStationRecord>(key, out var generalRecord))
                     {
                         generalRecord.Name = name;
                     }
 
-                    recordsSystem.Synchronize(origin);
+                    recordsSystem.Synchronize(key);
                 }
             }
         }
diff --git a/Content.Server/Pointing/EntitySystems/PointingSystem.cs b/Content.Server/Pointing/EntitySystems/PointingSystem.cs
index 6fcdfcf994b..a7c455e6a5d 100644
--- a/Content.Server/Pointing/EntitySystems/PointingSystem.cs
+++ b/Content.Server/Pointing/EntitySystems/PointingSystem.cs
@@ -1,7 +1,6 @@
 using System.Linq;
 using Content.Server.Administration.Logs;
 using Content.Server.Pointing.Components;
-using Content.Shared.Bed.Sleep;
 using Content.Shared.Database;
 using Content.Shared.Examine;
 using Content.Shared.Eye;
@@ -10,13 +9,13 @@
 using Content.Shared.Input;
 using Content.Shared.Interaction;
 using Content.Shared.Mind;
-using Content.Shared.Mobs.Systems;
 using Content.Shared.Pointing;
 using Content.Shared.Popups;
 using JetBrains.Annotations;
 using Robust.Server.GameObjects;
 using Robust.Server.Player;
 using Robust.Shared.Enums;
+using Robust.Shared.GameStates;
 using Robust.Shared.Input.Binding;
 using Robust.Shared.Map;
 using Robust.Shared.Player;
@@ -34,7 +33,6 @@ internal sealed class PointingSystem : SharedPointingSystem
         [Dependency] private readonly ITileDefinitionManager _tileDefinitionManager = default!;
         [Dependency] private readonly IGameTiming _gameTiming = default!;
         [Dependency] private readonly RotateToFaceSystem _rotateToFaceSystem = default!;
-        [Dependency] private readonly MobStateSystem _mobState = default!;
         [Dependency] private readonly SharedPopupSystem _popup = default!;
         [Dependency] private readonly VisibilitySystem _visibilitySystem = default!;
         [Dependency] private readonly SharedMindSystem _minds = default!;
@@ -50,6 +48,15 @@ internal sealed class PointingSystem : SharedPointingSystem
 
         private const float PointingRange = 15f;
 
+        private void GetCompState(Entity<PointingArrowComponent> entity, ref ComponentGetState args)
+        {
+            args.State = new SharedPointingArrowComponentState
+            {
+                StartPosition = entity.Comp.StartPosition,
+                EndTime = entity.Comp.EndTime
+            };
+        }
+
         private void OnPlayerStatusChanged(object? sender, SessionStatusEventArgs e)
         {
             if (e.NewStatus != SessionStatus.Disconnected)
@@ -97,7 +104,7 @@ public bool InRange(EntityUid pointer, EntityCoordinates coordinates)
             }
         }
 
-        public bool TryPoint(ICommonSession? session, EntityCoordinates coords, EntityUid pointed)
+        public bool TryPoint(ICommonSession? session, EntityCoordinates coordsPointed, EntityUid pointed)
         {
             if (session?.AttachedEntity is not { } player)
             {
@@ -105,9 +112,9 @@ public bool TryPoint(ICommonSession? session, EntityCoordinates coords, EntityUi
                 return false;
             }
 
-            if (!coords.IsValid(EntityManager))
+            if (!coordsPointed.IsValid(EntityManager))
             {
-                Log.Warning($"Player {ToPrettyString(player)} attempted to point at invalid coordinates: {coords}");
+                Log.Warning($"Player {ToPrettyString(player)} attempted to point at invalid coordinates: {coordsPointed}");
                 return false;
             }
 
@@ -123,33 +130,30 @@ public bool TryPoint(ICommonSession? session, EntityCoordinates coords, EntityUi
                 return false;
             }
 
-            // Checking mob state directly instead of some action blocker, as many action blockers are blocked for
-            // ghosts and there is no obvious choice for pointing.
-            if (_mobState.IsIncapacitated(player))
-            {
-                return false;
-            }
-
-            if (HasComp<SleepingComponent>(player))
+            if (!CanPoint(player))
             {
                 return false;
             }
 
-            if (!InRange(player, coords))
+            if (!InRange(player, coordsPointed))
             {
                 _popup.PopupEntity(Loc.GetString("pointing-system-try-point-cannot-reach"), player, player);
                 return false;
             }
 
+            var mapCoordsPointed = coordsPointed.ToMap(EntityManager);
+            _rotateToFaceSystem.TryFaceCoordinates(player, mapCoordsPointed.Position);
 
-            var mapCoords = coords.ToMap(EntityManager);
-            _rotateToFaceSystem.TryFaceCoordinates(player, mapCoords.Position);
-
-            var arrow = EntityManager.SpawnEntity("PointingArrow", coords);
+            var arrow = EntityManager.SpawnEntity("PointingArrow", coordsPointed);
 
             if (TryComp<PointingArrowComponent>(arrow, out var pointing))
             {
-                pointing.EndTime = _gameTiming.CurTime + TimeSpan.FromSeconds(4);
+                if (TryComp(player, out TransformComponent? xformPlayer))
+                    pointing.StartPosition = EntityCoordinates.FromMap(arrow, xformPlayer.Coordinates.ToMap(EntityManager)).Position;
+
+                pointing.EndTime = _gameTiming.CurTime + PointDuration;
+
+                Dirty(arrow, pointing);
             }
 
             if (EntityQuery<PointingArrowAngeringComponent>().FirstOrDefault() != null)
@@ -215,10 +219,10 @@ bool ViewerPredicate(ICommonSession playerSession)
                 TileRef? tileRef = null;
                 string? position = null;
 
-                if (_mapManager.TryFindGridAt(mapCoords, out var gridUid, out var grid))
+                if (_mapManager.TryFindGridAt(mapCoordsPointed, out var gridUid, out var grid))
                 {
-                    position = $"EntId={gridUid} {grid.WorldToTile(mapCoords.Position)}";
-                    tileRef = grid.GetTileRef(grid.WorldToTile(mapCoords.Position));
+                    position = $"EntId={gridUid} {grid.WorldToTile(mapCoordsPointed.Position)}";
+                    tileRef = grid.GetTileRef(grid.WorldToTile(mapCoordsPointed.Position));
                 }
 
                 var tileDef = _tileDefinitionManager[tileRef?.Tile.TypeId ?? 0];
@@ -228,7 +232,7 @@ bool ViewerPredicate(ICommonSession playerSession)
 
                 viewerMessage = Loc.GetString("pointing-system-other-point-at-tile", ("otherName", playerName), ("tileName", name));
 
-                _adminLogger.Add(LogType.Action, LogImpact.Low, $"{ToPrettyString(player):user} pointed at {name} {(position == null ? mapCoords : position)}");
+                _adminLogger.Add(LogType.Action, LogImpact.Low, $"{ToPrettyString(player):user} pointed at {name} {(position == null ? mapCoordsPointed : position)}");
             }
 
             _pointers[session] = _gameTiming.CurTime;
@@ -242,6 +246,8 @@ public override void Initialize()
         {
             base.Initialize();
 
+            SubscribeLocalEvent<PointingArrowComponent, ComponentGetState>(GetCompState);
+
             SubscribeNetworkEvent<PointingAttemptEvent>(OnPointAttempt);
 
             _playerManager.PlayerStatusChanged += OnPlayerStatusChanged;
@@ -255,8 +261,8 @@ private void OnPointAttempt(PointingAttemptEvent ev, EntitySessionEventArgs args
         {
             var target = GetEntity(ev.Target);
 
-            if (TryComp(target, out TransformComponent? xform))
-                TryPoint(args.SenderSession, xform.Coordinates, target);
+            if (TryComp(target, out TransformComponent? xformTarget))
+                TryPoint(args.SenderSession, xformTarget.Coordinates, target);
             else
                 Log.Warning($"User {args.SenderSession} attempted to point at a non-existent entity uid: {ev.Target}");
         }
diff --git a/Content.Server/Power/Generation/Teg/TegSystem.cs b/Content.Server/Power/Generation/Teg/TegSystem.cs
index 54f40a1bf34..3510a3da45d 100644
--- a/Content.Server/Power/Generation/Teg/TegSystem.cs
+++ b/Content.Server/Power/Generation/Teg/TegSystem.cs
@@ -7,6 +7,7 @@
 using Content.Server.NodeContainer;
 using Content.Server.NodeContainer.Nodes;
 using Content.Server.Power.Components;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Examine;
 using Content.Shared.Power.Generation.Teg;
 using Content.Shared.Rounding;
diff --git a/Content.Server/Remotes/DoorRemoteSystem.cs b/Content.Server/Remotes/DoorRemoteSystem.cs
index c63b2295c16..a88508ce53d 100644
--- a/Content.Server/Remotes/DoorRemoteSystem.cs
+++ b/Content.Server/Remotes/DoorRemoteSystem.cs
@@ -10,6 +10,7 @@
 using Content.Server.Power.EntitySystems;
 using Content.Shared.Database;
 using Content.Shared.Interaction.Events;
+using Content.Shared.Examine;
 using static Content.Server.Remotes.DoorRemoteComponent;
 
 namespace Content.Server.Remotes
@@ -65,10 +66,9 @@ private void OnBeforeInteract(EntityUid uid, DoorRemoteComponent component, Befo
             if (args.Handled
                 || args.Target == null
                 || !TryComp<DoorComponent>(args.Target, out var doorComp) // If it isn't a door we don't use it
-                // The remote can be used anywhere the user can see the door.
-                // This doesn't work that well, but I don't know of an alternative
-                || !_interactionSystem.InRangeUnobstructed(args.User, args.Target.Value,
-                    SharedInteractionSystem.MaxRaycastRange, CollisionGroup.Opaque))
+                // Only able to control doors if they are within your vision and within your max range.
+                // Not affected by mobs or machines anymore.
+                || !ExamineSystemShared.InRangeUnOccluded(args.User, args.Target.Value, SharedInteractionSystem.MaxRaycastRange, null))
             {
                 return;
             }
diff --git a/Content.Server/Resist/EscapeInventorySystem.cs b/Content.Server/Resist/EscapeInventorySystem.cs
index 56e0684aae8..8973540487f 100644
--- a/Content.Server/Resist/EscapeInventorySystem.cs
+++ b/Content.Server/Resist/EscapeInventorySystem.cs
@@ -7,6 +7,7 @@
 using Content.Shared.Interaction.Events;
 using Content.Shared.Inventory;
 using Content.Shared.Movement.Events;
+using Content.Shared.Movement.Systems;
 using Content.Shared.Resist;
 using Content.Shared.Storage;
 using Robust.Shared.Containers;
@@ -38,6 +39,9 @@ public override void Initialize()
 
     private void OnRelayMovement(EntityUid uid, CanEscapeInventoryComponent component, ref MoveInputEvent args)
     {
+        if (!args.HasDirectionalMovement)
+            return;
+
         if (!_containerSystem.TryGetContainingContainer(uid, out var container) || !_actionBlockerSystem.CanInteract(uid, container.Owner))
             return;
 
diff --git a/Content.Server/RoundEnd/RoundEndSystem.cs b/Content.Server/RoundEnd/RoundEndSystem.cs
index 4114ace8d7e..b8d057a47dc 100644
--- a/Content.Server/RoundEnd/RoundEndSystem.cs
+++ b/Content.Server/RoundEnd/RoundEndSystem.cs
@@ -14,6 +14,7 @@
 using Content.Server.Station.Components;
 using Content.Server.Station.Systems;
 using Content.Shared.Database;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.GameTicking;
 using Robust.Shared.Audio;
 using Robust.Shared.Audio.Systems;
diff --git a/Content.Server/SensorMonitoring/BatterySensorSystem.cs b/Content.Server/SensorMonitoring/BatterySensorSystem.cs
index 20e990b14c3..eb2ab21075c 100644
--- a/Content.Server/SensorMonitoring/BatterySensorSystem.cs
+++ b/Content.Server/SensorMonitoring/BatterySensorSystem.cs
@@ -1,6 +1,7 @@
 using Content.Server.DeviceNetwork;
 using Content.Server.DeviceNetwork.Systems;
 using Content.Server.Power.Components;
+using Content.Shared.DeviceNetwork;
 
 namespace Content.Server.SensorMonitoring;
 
diff --git a/Content.Server/SensorMonitoring/SensorMonitoringConsoleSystem.cs b/Content.Server/SensorMonitoring/SensorMonitoringConsoleSystem.cs
index fdd340ba0ae..ddd7812394e 100644
--- a/Content.Server/SensorMonitoring/SensorMonitoringConsoleSystem.cs
+++ b/Content.Server/SensorMonitoring/SensorMonitoringConsoleSystem.cs
@@ -10,13 +10,13 @@
 using Content.Shared.Atmos.Monitor;
 using Content.Shared.Atmos.Piping.Binary.Components;
 using Content.Shared.Atmos.Piping.Unary.Components;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.DeviceNetwork.Components;
 using Content.Shared.DeviceNetwork.Systems;
 using Content.Shared.SensorMonitoring;
 using Robust.Server.GameObjects;
 using Robust.Shared.Timing;
 using Robust.Shared.Utility;
-using ConsoleUIState = Content.Shared.SensorMonitoring.SensorMonitoringConsoleBoundInterfaceState;
 
 namespace Content.Server.SensorMonitoring;
 
diff --git a/Content.Server/Shuttles/Systems/ArrivalsSystem.cs b/Content.Server/Shuttles/Systems/ArrivalsSystem.cs
index 6503e4bf517..08f3481cd72 100644
--- a/Content.Server/Shuttles/Systems/ArrivalsSystem.cs
+++ b/Content.Server/Shuttles/Systems/ArrivalsSystem.cs
@@ -16,6 +16,7 @@
 using Content.Server.Station.Systems;
 using Content.Shared.Administration;
 using Content.Shared.CCVar;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Mobs.Components;
 using Content.Shared.Movement.Components;
 using Content.Shared.Parallax.Biomes;
diff --git a/Content.Server/Shuttles/Systems/EmergencyShuttleSystem.Console.cs b/Content.Server/Shuttles/Systems/EmergencyShuttleSystem.Console.cs
index 37c70c4e486..b589a526403 100644
--- a/Content.Server/Shuttles/Systems/EmergencyShuttleSystem.Console.cs
+++ b/Content.Server/Shuttles/Systems/EmergencyShuttleSystem.Console.cs
@@ -8,6 +8,7 @@
 using Content.Shared.Access;
 using Content.Shared.CCVar;
 using Content.Shared.Database;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Popups;
 using Content.Shared.Shuttles.BUIStates;
 using Content.Shared.Shuttles.Events;
diff --git a/Content.Server/Shuttles/Systems/EmergencyShuttleSystem.cs b/Content.Server/Shuttles/Systems/EmergencyShuttleSystem.cs
index d984c727376..d9ba2de3e59 100644
--- a/Content.Server/Shuttles/Systems/EmergencyShuttleSystem.cs
+++ b/Content.Server/Shuttles/Systems/EmergencyShuttleSystem.cs
@@ -5,7 +5,6 @@
 using Content.Server.Administration.Managers;
 using Content.Server.Chat.Systems;
 using Content.Server.Communications;
-using Content.Server.DeviceNetwork;
 using Content.Server.DeviceNetwork.Components;
 using Content.Server.DeviceNetwork.Systems;
 using Content.Server.GameTicking.Events;
@@ -19,6 +18,7 @@
 using Content.Shared.Access.Systems;
 using Content.Shared.CCVar;
 using Content.Shared.Database;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Shuttles.Components;
 using Content.Shared.Shuttles.Events;
 using Content.Shared.Tag;
diff --git a/Content.Server/Silicons/Borgs/BorgSystem.cs b/Content.Server/Silicons/Borgs/BorgSystem.cs
index 0efbe1a40ab..869c2797047 100644
--- a/Content.Server/Silicons/Borgs/BorgSystem.cs
+++ b/Content.Server/Silicons/Borgs/BorgSystem.cs
@@ -14,6 +14,7 @@
 using Content.Shared.Mobs;
 using Content.Shared.Mobs.Systems;
 using Content.Shared.Movement.Systems;
+using Content.Shared.Pointing;
 using Content.Shared.PowerCell;
 using Content.Shared.PowerCell.Components;
 using Content.Shared.Roles;
@@ -67,6 +68,7 @@ public override void Initialize()
         SubscribeLocalEvent<BorgChassisComponent, GetCharactedDeadIcEvent>(OnGetDeadIC);
 
         SubscribeLocalEvent<BorgBrainComponent, MindAddedMessage>(OnBrainMindAdded);
+        SubscribeLocalEvent<BorgBrainComponent, PointAttemptEvent>(OnBrainPointAttempt);
 
         InitializeModules();
         InitializeMMI();
@@ -242,6 +244,11 @@ private void OnBrainMindAdded(EntityUid uid, BorgBrainComponent component, MindA
         _mind.TransferTo(mindId, containerEnt, mind: mind);
     }
 
+    private void OnBrainPointAttempt(EntityUid uid, BorgBrainComponent component, PointAttemptEvent args)
+    {
+        args.Cancel();
+    }
+
     private void UpdateBatteryAlert(EntityUid uid, PowerCellSlotComponent? slotComponent = null)
     {
         if (!_powerCell.TryGetBatteryFromSlot(uid, out var battery, slotComponent))
diff --git a/Content.Server/Silicons/Laws/SiliconLawSystem.cs b/Content.Server/Silicons/Laws/SiliconLawSystem.cs
index 17a3d16413b..4584a9e88b5 100644
--- a/Content.Server/Silicons/Laws/SiliconLawSystem.cs
+++ b/Content.Server/Silicons/Laws/SiliconLawSystem.cs
@@ -121,14 +121,19 @@ private void OnDirectedGetLaws(EntityUid uid, SiliconLawProviderComponent compon
 
     private void OnIonStormLaws(EntityUid uid, SiliconLawProviderComponent component, ref IonStormLawsEvent args)
     {
-        component.Lawset = args.Lawset;
+        // Emagged borgs are immune to ion storm
+        if (!HasComp<EmaggedComponent>(uid))
+        {
+            component.Lawset = args.Lawset;
 
-        // gotta tell player to check their laws
-        NotifyLawsChanged(uid);
+            // gotta tell player to check their laws
+            NotifyLawsChanged(uid);
 
-        // new laws may allow antagonist behaviour so make it clear for admins
-        if (TryComp<EmagSiliconLawComponent>(uid, out var emag))
-            EnsureEmaggedRole(uid, emag);
+            // new laws may allow antagonist behaviour so make it clear for admins
+            if (TryComp<EmagSiliconLawComponent>(uid, out var emag))
+                EnsureEmaggedRole(uid, emag);
+
+        }
     }
 
     private void OnEmagLawsAdded(EntityUid uid, SiliconLawProviderComponent component, ref GotEmaggedEvent args)
@@ -148,7 +153,7 @@ private void OnEmagLawsAdded(EntityUid uid, SiliconLawProviderComponent componen
         component.Lawset?.Laws.Add(new SiliconLaw
         {
             LawString = Loc.GetString("law-emag-secrecy", ("faction", Loc.GetString(component.Lawset.ObeysTo))),
-            Order = component.Lawset.Laws.Count
+            Order = component.Lawset.Laws.Max(law => law.Order) + 1
         });
     }
 
diff --git a/Content.Server/Singularity/Components/RadiationCollectorComponent.cs b/Content.Server/Singularity/Components/RadiationCollectorComponent.cs
index 30522c28f3a..7870234aab6 100644
--- a/Content.Server/Singularity/Components/RadiationCollectorComponent.cs
+++ b/Content.Server/Singularity/Components/RadiationCollectorComponent.cs
@@ -11,12 +11,22 @@ namespace Content.Server.Singularity.Components;
 public sealed partial class RadiationCollectorComponent : Component
 {
     /// <summary>
-    ///     How much joules will collector generate for each rad.
+    ///     Power output (in Watts) per unit of radiation collected.
     /// </summary>
     [DataField]
     [ViewVariables(VVAccess.ReadWrite)]
     public float ChargeModifier = 30000f;
 
+    /// <summary>
+    ///     Number of power ticks that the power supply can remain active for. This is needed since
+    ///     power and radiation don't update at the same tickrate, and since radiation does not provide
+    ///     an update when radiation is removed. When this goes to zero, zero out the power supplier
+    ///     to model the radiation source going away.
+    /// </summary>
+    [DataField]
+    [ViewVariables(VVAccess.ReadWrite)]
+    public int PowerTicksLeft = 0;
+
     /// <summary>
     ///     Is the machine enabled.
     /// </summary>
diff --git a/Content.Server/Singularity/EntitySystems/RadiationCollectorSystem.cs b/Content.Server/Singularity/EntitySystems/RadiationCollectorSystem.cs
index 83666776a05..92b963e2017 100644
--- a/Content.Server/Singularity/EntitySystems/RadiationCollectorSystem.cs
+++ b/Content.Server/Singularity/EntitySystems/RadiationCollectorSystem.cs
@@ -38,6 +38,7 @@ public override void Initialize()
         SubscribeLocalEvent<RadiationCollectorComponent, MapInitEvent>(OnMapInit);
         SubscribeLocalEvent<RadiationCollectorComponent, EntInsertedIntoContainerMessage>(OnTankChanged);
         SubscribeLocalEvent<RadiationCollectorComponent, EntRemovedFromContainerMessage>(OnTankChanged);
+        SubscribeLocalEvent<NetworkBatteryPostSync>(PostSync);
     }
 
     private bool TryGetLoadedGasTank(EntityUid uid, [NotNullWhen(true)] out GasTankComponent? gasTankComponent)
@@ -107,20 +108,34 @@ private void OnRadiation(EntityUid uid, RadiationCollectorComponent component, O
             }
         }
 
-        // No idea if this is even vaguely accurate to the previous logic.
-        // The maths is copied from that logic even though it works differently.
-        // But the previous logic would also make the radiation collectors never ever stop providing energy.
-        // And since frameTime was used there, I'm assuming that this is what the intent was.
-        // This still won't stop things being potentially hilariously unbalanced though.
-        if (TryComp<BatteryComponent>(uid, out var batteryComponent))
+        if (TryComp<PowerSupplierComponent>(uid, out var comp))
         {
-            _batterySystem.SetCharge(uid, charge, batteryComponent);
+            int powerHoldoverTicks = _gameTiming.TickRate * 2; // number of ticks to hold radiation
+            component.PowerTicksLeft = powerHoldoverTicks;
+            comp.MaxSupply = component.Enabled ? charge : 0;
         }
 
         // Update appearance
         UpdatePressureIndicatorAppearance(uid, component, gasTankComponent);
     }
 
+    private void PostSync(NetworkBatteryPostSync ev)
+    {
+        // This is run every power tick. Used to decrement the PowerTicksLeft counter.
+        var query = EntityQueryEnumerator<RadiationCollectorComponent>();
+        while (query.MoveNext(out var uid, out var component))
+        {
+            if (component.PowerTicksLeft > 0)
+            {
+                component.PowerTicksLeft -= 1;
+            }
+            else if (TryComp<PowerSupplierComponent>(uid, out var comp))
+            {
+                comp.MaxSupply = 0;
+            }
+        }
+    }
+
     private void OnExamined(EntityUid uid, RadiationCollectorComponent component, ExaminedEvent args)
     {
         if (!TryGetLoadedGasTank(uid, out var gasTank))
diff --git a/Content.Server/StationEvents/Events/ClericalErrorRule.cs b/Content.Server/StationEvents/Events/ClericalErrorRule.cs
index c1b4cd93343..dd4473952cb 100644
--- a/Content.Server/StationEvents/Events/ClericalErrorRule.cs
+++ b/Content.Server/StationEvents/Events/ClericalErrorRule.cs
@@ -29,15 +29,16 @@ protected override void Started(EntityUid uid, ClericalErrorRuleComponent compon
         var min = (int) Math.Max(1, Math.Round(component.MinToRemove * recordCount));
         var max = (int) Math.Max(min, Math.Round(component.MaxToRemove * recordCount));
         var toRemove = RobustRandom.Next(min, max);
-        var keys = new List<StationRecordKey>();
+        var keys = new List<uint>();
         for (var i = 0; i < toRemove; i++)
         {
             keys.Add(RobustRandom.Pick(stationRecords.Records.Keys));
         }
 
-        foreach (var key in keys)
+        foreach (var id in keys)
         {
-            _stationRecords.RemoveRecord(chosenStation.Value, key, stationRecords);
+            var key = new StationRecordKey(id, chosenStation.Value);
+            _stationRecords.RemoveRecord(key, stationRecords);
         }
     }
 }
diff --git a/Content.Server/StationRecords/Components/GeneralStationRecordConsoleComponent.cs b/Content.Server/StationRecords/Components/GeneralStationRecordConsoleComponent.cs
index e5b7f7a260b..9076bee436f 100644
--- a/Content.Server/StationRecords/Components/GeneralStationRecordConsoleComponent.cs
+++ b/Content.Server/StationRecords/Components/GeneralStationRecordConsoleComponent.cs
@@ -1,10 +1,21 @@
+using Content.Server.StationRecords.Systems;
 using Content.Shared.StationRecords;
 
-namespace Content.Server.StationRecords;
+namespace Content.Server.StationRecords.Components;
 
-[RegisterComponent]
+[RegisterComponent, Access(typeof(GeneralStationRecordConsoleSystem))]
 public sealed partial class GeneralStationRecordConsoleComponent : Component
 {
-    public (NetEntity, uint)? ActiveKey { get; set; }
-    public GeneralStationRecordsFilter? Filter { get; set; }
+    /// <summary>
+    /// Selected crewmember record id.
+    /// Station always uses the station that owns the console.
+    /// </summary>
+    [DataField]
+    public uint? ActiveKey;
+
+    /// <summary>
+    /// Qualities to filter a search by.
+    /// </summary>
+    [DataField]
+    public StationRecordsFilter? Filter;
 }
diff --git a/Content.Server/StationRecords/StationRecordSet.cs b/Content.Server/StationRecords/StationRecordSet.cs
index 2f6b220a783..b5a4501cea7 100644
--- a/Content.Server/StationRecords/StationRecordSet.cs
+++ b/Content.Server/StationRecords/StationRecordSet.cs
@@ -6,9 +6,10 @@
 namespace Content.Server.StationRecords;
 
 /// <summary>
-///     Set of station records. StationRecordsComponent stores these.
-///     Keyed by StationRecordKey, which should be obtained from
+///     Set of station records for a single station. StationRecordsComponent stores these.
+///     Keyed by the record id, which should be obtained from
 ///     an entity that stores a reference to it.
+///     A StationRecordKey has both the station entity (use to get the record set) and id (use for this).
 /// </summary>
 [DataDefinition]
 public sealed partial class StationRecordSet
@@ -16,22 +17,31 @@ public sealed partial class StationRecordSet
     [DataField("currentRecordId")]
     private uint _currentRecordId;
 
-    // TODO add custom type serializer so that keys don't have to be written twice.
-    [DataField("keys")]
-    public HashSet<StationRecordKey> Keys = new();
+    /// <summary>
+    /// Every key id that has a record(s) stored.
+    /// Presumably this is faster than iterating the dictionary to check if any tables have a key.
+    /// </summary>
+    [DataField]
+    public HashSet<uint> Keys = new();
 
-    [DataField("recentlyAccessed")]
-    private HashSet<StationRecordKey> _recentlyAccessed = new();
+    /// <summary>
+    /// Recently accessed key ids which are used to synchronize them efficiently.
+    /// </summary>
+    [DataField]
+    private HashSet<uint> _recentlyAccessed = new();
 
-    [DataField("tables")] // TODO ensure all of this data is serializable.
-    private Dictionary<Type, Dictionary<StationRecordKey, object>> _tables = new();
+    /// <summary>
+    /// Dictionary between a record's type and then each record indexed by id.
+    /// </summary>
+    [DataField]
+    private Dictionary<Type, Dictionary<uint, object>> _tables = new();
 
     /// <summary>
     ///     Gets all records of a specific type stored in the record set.
     /// </summary>
     /// <typeparam name="T">The type of record to fetch.</typeparam>
     /// <returns>An enumerable object that contains a pair of both a station key, and the record associated with it.</returns>
-    public IEnumerable<(StationRecordKey, T)> GetRecordsOfType<T>()
+    public IEnumerable<(uint, T)> GetRecordsOfType<T>()
     {
         if (!_tables.ContainsKey(typeof(T)))
         {
@@ -52,43 +62,44 @@ public sealed partial class StationRecordSet
     }
 
     /// <summary>
-    ///     Add an entry into a record.
+    /// Create a new record with an entry.
+    /// Returns an id that can only be used to access the record for this station.
     /// </summary>
     /// <param name="entry">Entry to add.</param>
     /// <typeparam name="T">Type of the entry that's being added.</typeparam>
-    public StationRecordKey AddRecordEntry<T>(EntityUid station, T entry)
+    public uint? AddRecordEntry<T>(T entry)
     {
         if (entry == null)
-            return StationRecordKey.Invalid;
+            return null;
 
-        var key = new StationRecordKey(_currentRecordId++, station);
+        var key = _currentRecordId++;
         AddRecordEntry(key, entry);
         return key;
     }
 
     /// <summary>
-    ///     Add an entry into a record.
+    ///     Add an entry into an existing record.
     /// </summary>
-    /// <param name="key">Key for the record.</param>
+    /// <param name="key">Key id for the record.</param>
     /// <param name="entry">Entry to add.</param>
     /// <typeparam name="T">Type of the entry that's being added.</typeparam>
-    public void AddRecordEntry<T>(StationRecordKey key, T entry)
+    public void AddRecordEntry<T>(uint key, T entry)
     {
         if (entry == null)
             return;
 
-        if (Keys.Add(key))
-            _tables.GetOrNew(typeof(T))[key] = entry;
+        Keys.Add(key);
+        _tables.GetOrNew(typeof(T))[key] = entry;
     }
 
     /// <summary>
     ///     Try to get an record entry by type, from this record key.
     /// </summary>
-    /// <param name="key">The StationRecordKey to get the entries from.</param>
+    /// <param name="key">The record id to get the entries from.</param>
     /// <param name="entry">The entry that is retrieved from the record set.</param>
     /// <typeparam name="T">The type of entry to search for.</typeparam>
     /// <returns>True if the record exists and was retrieved, false otherwise.</returns>
-    public bool TryGetRecordEntry<T>(StationRecordKey key, [NotNullWhen(true)] out T? entry)
+    public bool TryGetRecordEntry<T>(uint key, [NotNullWhen(true)] out T? entry)
     {
         entry = default;
 
@@ -108,10 +119,10 @@ public bool TryGetRecordEntry<T>(StationRecordKey key, [NotNullWhen(true)] out T
     /// <summary>
     ///     Checks if the record associated with this key has an entry of a certain type.
     /// </summary>
-    /// <param name="key">The record key.</param>
+    /// <param name="key">The record key id.</param>
     /// <typeparam name="T">Type to check.</typeparam>
     /// <returns>True if the entry exists, false otherwise.</returns>
-    public bool HasRecordEntry<T>(StationRecordKey key)
+    public bool HasRecordEntry<T>(uint key)
     {
         return Keys.Contains(key)
                && _tables.TryGetValue(typeof(T), out var table)
@@ -122,7 +133,7 @@ public bool HasRecordEntry<T>(StationRecordKey key)
     ///     Get the recently accessed keys from this record set.
     /// </summary>
     /// <returns>All recently accessed keys from this record set.</returns>
-    public IEnumerable<StationRecordKey> GetRecentlyAccessed()
+    public IEnumerable<uint> GetRecentlyAccessed()
     {
         return _recentlyAccessed.ToArray();
     }
@@ -135,17 +146,23 @@ public void ClearRecentlyAccessed()
         _recentlyAccessed.Clear();
     }
 
+    /// <summary>
+    /// Removes a recently accessed key from the set.
+    /// </summary>
+    public void RemoveFromRecentlyAccessed(uint key)
+    {
+        _recentlyAccessed.Remove(key);
+    }
+
     /// <summary>
     ///     Removes all record entries related to this key from this set.
     /// </summary>
     /// <param name="key">The key to remove.</param>
     /// <returns>True if successful, false otherwise.</returns>
-    public bool RemoveAllRecords(StationRecordKey key)
+    public bool RemoveAllRecords(uint key)
     {
         if (!Keys.Remove(key))
-        {
             return false;
-        }
 
         foreach (var table in _tables.Values)
         {
diff --git a/Content.Server/StationRecords/Systems/GeneralStationRecordConsoleSystem.cs b/Content.Server/StationRecords/Systems/GeneralStationRecordConsoleSystem.cs
index f69caaa9a7e..721eff6f2cf 100644
--- a/Content.Server/StationRecords/Systems/GeneralStationRecordConsoleSystem.cs
+++ b/Content.Server/StationRecords/Systems/GeneralStationRecordConsoleSystem.cs
@@ -1,5 +1,6 @@
 using System.Linq;
 using Content.Server.Station.Systems;
+using Content.Server.StationRecords.Components;
 using Content.Shared.StationRecords;
 using Robust.Server.GameObjects;
 
@@ -7,126 +8,78 @@ namespace Content.Server.StationRecords.Systems;
 
 public sealed class GeneralStationRecordConsoleSystem : EntitySystem
 {
-    [Dependency] private readonly UserInterfaceSystem _userInterface = default!;
-    [Dependency] private readonly StationSystem _stationSystem = default!;
-    [Dependency] private readonly StationRecordsSystem _stationRecordsSystem = default!;
+    [Dependency] private readonly UserInterfaceSystem _ui = default!;
+    [Dependency] private readonly StationSystem _station = default!;
+    [Dependency] private readonly StationRecordsSystem _stationRecords = default!;
 
     public override void Initialize()
     {
-        SubscribeLocalEvent<GeneralStationRecordConsoleComponent, BoundUIOpenedEvent>(UpdateUserInterface);
-        SubscribeLocalEvent<GeneralStationRecordConsoleComponent, SelectGeneralStationRecord>(OnKeySelected);
-        SubscribeLocalEvent<GeneralStationRecordConsoleComponent, GeneralStationRecordsFilterMsg>(OnFiltersChanged);
         SubscribeLocalEvent<GeneralStationRecordConsoleComponent, RecordModifiedEvent>(UpdateUserInterface);
         SubscribeLocalEvent<GeneralStationRecordConsoleComponent, AfterGeneralRecordCreatedEvent>(UpdateUserInterface);
         SubscribeLocalEvent<GeneralStationRecordConsoleComponent, RecordRemovedEvent>(UpdateUserInterface);
+
+        Subs.BuiEvents<GeneralStationRecordConsoleComponent>(GeneralStationRecordConsoleKey.Key, subs =>
+        {
+            subs.Event<BoundUIOpenedEvent>(UpdateUserInterface);
+            subs.Event<SelectStationRecord>(OnKeySelected);
+            subs.Event<SetStationRecordFilter>(OnFiltersChanged);
+        });
     }
 
-    private void UpdateUserInterface<T>(EntityUid uid, GeneralStationRecordConsoleComponent component, T ev)
+    private void UpdateUserInterface<T>(Entity<GeneralStationRecordConsoleComponent> ent, ref T args)
     {
-        UpdateUserInterface(uid, component);
+        UpdateUserInterface(ent);
     }
 
-    private void OnKeySelected(EntityUid uid, GeneralStationRecordConsoleComponent component,
-        SelectGeneralStationRecord msg)
+    // TODO: instead of copy paste shitcode for each record console, have a shared records console comp they all use
+    // then have this somehow play nicely with creating ui state
+    // if that gets done put it in StationRecordsSystem console helpers section :)
+    private void OnKeySelected(Entity<GeneralStationRecordConsoleComponent> ent, ref SelectStationRecord msg)
     {
-        component.ActiveKey = msg.SelectedKey;
-        UpdateUserInterface(uid, component);
+        ent.Comp.ActiveKey = msg.SelectedKey;
+        UpdateUserInterface(ent);
     }
 
-    private void OnFiltersChanged(EntityUid uid,
-        GeneralStationRecordConsoleComponent component, GeneralStationRecordsFilterMsg msg)
+    private void OnFiltersChanged(Entity<GeneralStationRecordConsoleComponent> ent, ref SetStationRecordFilter msg)
     {
-        if (component.Filter == null ||
-            component.Filter.Type != msg.Type || component.Filter.Value != msg.Value)
+        if (ent.Comp.Filter == null ||
+            ent.Comp.Filter.Type != msg.Type || ent.Comp.Filter.Value != msg.Value)
         {
-            component.Filter = new GeneralStationRecordsFilter(msg.Type, msg.Value);
-            UpdateUserInterface(uid, component);
+            ent.Comp.Filter = new StationRecordsFilter(msg.Type, msg.Value);
+            UpdateUserInterface(ent);
         }
     }
 
-    private void UpdateUserInterface(EntityUid uid,
-        GeneralStationRecordConsoleComponent? console = null)
+    private void UpdateUserInterface(Entity<GeneralStationRecordConsoleComponent> ent)
     {
-        if (!Resolve(uid, ref console))
-        {
-            return;
-        }
-
-        var owningStation = _stationSystem.GetOwningStation(uid);
+        var (uid, console) = ent;
+        var owningStation = _station.GetOwningStation(uid);
 
-        if (!TryComp<StationRecordsComponent>(owningStation, out var stationRecordsComponent))
+        if (!TryComp<StationRecordsComponent>(owningStation, out var stationRecords))
         {
-            GeneralStationRecordConsoleState state = new(null, null, null, null);
-            SetStateForInterface(uid, state);
+            _ui.TrySetUiState(uid, GeneralStationRecordConsoleKey.Key, new GeneralStationRecordConsoleState());
             return;
         }
 
-        var consoleRecords =
-            _stationRecordsSystem.GetRecordsOfType<GeneralStationRecord>(owningStation.Value, stationRecordsComponent);
-
-        var listing = new Dictionary<(NetEntity, uint), string>();
+        var listing = _stationRecords.BuildListing((owningStation.Value, stationRecords), console.Filter);
 
-        foreach (var pair in consoleRecords)
+        switch (listing.Count)
         {
-            if (console.Filter != null && IsSkippedRecord(console.Filter, pair.Item2))
-            {
-                continue;
-            }
-
-            listing.Add(_stationRecordsSystem.Convert(pair.Item1), pair.Item2.Name);
+            case 0:
+                _ui.TrySetUiState(uid, GeneralStationRecordConsoleKey.Key, new GeneralStationRecordConsoleState());
+                return;
+            case 1:
+                console.ActiveKey = listing.Keys.First();
+                break;
         }
 
-        if (listing.Count == 0)
-        {
-            GeneralStationRecordConsoleState state = new(null, null, null, console.Filter);
-            SetStateForInterface(uid, state);
+        if (console.ActiveKey is not { } id)
             return;
-        }
-        else if (listing.Count == 1)
-        {
-            console.ActiveKey = listing.Keys.First();
-        }
 
-        GeneralStationRecord? record = null;
-        if (console.ActiveKey != null)
-        {
-            _stationRecordsSystem.TryGetRecord(owningStation.Value, _stationRecordsSystem.Convert(console.ActiveKey.Value), out record,
-                stationRecordsComponent);
-        }
+        var key = new StationRecordKey(id, owningStation.Value);
+        _stationRecords.TryGetRecord<GeneralStationRecord>(key, out var record, stationRecords);
 
-        GeneralStationRecordConsoleState newState = new(console.ActiveKey, record, listing, console.Filter);
-        SetStateForInterface(uid, newState);
-    }
-
-    private void SetStateForInterface(EntityUid uid, GeneralStationRecordConsoleState newState)
-    {
-        _userInterface.TrySetUiState(uid, GeneralStationRecordConsoleKey.Key, newState);
-    }
-
-    private bool IsSkippedRecord(GeneralStationRecordsFilter filter,
-        GeneralStationRecord someRecord)
-    {
-        bool isFilter = filter.Value.Length > 0;
-        string filterLowerCaseValue = "";
-
-        if (!isFilter)
-            return false;
-
-        filterLowerCaseValue = filter.Value.ToLower();
-
-        return filter.Type switch
-        {
-            GeneralStationRecordFilterType.Name =>
-                !someRecord.Name.ToLower().Contains(filterLowerCaseValue),
-            GeneralStationRecordFilterType.Prints => someRecord.Fingerprint != null
-                && IsFilterWithSomeCodeValue(someRecord.Fingerprint, filterLowerCaseValue),
-            GeneralStationRecordFilterType.DNA => someRecord.DNA != null
-                && IsFilterWithSomeCodeValue(someRecord.DNA, filterLowerCaseValue),
-        };
-    }
-
-    private bool IsFilterWithSomeCodeValue(string value, string filter)
-    {
-        return !value.ToLower().StartsWith(filter);
+        GeneralStationRecordConsoleState newState = new(id, record, listing, console.Filter);
+        _ui.TrySetUiState(uid, GeneralStationRecordConsoleKey.Key, newState);
     }
 }
diff --git a/Content.Server/StationRecords/Systems/StationRecordsSystem.cs b/Content.Server/StationRecords/Systems/StationRecordsSystem.cs
index fd5094d5330..09a00e5967c 100644
--- a/Content.Server/StationRecords/Systems/StationRecordsSystem.cs
+++ b/Content.Server/StationRecords/Systems/StationRecordsSystem.cs
@@ -32,8 +32,8 @@ namespace Content.Server.StationRecords.Systems;
 /// </summary>
 public sealed class StationRecordsSystem : SharedStationRecordsSystem
 {
-    [Dependency] private readonly InventorySystem _inventorySystem = default!;
-    [Dependency] private readonly StationRecordKeyStorageSystem _keyStorageSystem = default!;
+    [Dependency] private readonly InventorySystem _inventory = default!;
+    [Dependency] private readonly StationRecordKeyStorageSystem _keyStorage = default!;
     [Dependency] private readonly IPrototypeManager _prototypeManager = default!;
 
     public override void Initialize()
@@ -45,26 +45,22 @@ public override void Initialize()
 
     private void OnPlayerSpawn(PlayerSpawnCompleteEvent args)
     {
-        if (!HasComp<StationRecordsComponent>(args.Station))
+        if (!TryComp<StationRecordsComponent>(args.Station, out var stationRecords))
             return;
 
-        CreateGeneralRecord(args.Station, args.Mob, args.Profile, args.JobId);
+        CreateGeneralRecord(args.Station, args.Mob, args.Profile, args.JobId, stationRecords);
     }
 
     private void CreateGeneralRecord(EntityUid station, EntityUid player, HumanoidCharacterProfile profile,
-        string? jobId, StationRecordsComponent? records = null)
+        string? jobId, StationRecordsComponent records)
     {
-        if (!Resolve(station, ref records)
-            || string.IsNullOrEmpty(jobId)
+        // TODO make PlayerSpawnCompleteEvent.JobId a ProtoId
+        if (string.IsNullOrEmpty(jobId)
             || !_prototypeManager.HasIndex<JobPrototype>(jobId))
-        {
             return;
-        }
 
-        if (!_inventorySystem.TryGetSlotEntity(player, "id", out var idUid))
-        {
+        if (!_inventory.TryGetSlotEntity(player, "id", out var idUid))
             return;
-        }
 
         TryComp<FingerprintComponent>(player, out var fingerprintComponent);
         TryComp<DnaComponent>(player, out var dnaComponent);
@@ -100,17 +96,28 @@ private void CreateGeneralRecord(EntityUid station, EntityUid player, HumanoidCh
     ///     Optional - other systems should anticipate this.
     /// </param>
     /// <param name="records">Station records component.</param>
-    public void CreateGeneralRecord(EntityUid station, EntityUid? idUid, string name, int age, string species, Gender gender, string jobId, string? mobFingerprint, string? dna, HumanoidCharacterProfile? profile = null,
-        StationRecordsComponent? records = null)
+    public void CreateGeneralRecord(
+        EntityUid station,
+        EntityUid? idUid,
+        string name,
+        int age,
+        string species,
+        Gender gender,
+        string jobId,
+        string? mobFingerprint,
+        string? dna,
+        HumanoidCharacterProfile profile,
+        StationRecordsComponent records)
     {
-        if (!Resolve(station, ref records))
-        {
-            return;
-        }
+        if (!_prototypeManager.TryIndex<JobPrototype>(jobId, out var jobPrototype))
+            throw new ArgumentException($"Invalid job prototype ID: {jobId}");
 
-        if (!_prototypeManager.TryIndex(jobId, out JobPrototype? jobPrototype))
+        // when adding a record that already exists use the old one
+        // this happens when respawning as the same character
+        if (GetRecordByName(station, name, records) is {} id)
         {
-            throw new ArgumentException($"Invalid job prototype ID: {jobId}");
+            SetIdKey(idUid, new StationRecordKey(id, station));
+            return;
         }
 
         var record = new GeneralStationRecord()
@@ -129,40 +136,47 @@ public void CreateGeneralRecord(EntityUid station, EntityUid? idUid, string name
 
         var key = AddRecordEntry(station, record);
         if (!key.IsValid())
+        {
+            Log.Warning($"Failed to add general record entry for {name}");
             return;
+        }
+
+        SetIdKey(idUid, key);
+
+        RaiseLocalEvent(new AfterGeneralRecordCreatedEvent(key, record, profile));
+    }
 
-        if (idUid != null)
+    /// <summary>
+    /// Set the station records key for an id/pda.
+    /// </summary>
+    public void SetIdKey(EntityUid? uid, StationRecordKey key)
+    {
+        if (uid is not {} idUid)
+            return;
+
+        var keyStorageEntity = idUid;
+        if (TryComp<PdaComponent>(idUid, out var pda) && pda.ContainedId is {} id)
         {
-            var keyStorageEntity = idUid;
-            if (TryComp(idUid, out PdaComponent? pdaComponent) && pdaComponent.ContainedId != null)
-            {
-                keyStorageEntity = pdaComponent.IdSlot.Item;
-            }
-
-            if (keyStorageEntity != null)
-            {
-                _keyStorageSystem.AssignKey(keyStorageEntity.Value, key);
-            }
+            keyStorageEntity = id;
         }
 
-        RaiseLocalEvent(new AfterGeneralRecordCreatedEvent(station, key, record, profile));
+        _keyStorage.AssignKey(keyStorageEntity, key);
     }
 
     /// <summary>
     ///     Removes a record from this station.
     /// </summary>
-    /// <param name="station">Station to remove the record from.</param>
-    /// <param name="key">The key to remove.</param>
+    /// <param name="key">The station and key to remove.</param>
     /// <param name="records">Station records component.</param>
     /// <returns>True if the record was removed, false otherwise.</returns>
-    public bool RemoveRecord(EntityUid station, StationRecordKey key, StationRecordsComponent? records = null)
+    public bool RemoveRecord(StationRecordKey key, StationRecordsComponent? records = null)
     {
-        if (!Resolve(station, ref records))
+        if (!Resolve(key.OriginStation, ref records))
             return false;
 
-        if (records.Records.RemoveAllRecords(key))
+        if (records.Records.RemoveAllRecords(key.Id))
         {
-            RaiseLocalEvent(new RecordRemovedEvent(station, key));
+            RaiseLocalEvent(new RecordRemovedEvent(key));
             return true;
         }
 
@@ -174,20 +188,39 @@ public bool RemoveRecord(EntityUid station, StationRecordKey key, StationRecords
     ///     from the provided station record key. Will always return
     ///     null if the key does not match the station.
     /// </summary>
-    /// <param name="station">Station to get the record from.</param>
-    /// <param name="key">Key to try and index from the record set.</param>
+    /// <param name="key">Station and key to try and index from the record set.</param>
     /// <param name="entry">The resulting entry.</param>
     /// <param name="records">Station record component.</param>
     /// <typeparam name="T">Type to get from the record set.</typeparam>
     /// <returns>True if the record was obtained, false otherwise.</returns>
-    public bool TryGetRecord<T>(EntityUid station, StationRecordKey key, [NotNullWhen(true)] out T? entry, StationRecordsComponent? records = null)
+    public bool TryGetRecord<T>(StationRecordKey key, [NotNullWhen(true)] out T? entry, StationRecordsComponent? records = null)
     {
         entry = default;
 
-        if (!Resolve(station, ref records))
+        if (!Resolve(key.OriginStation, ref records))
             return false;
 
-        return records.Records.TryGetRecordEntry(key, out entry);
+        return records.Records.TryGetRecordEntry(key.Id, out entry);
+    }
+
+    /// <summary>
+    /// Returns an id if a record with the same name exists.
+    /// </summary>
+    /// <remarks>
+    /// Linear search so O(n) time complexity.
+    /// </remarks>
+    public uint? GetRecordByName(EntityUid station, string name, StationRecordsComponent? records = null)
+    {
+        if (!Resolve(station, ref records))
+            return null;
+
+        foreach (var (id, record) in GetRecordsOfType<GeneralStationRecord>(station, records))
+        {
+            if (record.Name == name)
+                return id;
+        }
+
+        return null;
     }
 
     /// <summary>
@@ -197,30 +230,47 @@ public bool TryGetRecord<T>(EntityUid station, StationRecordKey key, [NotNullWhe
     /// <param name="records">Station records component.</param>
     /// <typeparam name="T">Type of record to fetch</typeparam>
     /// <returns>Enumerable of pairs with a station record key, and the entry in question of type T.</returns>
-    public IEnumerable<(StationRecordKey, T)> GetRecordsOfType<T>(EntityUid station, StationRecordsComponent? records = null)
+    public IEnumerable<(uint, T)> GetRecordsOfType<T>(EntityUid station, StationRecordsComponent? records = null)
     {
         if (!Resolve(station, ref records))
-        {
-            return Array.Empty<(StationRecordKey, T)>();
-        }
+            return Array.Empty<(uint, T)>();
 
         return records.Records.GetRecordsOfType<T>();
     }
 
     /// <summary>
-    ///     Adds a record entry to a station's record set.
+    ///     Adds a new record entry to a station's record set.
     /// </summary>
     /// <param name="station">The station to add the record to.</param>
     /// <param name="record">The record to add.</param>
     /// <param name="records">Station records component.</param>
     /// <typeparam name="T">The type of record to add.</typeparam>
-    public StationRecordKey AddRecordEntry<T>(EntityUid station, T record,
-        StationRecordsComponent? records = null)
+    public StationRecordKey AddRecordEntry<T>(EntityUid station, T record, StationRecordsComponent? records = null)
     {
         if (!Resolve(station, ref records))
             return StationRecordKey.Invalid;
 
-        return records.Records.AddRecordEntry(station, record);
+        var id = records.Records.AddRecordEntry(record);
+        if (id == null)
+            return StationRecordKey.Invalid;
+
+        return new StationRecordKey(id.Value, station);
+    }
+
+    /// <summary>
+    /// Adds a record to an existing entry.
+    /// </summary>
+    /// <param name="key">The station and id of the existing entry.</param>
+    /// <param name="record">The record to add.</param>
+    /// <param name="records">Station records component.</param>
+    /// <typeparam name="T">The type of record to add.</typeparam>
+    public void AddRecordEntry<T>(StationRecordKey key, T record,
+        StationRecordsComponent? records = null)
+    {
+        if (!Resolve(key.OriginStation, ref records))
+            return;
+
+        records.Records.AddRecordEntry(key.Id, record);
     }
 
     /// <summary>
@@ -231,17 +281,99 @@ public StationRecordKey AddRecordEntry<T>(EntityUid station, T record,
     public void Synchronize(EntityUid station, StationRecordsComponent? records = null)
     {
         if (!Resolve(station, ref records))
-        {
             return;
-        }
 
         foreach (var key in records.Records.GetRecentlyAccessed())
         {
-            RaiseLocalEvent(new RecordModifiedEvent(station, key));
+            RaiseLocalEvent(new RecordModifiedEvent(new StationRecordKey(key, station)));
         }
 
         records.Records.ClearRecentlyAccessed();
     }
+
+    /// <summary>
+    /// Synchronizes a single record's entries for a station.
+    /// </summary>
+    /// <param name="key">The station and id of the record</param>
+    /// <param name="records">Station records component.</param>
+    public void Synchronize(StationRecordKey key, StationRecordsComponent? records = null)
+    {
+        if (!Resolve(key.OriginStation, ref records))
+            return;
+
+        RaiseLocalEvent(new RecordModifiedEvent(key));
+
+        records.Records.RemoveFromRecentlyAccessed(key.Id);
+    }
+
+    #region Console system helpers
+
+    /// <summary>
+    /// Checks if a record should be skipped given a filter.
+    /// Takes general record since even if you are using this for e.g. criminal records,
+    /// you don't want to duplicate basic info like name and dna.
+    /// Station records lets you do this nicely with multiple types having their own data.
+    /// </summary>
+    public bool IsSkipped(StationRecordsFilter? filter, GeneralStationRecord someRecord)
+    {
+        // if nothing is being filtered, show everything
+        if (filter == null)
+            return false;
+        if (filter.Value.Length == 0)
+            return false;
+
+        var filterLowerCaseValue = filter.Value.ToLower();
+
+        return filter.Type switch
+        {
+            StationRecordFilterType.Name =>
+                !someRecord.Name.ToLower().Contains(filterLowerCaseValue),
+            StationRecordFilterType.Prints => someRecord.Fingerprint != null
+                && IsFilterWithSomeCodeValue(someRecord.Fingerprint, filterLowerCaseValue),
+            StationRecordFilterType.DNA => someRecord.DNA != null
+                && IsFilterWithSomeCodeValue(someRecord.DNA, filterLowerCaseValue),
+        };
+    }
+
+    private bool IsFilterWithSomeCodeValue(string value, string filter)
+    {
+        return !value.ToLower().StartsWith(filter);
+    }
+
+    /// <summary>
+    /// Build a record listing of id to name for a station and filter.
+    /// </summary>
+    public Dictionary<uint, string> BuildListing(Entity<StationRecordsComponent> station, StationRecordsFilter? filter)
+    {
+        var listing = new Dictionary<uint, string>();
+
+        var records = GetRecordsOfType<GeneralStationRecord>(station, station.Comp);
+        foreach (var pair in records)
+        {
+            if (IsSkipped(filter, pair.Item2))
+                continue;
+
+            listing.Add(pair.Item1, pair.Item2.Name);
+        }
+
+        return listing;
+    }
+
+    #endregion
+}
+
+/// <summary>
+/// Base event for station record events
+/// </summary>
+public abstract class StationRecordEvent : EntityEventArgs
+{
+    public readonly StationRecordKey Key;
+    public EntityUid Station => Key.OriginStation;
+
+    protected StationRecordEvent(StationRecordKey key)
+    {
+        Key = key;
+    }
 }
 
 /// <summary>
@@ -250,23 +382,19 @@ public void Synchronize(EntityUid station, StationRecordsComponent? records = nu
 ///     listening to this event, as it contains the character's record key.
 ///     Also stores the general record reference, to save some time.
 /// </summary>
-public sealed class AfterGeneralRecordCreatedEvent : EntityEventArgs
+public sealed class AfterGeneralRecordCreatedEvent : StationRecordEvent
 {
-    public readonly EntityUid Station;
-    public StationRecordKey Key { get; }
-    public GeneralStationRecord Record { get; }
+    public readonly GeneralStationRecord Record;
     /// <summary>
     /// Profile for the related player. This is so that other systems can get further information
     ///     about the player character.
     ///     Optional - other systems should anticipate this.
     /// </summary>
-    public HumanoidCharacterProfile? Profile { get; }
+    public readonly HumanoidCharacterProfile Profile;
 
-    public AfterGeneralRecordCreatedEvent(EntityUid station, StationRecordKey key, GeneralStationRecord record,
-        HumanoidCharacterProfile? profile)
+    public AfterGeneralRecordCreatedEvent(StationRecordKey key, GeneralStationRecord record,
+        HumanoidCharacterProfile profile) : base(key)
     {
-        Station = station;
-        Key = key;
         Record = record;
         Profile = profile;
     }
@@ -278,15 +406,10 @@ public AfterGeneralRecordCreatedEvent(EntityUid station, StationRecordKey key, G
 ///     that store record keys can then remove the key from their internal
 ///     fields.
 /// </summary>
-public sealed class RecordRemovedEvent : EntityEventArgs
+public sealed class RecordRemovedEvent : StationRecordEvent
 {
-    public readonly EntityUid Station;
-    public StationRecordKey Key { get; }
-
-    public RecordRemovedEvent(EntityUid station, StationRecordKey key)
+    public RecordRemovedEvent(StationRecordKey key) : base(key)
     {
-        Station = station;
-        Key = key;
     }
 }
 
@@ -295,14 +418,9 @@ public RecordRemovedEvent(EntityUid station, StationRecordKey key)
 ///     inform other systems that records stored in this key
 ///     may have changed.
 /// </summary>
-public sealed class RecordModifiedEvent : EntityEventArgs
+public sealed class RecordModifiedEvent : StationRecordEvent
 {
-    public readonly EntityUid Station;
-    public StationRecordKey Key { get; }
-
-    public RecordModifiedEvent(EntityUid station, StationRecordKey key)
+    public RecordModifiedEvent(StationRecordKey key) : base(key)
     {
-        Station = station;
-        Key = key;
     }
 }
diff --git a/Content.Server/Storage/EntitySystems/EntityStorageSystem.cs b/Content.Server/Storage/EntitySystems/EntityStorageSystem.cs
index 176fd9b9ed2..8b31f598d0d 100644
--- a/Content.Server/Storage/EntitySystems/EntityStorageSystem.cs
+++ b/Content.Server/Storage/EntitySystems/EntityStorageSystem.cs
@@ -33,6 +33,7 @@ public override void Initialize()
         base.Initialize();
 
         /* CompRef things */
+        SubscribeLocalEvent<EntityStorageComponent, EntityUnpausedEvent>(OnEntityUnpausedEvent);
         SubscribeLocalEvent<EntityStorageComponent, ComponentInit>(OnComponentInit);
         SubscribeLocalEvent<EntityStorageComponent, ComponentStartup>(OnComponentStartup);
         SubscribeLocalEvent<EntityStorageComponent, ActivateInWorldEvent>(OnInteract, after: new[] { typeof(LockSystem) });
diff --git a/Content.Server/Store/Components/StoreComponent.cs b/Content.Server/Store/Components/StoreComponent.cs
index 54f8c9ee15b..063e25fbf9f 100644
--- a/Content.Server/Store/Components/StoreComponent.cs
+++ b/Content.Server/Store/Components/StoreComponent.cs
@@ -1,6 +1,7 @@
 using Content.Shared.FixedPoint;
 using Content.Shared.Store;
 using Robust.Shared.Audio;
+using Robust.Shared.Map;
 using Robust.Shared.Serialization.TypeSerializers.Implementations.Custom.Prototype;
 using Robust.Shared.Serialization.TypeSerializers.Implementations.Custom.Prototype.Dictionary;
 using Robust.Shared.Serialization.TypeSerializers.Implementations.Custom.Prototype.Set;
@@ -59,6 +60,30 @@ public sealed partial class StoreComponent : Component
     [ViewVariables]
     public HashSet<ListingData> LastAvailableListings = new();
 
+    /// <summary>
+    ///     All current entities bought from this shop. Useful for keeping track of refunds and upgrades.
+    /// </summary>
+    [ViewVariables, DataField]
+    public List<EntityUid> BoughtEntities = new();
+
+    /// <summary>
+    ///     The total balance spent in this store. Used for refunds.
+    /// </summary>
+    [ViewVariables, DataField]
+    public Dictionary<string, FixedPoint2> BalanceSpent = new();
+
+    /// <summary>
+    ///     Controls if the store allows refunds
+    /// </summary>
+    [ViewVariables, DataField]
+    public bool RefundAllowed;
+
+    /// <summary>
+    ///     The map the store was originally from, used to block refunds if the map is changed
+    /// </summary>
+    [DataField]
+    public EntityUid? StartingMap;
+
     #region audio
     /// <summary>
     /// The sound played to the buyer when a purchase is succesfully made.
@@ -78,3 +103,17 @@ public sealed partial class StoreComponent : Component
 /// </summary>
 [ByRefEvent]
 public readonly record struct StoreRemovedEvent;
+
+/// <summary>
+///     Broadcast when an Entity with the <see cref="StoreRefundComponent"/> is deleted
+/// </summary>
+[ByRefEvent]
+public readonly struct RefundEntityDeletedEvent
+{
+    public EntityUid Uid { get; }
+
+    public RefundEntityDeletedEvent(EntityUid uid)
+    {
+        Uid = uid;
+    }
+}
diff --git a/Content.Server/Store/StoreRefundComponent.cs b/Content.Server/Store/StoreRefundComponent.cs
new file mode 100644
index 00000000000..1a6b17c5ead
--- /dev/null
+++ b/Content.Server/Store/StoreRefundComponent.cs
@@ -0,0 +1,13 @@
+using Content.Server.Store.Systems;
+
+namespace Content.Server.Store.Components;
+
+/// <summary>
+///     Keeps track of entities bought from stores for refunds, especially useful if entities get deleted before they can be refunded.
+/// </summary>
+[RegisterComponent, Access(typeof(StoreSystem))]
+public sealed partial class StoreRefundComponent : Component
+{
+    [ViewVariables, DataField]
+    public EntityUid? StoreEntity;
+}
diff --git a/Content.Server/Store/Systems/StoreSystem.Refund.cs b/Content.Server/Store/Systems/StoreSystem.Refund.cs
new file mode 100644
index 00000000000..d59ee75e3ea
--- /dev/null
+++ b/Content.Server/Store/Systems/StoreSystem.Refund.cs
@@ -0,0 +1,54 @@
+using Content.Server.Store.Components;
+using Robust.Shared.Containers;
+
+namespace Content.Server.Store.Systems;
+
+public sealed partial class StoreSystem
+{
+    private void InitializeRefund()
+    {
+        SubscribeLocalEvent<StoreComponent, EntityTerminatingEvent>(OnStoreTerminating);
+        SubscribeLocalEvent<StoreRefundComponent, EntityTerminatingEvent>(OnRefundTerminating);
+        SubscribeLocalEvent<StoreRefundComponent, EntRemovedFromContainerMessage>(OnEntityRemoved);
+        SubscribeLocalEvent<StoreRefundComponent, EntInsertedIntoContainerMessage>(OnEntityInserted);
+    }
+
+    private void OnEntityRemoved(EntityUid uid, StoreRefundComponent component, EntRemovedFromContainerMessage args)
+    {
+        if (component.StoreEntity == null || _actions.TryGetActionData(uid, out _) || !TryComp<StoreComponent>(component.StoreEntity.Value, out var storeComp))
+            return;
+
+        DisableRefund(component.StoreEntity.Value, storeComp);
+    }
+
+    private void OnEntityInserted(EntityUid uid, StoreRefundComponent component, EntInsertedIntoContainerMessage args)
+    {
+        if (component.StoreEntity == null || _actions.TryGetActionData(uid, out _) || !TryComp<StoreComponent>(component.StoreEntity.Value, out var storeComp))
+            return;
+
+        DisableRefund(component.StoreEntity.Value, storeComp);
+    }
+
+    private void OnStoreTerminating(Entity<StoreComponent> ent, ref EntityTerminatingEvent args)
+    {
+        if (ent.Comp.BoughtEntities.Count <= 0)
+            return;
+
+        foreach (var boughtEnt in ent.Comp.BoughtEntities)
+        {
+            if (!TryComp<StoreRefundComponent>(boughtEnt, out var refundComp))
+                continue;
+
+            refundComp.StoreEntity = null;
+        }
+    }
+
+    private void OnRefundTerminating(Entity<StoreRefundComponent> ent, ref EntityTerminatingEvent args)
+    {
+        if (ent.Comp.StoreEntity == null)
+            return;
+
+        var ev = new RefundEntityDeletedEvent(ent);
+        RaiseLocalEvent(ent.Comp.StoreEntity.Value, ref ev);
+    }
+}
diff --git a/Content.Server/Store/Systems/StoreSystem.Ui.cs b/Content.Server/Store/Systems/StoreSystem.Ui.cs
index 7599b08b3ce..a7490fd27ff 100644
--- a/Content.Server/Store/Systems/StoreSystem.Ui.cs
+++ b/Content.Server/Store/Systems/StoreSystem.Ui.cs
@@ -4,11 +4,13 @@
 using Content.Server.PDA.Ringer;
 using Content.Server.Stack;
 using Content.Server.Store.Components;
-using Content.Shared.UserInterface;
+using Content.Shared.Actions;
 using Content.Shared.Database;
 using Content.Shared.FixedPoint;
 using Content.Shared.Hands.EntitySystems;
+using Content.Shared.Mind;
 using Content.Shared.Store;
+using Content.Shared.UserInterface;
 using Robust.Server.GameObjects;
 using Robust.Shared.Audio.Systems;
 using Robust.Shared.Player;
@@ -20,6 +22,9 @@ public sealed partial class StoreSystem
     [Dependency] private readonly IAdminLogManager _admin = default!;
     [Dependency] private readonly SharedHandsSystem _hands = default!;
     [Dependency] private readonly ActionsSystem _actions = default!;
+    [Dependency] private readonly ActionContainerSystem _actionContainer = default!;
+    [Dependency] private readonly ActionUpgradeSystem _actionUpgrade = default!;
+    [Dependency] private readonly SharedMindSystem _mind = default!;
     [Dependency] private readonly SharedAudioSystem _audio = default!;
     [Dependency] private readonly StackSystem _stack = default!;
     [Dependency] private readonly UserInterfaceSystem _ui = default!;
@@ -29,6 +34,13 @@ private void InitializeUi()
         SubscribeLocalEvent<StoreComponent, StoreRequestUpdateInterfaceMessage>(OnRequestUpdate);
         SubscribeLocalEvent<StoreComponent, StoreBuyListingMessage>(OnBuyRequest);
         SubscribeLocalEvent<StoreComponent, StoreRequestWithdrawMessage>(OnRequestWithdraw);
+        SubscribeLocalEvent<StoreComponent, StoreRequestRefundMessage>(OnRequestRefund);
+        SubscribeLocalEvent<StoreComponent, RefundEntityDeletedEvent>(OnRefundEntityDeleted);
+    }
+
+    private void OnRefundEntityDeleted(Entity<StoreComponent> ent, ref RefundEntityDeletedEvent args)
+    {
+        ent.Comp.BoughtEntities.Remove(args.Uid);
     }
 
     /// <summary>
@@ -98,7 +110,7 @@ public void UpdateUserInterface(EntityUid? user, EntityUid store, StoreComponent
 
         // only tell operatives to lock their uplink if it can be locked
         var showFooter = HasComp<RingerUplinkComponent>(store);
-        var state = new StoreUpdateState(component.LastAvailableListings, allCurrency, showFooter);
+        var state = new StoreUpdateState(component.LastAvailableListings, allCurrency, showFooter, component.RefundAllowed);
         _ui.SetUiState(ui, state);
     }
 
@@ -118,6 +130,7 @@ private void BeforeActivatableUiOpen(EntityUid uid, StoreComponent component, Be
     private void OnBuyRequest(EntityUid uid, StoreComponent component, StoreBuyListingMessage msg)
     {
         var listing = component.Listings.FirstOrDefault(x => x.Equals(msg.Listing));
+
         if (listing == null) //make sure this listing actually exists
         {
             Log.Debug("listing does not exist");
@@ -149,10 +162,20 @@ private void OnBuyRequest(EntityUid uid, StoreComponent component, StoreBuyListi
                 return;
             }
         }
+
+        if (!IsOnStartingMap(uid, component))
+            component.RefundAllowed = false;
+        else
+            component.RefundAllowed = true;
+
         //subtract the cash
-        foreach (var currency in listing.Cost)
+        foreach (var (currency, value) in listing.Cost)
         {
-            component.Balance[currency.Key] -= currency.Value;
+            component.Balance[currency] -= value;
+
+            component.BalanceSpent.TryAdd(currency, FixedPoint2.Zero);
+
+            component.BalanceSpent[currency] += value;
         }
 
         //spawn entity
@@ -160,13 +183,71 @@ private void OnBuyRequest(EntityUid uid, StoreComponent component, StoreBuyListi
         {
             var product = Spawn(listing.ProductEntity, Transform(buyer).Coordinates);
             _hands.PickupOrDrop(buyer, product);
+
+            HandleRefundComp(uid, component, product);
+
+            var xForm = Transform(product);
+
+            if (xForm.ChildCount > 0)
+            {
+                var childEnumerator = xForm.ChildEnumerator;
+                while (childEnumerator.MoveNext(out var child))
+                {
+                    component.BoughtEntities.Add(child);
+                }
+            }
         }
 
         //give action
         if (!string.IsNullOrWhiteSpace(listing.ProductAction))
         {
+            EntityUid? actionId;
             // I guess we just allow duplicate actions?
-            _actions.AddAction(buyer, listing.ProductAction);
+            // Allow duplicate actions and just have a single list buy for the buy-once ones.
+            if (!_mind.TryGetMind(buyer, out var mind, out _))
+                actionId = _actions.AddAction(buyer, listing.ProductAction);
+            else
+                actionId = _actionContainer.AddAction(mind, listing.ProductAction);
+
+            // Add the newly bought action entity to the list of bought entities
+            // And then add that action entity to the relevant product upgrade listing, if applicable
+            if (actionId != null)
+            {
+                HandleRefundComp(uid, component, actionId.Value);
+
+                if (listing.ProductUpgradeID != null)
+                {
+                    foreach (var upgradeListing in component.Listings)
+                    {
+                        if (upgradeListing.ID == listing.ProductUpgradeID)
+                        {
+                            upgradeListing.ProductActionEntity = actionId.Value;
+                            break;
+                        }
+                    }
+                }
+            }
+        }
+
+        if (listing is { ProductUpgradeID: not null, ProductActionEntity: not null })
+        {
+            if (listing.ProductActionEntity != null)
+            {
+                component.BoughtEntities.Remove(listing.ProductActionEntity.Value);
+            }
+
+            if (!_actionUpgrade.TryUpgradeAction(listing.ProductActionEntity, out var upgradeActionId))
+            {
+                if (listing.ProductActionEntity != null)
+                    HandleRefundComp(uid, component, listing.ProductActionEntity.Value);
+
+                return;
+            }
+
+            listing.ProductActionEntity = upgradeActionId;
+
+            if (upgradeActionId != null)
+                HandleRefundComp(uid, component, upgradeActionId.Value);
         }
 
         //broadcast event
@@ -225,4 +306,71 @@ private void OnRequestWithdraw(EntityUid uid, StoreComponent component, StoreReq
         component.Balance[msg.Currency] -= msg.Amount;
         UpdateUserInterface(buyer, uid, component);
     }
+
+    private void OnRequestRefund(EntityUid uid, StoreComponent component, StoreRequestRefundMessage args)
+    {
+        // TODO: Remove guardian/holopara
+
+        if (args.Session.AttachedEntity is not { Valid: true } buyer)
+            return;
+
+        if (!IsOnStartingMap(uid, component))
+        {
+            component.RefundAllowed = false;
+            UpdateUserInterface(buyer, uid, component);
+        }
+
+        if (!component.RefundAllowed || component.BoughtEntities.Count == 0)
+            return;
+
+        for (var i = component.BoughtEntities.Count; i >= 0; i--)
+        {
+            var purchase = component.BoughtEntities[i];
+
+            if (!Exists(purchase))
+                continue;
+
+            component.BoughtEntities.RemoveAt(i);
+
+            if (_actions.TryGetActionData(purchase, out var actionComponent))
+            {
+                _actionContainer.RemoveAction(purchase, actionComponent);
+            }
+
+            EntityManager.DeleteEntity(purchase);
+        }
+
+        foreach (var (currency, value) in component.BalanceSpent)
+        {
+            component.Balance[currency] += value;
+        }
+        // Reset store back to its original state
+        RefreshAllListings(component);
+        component.BalanceSpent = new();
+        UpdateUserInterface(buyer, uid, component);
+    }
+
+    private void HandleRefundComp(EntityUid uid, StoreComponent component, EntityUid purchase)
+    {
+        component.BoughtEntities.Add(purchase);
+        var refundComp = EnsureComp<StoreRefundComponent>(purchase);
+        refundComp.StoreEntity = uid;
+    }
+
+    private bool IsOnStartingMap(EntityUid store, StoreComponent component)
+    {
+        var xform = Transform(store);
+        return component.StartingMap == xform.MapUid;
+    }
+
+    /// <summary>
+    ///     Disables refunds for this store
+    /// </summary>
+    public void DisableRefund(EntityUid store, StoreComponent? component = null)
+    {
+        if (!Resolve(store, ref component))
+            return;
+
+        component.RefundAllowed = false;
+    }
 }
diff --git a/Content.Server/Store/Systems/StoreSystem.cs b/Content.Server/Store/Systems/StoreSystem.cs
index 67fbd4faf51..8ce1f9bb83a 100644
--- a/Content.Server/Store/Systems/StoreSystem.cs
+++ b/Content.Server/Store/Systems/StoreSystem.cs
@@ -36,12 +36,14 @@ public override void Initialize()
 
         InitializeUi();
         InitializeCommand();
+        InitializeRefund();
     }
 
     private void OnMapInit(EntityUid uid, StoreComponent component, MapInitEvent args)
     {
         RefreshAllListings(component);
         InitializeFromPreset(component.Preset, uid, component);
+        component.StartingMap = Transform(uid).MapUid;
     }
 
     private void OnStartup(EntityUid uid, StoreComponent component, ComponentStartup args)
diff --git a/Content.Server/SurveillanceCamera/Systems/SurveillanceCameraMonitorSystem.cs b/Content.Server/SurveillanceCamera/Systems/SurveillanceCameraMonitorSystem.cs
index cbc2f6d31ec..f258fbe89cf 100644
--- a/Content.Server/SurveillanceCamera/Systems/SurveillanceCameraMonitorSystem.cs
+++ b/Content.Server/SurveillanceCamera/Systems/SurveillanceCameraMonitorSystem.cs
@@ -2,6 +2,7 @@
 using Content.Server.DeviceNetwork;
 using Content.Server.DeviceNetwork.Systems;
 using Content.Server.Power.Components;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.UserInterface;
 using Content.Shared.SurveillanceCamera;
 using Robust.Server.GameObjects;
diff --git a/Content.Server/Wagging/WaggingSystem.cs b/Content.Server/Wagging/WaggingSystem.cs
index 5d4163fa65f..7e9ffbbc8f4 100644
--- a/Content.Server/Wagging/WaggingSystem.cs
+++ b/Content.Server/Wagging/WaggingSystem.cs
@@ -1,5 +1,4 @@
 using Content.Server.Actions;
-using Content.Server.Chat.Systems;
 using Content.Server.Humanoid;
 using Content.Shared.Humanoid;
 using Content.Shared.Humanoid.Markings;
@@ -16,7 +15,6 @@ namespace Content.Server.Wagging;
 public sealed class WaggingSystem : EntitySystem
 {
     [Dependency] private readonly ActionsSystem _actions = default!;
-    [Dependency] private readonly ChatSystem _chat = default!;
     [Dependency] private readonly HumanoidAppearanceSystem _humanoidAppearance = default!;
     [Dependency] private readonly IPrototypeManager _prototype = default!;
 
@@ -102,9 +100,6 @@ public bool TryToggleWagging(EntityUid uid, WaggingComponent? wagging = null, Hu
                 humanoid: humanoid);
         }
 
-        var emoteText = Loc.GetString(wagging.Wagging ? "wagging-emote-start" : "wagging-emote-stop", ("ent", uid));
-        _chat.TrySendInGameICMessage(uid, emoteText, InGameICChatType.Emote, ChatTransmitRange.Normal); // Ok while emotes dont have radial menu
-
         return true;
     }
 }
diff --git a/Content.Server/Wires/WiresSystem.cs b/Content.Server/Wires/WiresSystem.cs
index 5275a95c340..2b23b093603 100644
--- a/Content.Server/Wires/WiresSystem.cs
+++ b/Content.Server/Wires/WiresSystem.cs
@@ -1,51 +1,39 @@
 using System.Diagnostics.CodeAnalysis;
 using System.Linq;
 using System.Threading;
-using Content.Server.Administration.Logs;
 using Content.Server.Construction;
 using Content.Server.Construction.Components;
 using Content.Server.Power.Components;
-using Content.Shared.UserInterface;
-using Content.Shared.Database;
+using Content.Server.UserInterface;
 using Content.Shared.DoAfter;
 using Content.Shared.GameTicking;
 using Content.Shared.Hands.Components;
 using Content.Shared.Interaction;
 using Content.Shared.Popups;
-using Content.Shared.Tools;
 using Content.Shared.Tools.Components;
+using Content.Shared.UserInterface;
 using Content.Shared.Wires;
 using Robust.Server.GameObjects;
-using Robust.Server.Player;
-using Robust.Shared.Audio;
-using Robust.Shared.Audio.Systems;
 using Robust.Shared.Player;
 using Robust.Shared.Prototypes;
 using Robust.Shared.Random;
-using SharedToolSystem = Content.Shared.Tools.Systems.SharedToolSystem;
-using Content.Server.UserInterface;
 
 namespace Content.Server.Wires;
 
 public sealed class WiresSystem : SharedWiresSystem
 {
     [Dependency] private readonly IPrototypeManager _protoMan = default!;
-    [Dependency] private readonly IAdminLogManager _adminLogger = default!;
     [Dependency] private readonly ActivatableUISystem _activatableUI = default!;
     [Dependency] private readonly SharedDoAfterSystem _doAfter = default!;
-    [Dependency] private readonly SharedToolSystem _toolSystem = default!;
     [Dependency] private readonly SharedPopupSystem _popupSystem = default!;
     [Dependency] private readonly SharedInteractionSystem _interactionSystem = default!;
-    [Dependency] private readonly SharedAudioSystem _audio = default!;
     [Dependency] private readonly UserInterfaceSystem _uiSystem = default!;
-    [Dependency] private readonly SharedAppearanceSystem _appearance = default!;
     [Dependency] private readonly IRobustRandom _random = default!;
     [Dependency] private readonly ConstructionSystem _construction = default!;
 
     // This is where all the wire layouts are stored.
     [ViewVariables] private readonly Dictionary<string, WireLayout> _layouts = new();
 
-    private const float ScrewTime = 1f;
     private float _toolTime = 0f;
 
     #region Initialization
@@ -56,8 +44,7 @@ public override void Initialize()
         SubscribeLocalEvent<RoundRestartCleanupEvent>(Reset);
 
         // this is a broadcast event
-        SubscribeLocalEvent<WiresPanelComponent, WirePanelDoAfterEvent>(OnPanelDoAfter);
-        SubscribeLocalEvent<WiresComponent, ComponentStartup>(OnWiresStartup);
+        SubscribeLocalEvent<WiresComponent, PanelChangedEvent>(OnPanelChanged);
         SubscribeLocalEvent<WiresComponent, WiresActionMessage>(OnWiresActionMessage);
         SubscribeLocalEvent<WiresComponent, InteractUsingEvent>(OnInteractUsing);
         SubscribeLocalEvent<WiresComponent, MapInitEvent>(OnMapInit);
@@ -68,6 +55,7 @@ public override void Initialize()
         SubscribeLocalEvent<ActivatableUIRequiresPanelComponent, PanelChangedEvent>(OnActivatableUIPanelChanged);
         SubscribeLocalEvent<WiresPanelSecurityComponent, WiresPanelSecurityEvent>(SetWiresPanelSecurity);
     }
+
     private void SetOrCreateWireLayout(EntityUid uid, WiresComponent? wires = null)
     {
         if (!Resolve(uid, ref wires))
@@ -246,11 +234,6 @@ private Wire CreateWire(EntityUid uid, IWireAction? action, int position, WireLa
             position,
             action);
     }
-
-    private void OnWiresStartup(EntityUid uid, WiresComponent component, ComponentStartup args)
-    {
-        EnsureComp<WiresPanelComponent>(uid);
-    }
     #endregion
 
     #region DoAfters
@@ -464,49 +447,28 @@ private void OnInteractUsing(EntityUid uid, WiresComponent component, InteractUs
         if (args.Handled)
             return;
 
-        if (!TryComp<ToolComponent>(args.Used, out var tool) || !TryComp<WiresPanelComponent>(uid, out var panel))
+        if (!TryComp<ToolComponent>(args.Used, out var tool))
             return;
 
-        if (panel.Open &&
-            (_toolSystem.HasQuality(args.Used, "Cutting", tool) ||
-            _toolSystem.HasQuality(args.Used, "Pulsing", tool)))
-        {
-            if (TryComp<WiresPanelSecurityComponent>(uid, out var wiresPanelSecurity) &&
-                !wiresPanelSecurity.WiresAccessible)
-                return;
+        if (!IsPanelOpen(uid))
+            return;
 
+        if (Tool.HasQuality(args.Used, "Cutting", tool) ||
+            Tool.HasQuality(args.Used, "Pulsing", tool))
+        {
             if (TryComp(args.User, out ActorComponent? actor))
             {
                 _uiSystem.TryOpen(uid, WiresUiKey.Key, actor.PlayerSession);
                 args.Handled = true;
             }
         }
-        else if (_toolSystem.UseTool(args.Used, args.User, uid, ScrewTime, "Screwing", new WirePanelDoAfterEvent(), toolComponent: tool))
-        {
-            _adminLogger.Add(LogType.Action, LogImpact.Low,
-                $"{ToPrettyString(args.User):user} is screwing {ToPrettyString(uid):target}'s {(panel.Open ? "open" : "closed")} maintenance panel at {Transform(uid).Coordinates:targetlocation}");
-            args.Handled = true;
-        }
     }
 
-    private void OnPanelDoAfter(EntityUid uid, WiresPanelComponent panel, WirePanelDoAfterEvent args)
+    private void OnPanelChanged(Entity<WiresComponent> ent, ref PanelChangedEvent args)
     {
-        if (args.Cancelled)
+        if (args.Open)
             return;
-
-        TogglePanel(uid, panel, !panel.Open);
-        UpdateAppearance(uid, panel);
-        _adminLogger.Add(LogType.Action, LogImpact.Low, $"{ToPrettyString(args.User):user} screwed {ToPrettyString(uid):target}'s maintenance panel {(panel.Open ? "open" : "closed")}");
-
-        if (panel.Open)
-        {
-            _audio.PlayPvs(panel.ScrewdriverOpenSound, uid);
-        }
-        else
-        {
-            _audio.PlayPvs(panel.ScrewdriverCloseSound, uid);
-            _uiSystem.TryCloseAll(uid, WiresUiKey.Key);
-        }
+        _uiSystem.TryCloseAll(ent, WiresUiKey.Key);
     }
 
     private void OnAttemptOpenActivatableUI(EntityUid uid, ActivatableUIRequiresPanelComponent component, ActivatableUIOpenAttemptEvent args)
@@ -665,16 +627,6 @@ public void ChangePanelVisibility(EntityUid uid, WiresPanelComponent component,
         Dirty(uid, component);
     }
 
-    public void TogglePanel(EntityUid uid, WiresPanelComponent component, bool open)
-    {
-        component.Open = open;
-        UpdateAppearance(uid, component);
-        Dirty(uid, component);
-
-        var ev = new PanelChangedEvent(component.Open);
-        RaiseLocalEvent(uid, ref ev);
-    }
-
     public void SetWiresPanelSecurity(EntityUid uid, WiresPanelSecurityComponent component, WiresPanelSecurityEvent args)
     {
         component.Examine = args.Examine;
@@ -688,12 +640,6 @@ public void SetWiresPanelSecurity(EntityUid uid, WiresPanelSecurityComponent com
         }
     }
 
-    private void UpdateAppearance(EntityUid uid, WiresPanelComponent panel)
-    {
-        if (TryComp<AppearanceComponent>(uid, out var appearance))
-            _appearance.SetData(uid, WiresVisuals.MaintenancePanelState, panel.Open && panel.Visible, appearance);
-    }
-
     private void TryDoWireAction(EntityUid target, EntityUid user, EntityUid toolEntity, int id, WiresAction action, WiresComponent? wires = null, ToolComponent? tool = null)
     {
         if (!Resolve(target, ref wires)
@@ -711,7 +657,7 @@ private void TryDoWireAction(EntityUid target, EntityUid user, EntityUid toolEnt
         switch (action)
         {
             case WiresAction.Cut:
-                if (!_toolSystem.HasQuality(toolEntity, "Cutting", tool))
+                if (!Tool.HasQuality(toolEntity, "Cutting", tool))
                 {
                     _popupSystem.PopupCursor(Loc.GetString("wires-component-ui-on-receive-message-need-wirecutters"), user);
                     return;
@@ -725,7 +671,7 @@ private void TryDoWireAction(EntityUid target, EntityUid user, EntityUid toolEnt
 
                 break;
             case WiresAction.Mend:
-                if (!_toolSystem.HasQuality(toolEntity, "Cutting", tool))
+                if (!Tool.HasQuality(toolEntity, "Cutting", tool))
                 {
                     _popupSystem.PopupCursor(Loc.GetString("wires-component-ui-on-receive-message-need-wirecutters"), user);
                     return;
@@ -739,7 +685,7 @@ private void TryDoWireAction(EntityUid target, EntityUid user, EntityUid toolEnt
 
                 break;
             case WiresAction.Pulse:
-                if (!_toolSystem.HasQuality(toolEntity, "Pulsing", tool))
+                if (!Tool.HasQuality(toolEntity, "Pulsing", tool))
                 {
                     _popupSystem.PopupCursor(Loc.GetString("wires-component-ui-on-receive-message-need-multitool"), user);
                     return;
@@ -798,7 +744,7 @@ private void UpdateWires(EntityUid used, EntityUid user, EntityUid toolEntity, i
         switch (action)
         {
             case WiresAction.Cut:
-                if (!_toolSystem.HasQuality(toolEntity, "Cutting", tool))
+                if (!Tool.HasQuality(toolEntity, "Cutting", tool))
                 {
                     _popupSystem.PopupCursor(Loc.GetString("wires-component-ui-on-receive-message-need-wirecutters"), user);
                     break;
@@ -810,7 +756,7 @@ private void UpdateWires(EntityUid used, EntityUid user, EntityUid toolEntity, i
                     break;
                 }
 
-                _toolSystem.PlayToolSound(toolEntity, tool, user);
+                Tool.PlayToolSound(toolEntity, tool, user);
                 if (wire.Action == null || wire.Action.Cut(user, wire))
                 {
                     wire.IsCut = true;
@@ -819,7 +765,7 @@ private void UpdateWires(EntityUid used, EntityUid user, EntityUid toolEntity, i
                 UpdateUserInterface(used);
                 break;
             case WiresAction.Mend:
-                if (!_toolSystem.HasQuality(toolEntity, "Cutting", tool))
+                if (!Tool.HasQuality(toolEntity, "Cutting", tool))
                 {
                     _popupSystem.PopupCursor(Loc.GetString("wires-component-ui-on-receive-message-need-wirecutters"), user);
                     break;
@@ -831,7 +777,7 @@ private void UpdateWires(EntityUid used, EntityUid user, EntityUid toolEntity, i
                     break;
                 }
 
-                _toolSystem.PlayToolSound(toolEntity, tool, user);
+                Tool.PlayToolSound(toolEntity, tool, user);
                 if (wire.Action == null || wire.Action.Mend(user, wire))
                 {
                     wire.IsCut = false;
@@ -840,7 +786,7 @@ private void UpdateWires(EntityUid used, EntityUid user, EntityUid toolEntity, i
                 UpdateUserInterface(used);
                 break;
             case WiresAction.Pulse:
-                if (!_toolSystem.HasQuality(toolEntity, "Pulsing", tool))
+                if (!Tool.HasQuality(toolEntity, "Pulsing", tool))
                 {
                     _popupSystem.PopupCursor(Loc.GetString("wires-component-ui-on-receive-message-need-multitool"), user);
                     break;
@@ -855,7 +801,7 @@ private void UpdateWires(EntityUid used, EntityUid user, EntityUid toolEntity, i
                 wire.Action?.Pulse(user, wire);
 
                 UpdateUserInterface(used);
-                _audio.PlayPvs(wires.PulseSound, used);
+                Audio.PlayPvs(wires.PulseSound, used);
                 break;
         }
 
diff --git a/Content.Server/Xenoarchaeology/Equipment/Systems/ArtifactCrusherSystem.cs b/Content.Server/Xenoarchaeology/Equipment/Systems/ArtifactCrusherSystem.cs
index 09fdc260d7c..6606f284327 100644
--- a/Content.Server/Xenoarchaeology/Equipment/Systems/ArtifactCrusherSystem.cs
+++ b/Content.Server/Xenoarchaeology/Equipment/Systems/ArtifactCrusherSystem.cs
@@ -106,7 +106,7 @@ public void FinishCrushing(Entity<ArtifactCrusherComponent, EntityStorageCompone
             if (!TryComp<BodyComponent>(contained, out var body))
                 Del(contained);
 
-            var gibs = _body.GibBody(contained, body: body, gibOrgans: true, deleteBrain: true);
+            var gibs = _body.GibBody(contained, body: body, gibOrgans: true);
             foreach (var gib in gibs)
             {
                 ContainerSystem.Insert((gib, null, null, null), crusher.OutputContainer);
diff --git a/Content.Shared/Access/Components/AccessReaderComponent.cs b/Content.Shared/Access/Components/AccessReaderComponent.cs
index 3f6c9e1c052..b1577979223 100644
--- a/Content.Shared/Access/Components/AccessReaderComponent.cs
+++ b/Content.Shared/Access/Components/AccessReaderComponent.cs
@@ -34,7 +34,7 @@ public sealed partial class AccessReaderComponent : Component
     public List<HashSet<string>> AccessLists = new();
 
     /// <summary>
-    /// A list of <see cref="StationRecordKey"/>s that grant access. Only a single matching key is required tp gaim
+    /// A list of <see cref="StationRecordKey"/>s that grant access. Only a single matching key is required to gain
     /// access.
     /// </summary>
     [DataField]
diff --git a/Content.Shared/Bed/Sleep/SharedSleepingSystem.cs b/Content.Shared/Bed/Sleep/SharedSleepingSystem.cs
index 2ac1c372ca6..505b2a18e7b 100644
--- a/Content.Shared/Bed/Sleep/SharedSleepingSystem.cs
+++ b/Content.Shared/Bed/Sleep/SharedSleepingSystem.cs
@@ -2,6 +2,7 @@
 using Content.Shared.Bed.Sleep;
 using Content.Shared.Damage.ForceSay;
 using Content.Shared.Eye.Blinding.Systems;
+using Content.Shared.Pointing;
 using Content.Shared.Speech;
 using Robust.Shared.Network;
 using Robust.Shared.Prototypes;
@@ -25,6 +26,7 @@ public override void Initialize()
             SubscribeLocalEvent<SleepingComponent, ComponentShutdown>(OnShutdown);
             SubscribeLocalEvent<SleepingComponent, SpeakAttemptEvent>(OnSpeakAttempt);
             SubscribeLocalEvent<SleepingComponent, CanSeeAttemptEvent>(OnSeeAttempt);
+            SubscribeLocalEvent<SleepingComponent, PointAttemptEvent>(OnPointAttempt);
             SubscribeLocalEvent<SleepingComponent, EntityUnpausedEvent>(OnSleepUnpaused);
         }
 
@@ -70,6 +72,11 @@ private void OnSeeAttempt(EntityUid uid, SleepingComponent component, CanSeeAtte
             if (component.LifeStage <= ComponentLifeStage.Running)
                 args.Cancel();
         }
+
+        private void OnPointAttempt(EntityUid uid, SleepingComponent component, PointAttemptEvent args)
+        {
+            args.Cancel();
+        }
     }
 }
 
diff --git a/Content.Shared/Body/Systems/SharedBodySystem.Body.cs b/Content.Shared/Body/Systems/SharedBodySystem.Body.cs
index e5e4edddb07..85b6758d78a 100644
--- a/Content.Shared/Body/Systems/SharedBodySystem.Body.cs
+++ b/Content.Shared/Body/Systems/SharedBodySystem.Body.cs
@@ -5,8 +5,13 @@
 using Content.Shared.Body.Part;
 using Content.Shared.Body.Prototypes;
 using Content.Shared.DragDrop;
+using Content.Shared.Gibbing.Components;
+using Content.Shared.Gibbing.Events;
+using Content.Shared.Gibbing.Systems;
 using Content.Shared.Inventory;
 using Content.Shared.Inventory.Events;
+using Robust.Shared.Audio;
+using Robust.Shared.Audio.Systems;
 using Robust.Shared.Containers;
 using Robust.Shared.Map;
 using Robust.Shared.Utility;
@@ -23,7 +28,10 @@ public partial class SharedBodySystem
      */
 
     [Dependency] private readonly InventorySystem _inventory = default!;
-
+    [Dependency] private readonly GibbingSystem _gibbingSystem = default!;
+    [Dependency] private readonly SharedAudioSystem _audioSystem = default!;
+    private const float GibletLaunchImpulse = 8;
+    private const float GibletLaunchImpulseVariance = 3;
     private void InitializeBody()
     {
         // Body here to handle root body parts.
@@ -263,29 +271,45 @@ public IEnumerable<BodyPartSlot> GetBodyAllSlots(EntityUid bodyId, BodyComponent
         }
     }
 
-    public virtual HashSet<EntityUid> GibBody(EntityUid bodyId, bool gibOrgans = false,
-        BodyComponent? body = null, bool deleteItems = false, bool deleteBrain = false)
+    public virtual HashSet<EntityUid> GibBody(
+        EntityUid bodyId,
+        bool gibOrgans = false,
+        BodyComponent? body = null ,
+        bool deleteItems = false,
+        bool launchGibs = true,
+        Vector2? splatDirection = null,
+        float splatModifier = 1,
+        Angle splatCone = default,
+        SoundSpecifier? gibSoundOverride = null
+        )
     {
         var gibs = new HashSet<EntityUid>();
 
         if (!Resolve(bodyId, ref body, false))
             return gibs;
 
+        var root = GetRootPartOrNull(bodyId, body);
+        if (root != null && TryComp(root.Value.Entity, out GibbableComponent? gibbable))
+        {
+            gibSoundOverride ??= gibbable.GibSound;
+        }
         var parts = GetBodyChildren(bodyId, body).ToArray();
         gibs.EnsureCapacity(parts.Length);
-
         foreach (var part in parts)
         {
-            SharedTransform.AttachToGridOrMap(part.Id);
-            gibs.Add(part.Id);
+
+            _gibbingSystem.TryGibEntityWithRef(bodyId, part.Id, GibType.Gib, GibContentsOption.Skip, ref gibs,
+                playAudio: false, launchGibs:true, launchDirection:splatDirection, launchImpulse: GibletLaunchImpulse * splatModifier,
+                launchImpulseVariance:GibletLaunchImpulseVariance, launchCone: splatCone);
 
             if (!gibOrgans)
                 continue;
 
             foreach (var organ in GetPartOrgans(part.Id, part.Component))
             {
-                SharedTransform.AttachToGridOrMap(organ.Id);
-                gibs.Add(organ.Id);
+                _gibbingSystem.TryGibEntityWithRef(bodyId, organ.Id, GibType.Drop, GibContentsOption.Skip,
+                    ref gibs, playAudio: false, launchImpulse: GibletLaunchImpulse * splatModifier,
+                    launchImpulseVariance:GibletLaunchImpulseVariance, launchCone: splatCone);
             }
         }
         if(TryComp<InventoryComponent>(bodyId, out var inventory))
@@ -296,6 +320,7 @@ public virtual HashSet<EntityUid> GibBody(EntityUid bodyId, bool gibOrgans = fal
                 gibs.Add(item);
             }
         }
+        _audioSystem.PlayPredicted(gibSoundOverride, Transform(bodyId).Coordinates, null);
         return gibs;
     }
 }
diff --git a/Content.Shared/CCVar/CCVars.cs b/Content.Shared/CCVar/CCVars.cs
index a6cb084c9ed..aac3a17b6f8 100644
--- a/Content.Shared/CCVar/CCVars.cs
+++ b/Content.Shared/CCVar/CCVars.cs
@@ -1564,6 +1564,9 @@ public static readonly CVarDef<int>
         public static readonly CVarDef<bool> ReducedMotion =
             CVarDef.Create("accessibility.reduced_motion", false, CVar.CLIENTONLY | CVar.ARCHIVE);
 
+        public static readonly CVarDef<bool> ChatEnableColorName =
+            CVarDef.Create("accessibility.enable_color_name", true, CVar.CLIENTONLY | CVar.ARCHIVE, "Toggles displaying names with individual colors.");
+
         /// <summary>
         /// Screen shake intensity slider, controlling the intensity of the CameraRecoilSystem.
         /// Goes from 0 (no recoil at all) to 1 (regular amounts of recoil)
diff --git a/Content.Shared/Chat/SharedChatSystem.cs b/Content.Shared/Chat/SharedChatSystem.cs
index 47c427008a1..a20d649d238 100644
--- a/Content.Shared/Chat/SharedChatSystem.cs
+++ b/Content.Shared/Chat/SharedChatSystem.cs
@@ -214,4 +214,31 @@ public static string SanitizeAnnouncement(string message, int maxLength = 0, int
 
         return trimmed;
     }
+
+    public static string InjectTagInsideTag(ChatMessage message, string outerTag, string innerTag, string? tagParameter)
+    {
+        var rawmsg = message.WrappedMessage;
+        var tagStart = rawmsg.IndexOf($"[{outerTag}]");
+        var tagEnd = rawmsg.IndexOf($"[/{outerTag}]");
+        if (tagStart < 0 || tagEnd < 0) //If the outer tag is not found, the injection is not performed
+            return rawmsg;
+        tagStart += outerTag.Length + 2;
+
+        string innerTagProcessed = tagParameter != null ? $"[{innerTag}={tagParameter}]" : $"[{innerTag}]";
+
+        rawmsg = rawmsg.Insert(tagEnd, $"[/{innerTag}]");
+        rawmsg = rawmsg.Insert(tagStart, innerTagProcessed);
+
+        return rawmsg;
+    }
+    public static string GetStringInsideTag(ChatMessage message, string tag)
+    {
+        var rawmsg = message.WrappedMessage;
+        var tagStart = rawmsg.IndexOf($"[{tag}]");
+        var tagEnd = rawmsg.IndexOf($"[/{tag}]");
+        if (tagStart < 0 || tagEnd < 0)
+            return "";
+        tagStart += tag.Length + 2;
+        return rawmsg.Substring(tagStart, tagEnd - tagStart);
+    }
 }
diff --git a/Content.Server/Chemistry/Components/SolutionSpikerComponent.cs b/Content.Shared/Chemistry/Components/SolutionSpikerComponent.cs
similarity index 51%
rename from Content.Server/Chemistry/Components/SolutionSpikerComponent.cs
rename to Content.Shared/Chemistry/Components/SolutionSpikerComponent.cs
index 1fad6c9a3e8..e6cf9e02054 100644
--- a/Content.Server/Chemistry/Components/SolutionSpikerComponent.cs
+++ b/Content.Shared/Chemistry/Components/SolutionSpikerComponent.cs
@@ -1,30 +1,40 @@
-namespace Content.Server.Chemistry.Components;
+using Content.Shared.Chemistry.EntitySystems;
+using Robust.Shared.GameStates;
 
-[RegisterComponent]
+namespace Content.Shared.Chemistry.Components;
+
+[RegisterComponent, NetworkedComponent, Access(typeof(SolutionSpikerSystem))]
 public sealed partial class SolutionSpikerComponent : Component
 {
     /// <summary>
     ///     The source solution to take the reagents from in order
     ///     to spike the other solution container.
     /// </summary>
-    [DataField]
-    public string SourceSolution { get; private set; } = string.Empty;
+    [DataField(required: true)]
+    public string SourceSolution = string.Empty;
 
     /// <summary>
     ///     If spiking with this entity should ignore empty containers or not.
     /// </summary>
     [DataField]
-    public bool IgnoreEmpty { get; private set; }
+    public bool IgnoreEmpty;
+
+    /// <summary>
+    /// If true, the entity is deleted after spiking.
+    /// This is almost certainly what you want.
+    /// </summary>
+    [DataField]
+    public bool Delete = true;
 
     /// <summary>
     ///     What should pop up when spiking with this entity.
     /// </summary>
     [DataField]
-    public LocId Popup { get; private set; } = "spike-solution-generic";
+    public LocId Popup = "spike-solution-generic";
 
     /// <summary>
     ///     What should pop up when spiking fails because the container was empty.
     /// </summary>
     [DataField]
-    public LocId PopupEmpty { get; private set; } = "spike-solution-empty-generic";
+    public LocId PopupEmpty = "spike-solution-empty-generic";
 }
diff --git a/Content.Server/Chemistry/EntitySystems/SolutionSpikableSystem.cs b/Content.Shared/Chemistry/EntitySystems/SolutionSpikerSystem.cs
similarity index 61%
rename from Content.Server/Chemistry/EntitySystems/SolutionSpikableSystem.cs
rename to Content.Shared/Chemistry/EntitySystems/SolutionSpikerSystem.cs
index 7518b45a8bc..f179580604c 100644
--- a/Content.Server/Chemistry/EntitySystems/SolutionSpikableSystem.cs
+++ b/Content.Shared/Chemistry/EntitySystems/SolutionSpikerSystem.cs
@@ -1,12 +1,9 @@
-using Content.Server.Chemistry.Components;
-using Content.Server.Chemistry.Containers.EntitySystems;
-using Content.Server.Explosion.EntitySystems;
-using Content.Server.Popups;
+using Content.Shared.Popups;
 using Content.Shared.Chemistry.Components;
 using Content.Shared.Chemistry.Components.SolutionManager;
 using Content.Shared.Interaction;
 
-namespace Content.Server.Chemistry.EntitySystems;
+namespace Content.Shared.Chemistry.EntitySystems;
 
 /// <summary>
 ///     Entity system used to handle when solution containers are 'spiked'
@@ -17,11 +14,10 @@ namespace Content.Server.Chemistry.EntitySystems;
 ///     Examples of spikable entity interactions include pills being dropped into glasses,
 ///     eggs being cracked into bowls, and so on.
 /// </summary>
-public sealed class SolutionSpikableSystem : EntitySystem
+public sealed class SolutionSpikerSystem : EntitySystem
 {
-    [Dependency] private readonly SolutionContainerSystem _solutionContainerSystem = default!;
-    [Dependency] private readonly TriggerSystem _triggerSystem = default!;
-    [Dependency] private readonly PopupSystem _popupSystem = default!;
+    [Dependency] private readonly SharedPopupSystem _popup = default!;
+    [Dependency] private readonly SharedSolutionContainerSystem _solution = default!;
 
     public override void Initialize()
     {
@@ -47,23 +43,24 @@ private void TrySpike(EntityUid source, EntityUid target, EntityUid user, Refill
     {
         if (!Resolve(source, ref spikableSource, ref managerSource, false)
             || !Resolve(target, ref spikableTarget, ref managerTarget, false)
-            || !_solutionContainerSystem.TryGetRefillableSolution((target, spikableTarget, managerTarget), out var targetSoln, out var targetSolution)
-            || !_solutionContainerSystem.TryGetSolution((source, managerSource), spikableSource.SourceSolution, out _, out var sourceSolution))
+            || !_solution.TryGetRefillableSolution((target, spikableTarget, managerTarget), out var targetSoln, out var targetSolution)
+            || !_solution.TryGetSolution((source, managerSource), spikableSource.SourceSolution, out _, out var sourceSolution))
         {
             return;
         }
 
         if (targetSolution.Volume == 0 && !spikableSource.IgnoreEmpty)
         {
-            _popupSystem.PopupEntity(Loc.GetString(spikableSource.PopupEmpty, ("spiked-entity", target), ("spike-entity", source)), user, user);
+            _popup.PopupClient(Loc.GetString(spikableSource.PopupEmpty, ("spiked-entity", target), ("spike-entity", source)), user, user);
             return;
         }
 
-        if (!_solutionContainerSystem.ForceAddSolution(targetSoln.Value, sourceSolution))
+        if (!_solution.ForceAddSolution(targetSoln.Value, sourceSolution))
             return;
 
-        _popupSystem.PopupEntity(Loc.GetString(spikableSource.Popup, ("spiked-entity", target), ("spike-entity", source)), user, user);
+        _popup.PopupClient(Loc.GetString(spikableSource.Popup, ("spiked-entity", target), ("spike-entity", source)), user, user);
         sourceSolution.RemoveAllSolution();
-        _triggerSystem.Trigger(source, user);
+        if (spikableSource.Delete)
+            QueueDel(source);
     }
 }
diff --git a/Content.Shared/Clothing/ClothingEvents.cs b/Content.Shared/Clothing/ClothingEvents.cs
index bb31c568e02..1dcce2402ae 100644
--- a/Content.Shared/Clothing/ClothingEvents.cs
+++ b/Content.Shared/Clothing/ClothingEvents.cs
@@ -64,7 +64,7 @@ public sealed partial class ToggleMaskEvent : InstantActionEvent { }
 ///     Event raised on the mask entity when it is toggled.
 /// </summary>
 [ByRefEvent]
-public readonly record struct ItemMaskToggledEvent(EntityUid Wearer, bool IsToggled, bool IsEquip);
+public readonly record struct ItemMaskToggledEvent(EntityUid Wearer, string? equippedPrefix, bool IsToggled, bool IsEquip);
 
 /// <summary>
 ///     Event raised on the entity wearing the mask when it is toggled.
diff --git a/Content.Shared/Clothing/Components/FoldableClothingComponent.cs b/Content.Shared/Clothing/Components/FoldableClothingComponent.cs
new file mode 100644
index 00000000000..1a40d1dca12
--- /dev/null
+++ b/Content.Shared/Clothing/Components/FoldableClothingComponent.cs
@@ -0,0 +1,33 @@
+using Content.Shared.Inventory;
+using Robust.Shared.GameStates;
+
+namespace Content.Shared.Clothing.Components;
+
+[RegisterComponent, NetworkedComponent]
+public sealed partial class FoldableClothingComponent : Component
+{
+    /// <summary>
+    /// Which slots does this fit into when folded?
+    /// </summary>
+    [DataField]
+    public SlotFlags? FoldedSlots;
+
+    /// <summary>
+    /// Which slots does this fit into when unfolded?
+    /// </summary>
+    [DataField]
+    public SlotFlags? UnfoldedSlots;
+
+
+    /// <summary>
+    /// What equipped prefix does this have while in folded form?
+    /// </summary>
+    [DataField]
+    public string? FoldedEquippedPrefix;
+
+    /// <summary>
+    /// What held prefix does this have while in folded form?
+    /// </summary>
+    [DataField]
+    public string? FoldedHeldPrefix;
+}
diff --git a/Content.Shared/Clothing/Components/MaskComponent.cs b/Content.Shared/Clothing/Components/MaskComponent.cs
index e645524da73..5430417a8cd 100644
--- a/Content.Shared/Clothing/Components/MaskComponent.cs
+++ b/Content.Shared/Clothing/Components/MaskComponent.cs
@@ -1,4 +1,4 @@
-using Content.Shared.Clothing.EntitySystems;
+using Content.Shared.Clothing.EntitySystems;
 using Robust.Shared.GameStates;
 using Robust.Shared.Prototypes;
 
@@ -19,4 +19,7 @@ public sealed partial class MaskComponent : Component
 
     [DataField, AutoNetworkedField]
     public bool IsToggled;
+
+    [DataField, AutoNetworkedField]
+    public string EquippedPrefix = "toggled";
 }
diff --git a/Content.Shared/Clothing/EntitySystems/ClothingSystem.cs b/Content.Shared/Clothing/EntitySystems/ClothingSystem.cs
index 92e31cfd8ea..154171fc054 100644
--- a/Content.Shared/Clothing/EntitySystems/ClothingSystem.cs
+++ b/Content.Shared/Clothing/EntitySystems/ClothingSystem.cs
@@ -113,7 +113,8 @@ private void OnHandleState(EntityUid uid, ClothingComponent component, ref Compo
     private void OnMaskToggled(Entity<ClothingComponent> ent, ref ItemMaskToggledEvent args)
     {
         //TODO: sprites for 'pulled down' state. defaults to invisible due to no sprite with this prefix
-        SetEquippedPrefix(ent, args.IsToggled ? "toggled" : null, ent);
+        if(args.equippedPrefix != null)
+            SetEquippedPrefix(ent, args.IsToggled ? args.equippedPrefix : null, ent);
     }
 
     private void OnEquipDoAfter(Entity<ClothingComponent> ent, ref ClothingEquipDoAfterEvent args)
diff --git a/Content.Shared/Clothing/EntitySystems/FoldableClothingSystem.cs b/Content.Shared/Clothing/EntitySystems/FoldableClothingSystem.cs
new file mode 100644
index 00000000000..27ea1680188
--- /dev/null
+++ b/Content.Shared/Clothing/EntitySystems/FoldableClothingSystem.cs
@@ -0,0 +1,64 @@
+using Content.Shared.Clothing.Components;
+using Content.Shared.Foldable;
+using Content.Shared.Inventory;
+using Content.Shared.Item;
+
+namespace Content.Shared.Clothing.EntitySystems;
+
+public sealed class FoldableClothingSystem : EntitySystem
+{
+    [Dependency] private readonly ClothingSystem _clothingSystem = default!;
+    [Dependency] private readonly InventorySystem _inventorySystem = default!;
+    [Dependency] private readonly SharedItemSystem _itemSystem = default!;
+
+    public override void Initialize()
+    {
+        base.Initialize();
+
+        SubscribeLocalEvent<FoldableClothingComponent, FoldAttemptEvent>(OnFoldAttempt);
+        SubscribeLocalEvent<FoldableClothingComponent, FoldedEvent>(OnFolded);
+    }
+
+    private void OnFoldAttempt(Entity<FoldableClothingComponent> ent, ref FoldAttemptEvent args)
+    {
+        if (args.Cancelled)
+            return;
+
+        // allow folding while equipped if allowed slots are the same:
+        // e.g. flip a hat backwards while on your head
+        if (_inventorySystem.TryGetContainingSlot(ent.Owner, out var slot) &&
+            !ent.Comp.FoldedSlots.Equals(ent.Comp.UnfoldedSlots))
+            args.Cancelled = true;
+    }
+
+    private void OnFolded(Entity<FoldableClothingComponent> ent, ref FoldedEvent args)
+    {
+        if (TryComp<ClothingComponent>(ent.Owner, out var clothingComp) &&
+            TryComp<ItemComponent>(ent.Owner, out var itemComp))
+        {
+            if (args.IsFolded)
+            {
+                if (ent.Comp.FoldedSlots.HasValue)
+                    _clothingSystem.SetSlots(ent.Owner, ent.Comp.FoldedSlots.Value, clothingComp);
+
+                if (ent.Comp.FoldedEquippedPrefix != null)
+                    _clothingSystem.SetEquippedPrefix(ent.Owner, ent.Comp.FoldedEquippedPrefix, clothingComp);
+
+                if (ent.Comp.FoldedHeldPrefix != null)
+                    _itemSystem.SetHeldPrefix(ent.Owner, ent.Comp.FoldedHeldPrefix, false, itemComp);
+            }
+            else
+            {
+                if (ent.Comp.UnfoldedSlots.HasValue)
+                    _clothingSystem.SetSlots(ent.Owner, ent.Comp.UnfoldedSlots.Value, clothingComp);
+
+                if (ent.Comp.FoldedEquippedPrefix != null)
+                    _clothingSystem.SetEquippedPrefix(ent.Owner, null, clothingComp);
+
+                if (ent.Comp.FoldedHeldPrefix != null)
+                    _itemSystem.SetHeldPrefix(ent.Owner, null, false, itemComp);
+
+            }
+        }
+    }
+}
diff --git a/Content.Shared/Clothing/EntitySystems/MaskSystem.cs b/Content.Shared/Clothing/EntitySystems/MaskSystem.cs
index 2bbcad4bc4d..aab2a172dc1 100644
--- a/Content.Shared/Clothing/EntitySystems/MaskSystem.cs
+++ b/Content.Shared/Clothing/EntitySystems/MaskSystem.cs
@@ -1,7 +1,9 @@
 using Content.Shared.Actions;
 using Content.Shared.Clothing.Components;
+using Content.Shared.Foldable;
 using Content.Shared.Inventory;
 using Content.Shared.Inventory.Events;
+using Content.Shared.Item;
 using Content.Shared.Popups;
 using Robust.Shared.Timing;
 
@@ -21,11 +23,12 @@ public override void Initialize()
         SubscribeLocalEvent<MaskComponent, ToggleMaskEvent>(OnToggleMask);
         SubscribeLocalEvent<MaskComponent, GetItemActionsEvent>(OnGetActions);
         SubscribeLocalEvent<MaskComponent, GotUnequippedEvent>(OnGotUnequipped);
+        SubscribeLocalEvent<MaskComponent, FoldedEvent>(OnFolded);
     }
 
     private void OnGetActions(EntityUid uid, MaskComponent component, GetItemActionsEvent args)
     {
-        if (!args.InHands)
+        if (_inventorySystem.InSlotWithFlags(uid, SlotFlags.MASK))
             args.AddAction(ref component.ToggleActionEntity, component.ToggleAction);
     }
 
@@ -46,7 +49,7 @@ private void OnToggleMask(Entity<MaskComponent> ent, ref ToggleMaskEvent args)
         else
             _popupSystem.PopupEntity(Loc.GetString("action-mask-pull-up-popup-message", ("mask", uid)), args.Performer, args.Performer);
 
-        ToggleMaskComponents(uid, mask, args.Performer);
+        ToggleMaskComponents(uid, mask, args.Performer, mask.EquippedPrefix);
     }
 
     // set to untoggled when unequipped, so it isn't left in a 'pulled down' state
@@ -59,15 +62,22 @@ private void OnGotUnequipped(EntityUid uid, MaskComponent mask, GotUnequippedEve
         Dirty(uid, mask);
         _actionSystem.SetToggled(mask.ToggleActionEntity, mask.IsToggled);
 
-        ToggleMaskComponents(uid, mask, args.Equipee, true);
+        ToggleMaskComponents(uid, mask, args.Equipee, mask.EquippedPrefix, true);
     }
 
-    private void ToggleMaskComponents(EntityUid uid, MaskComponent mask, EntityUid wearer, bool isEquip = false)
+    private void ToggleMaskComponents(EntityUid uid, MaskComponent mask, EntityUid wearer, string? equippedPrefix = null, bool isEquip = false)
     {
-        var maskEv = new ItemMaskToggledEvent(wearer, mask.IsToggled, isEquip);
+        var maskEv = new ItemMaskToggledEvent(wearer, equippedPrefix, mask.IsToggled, isEquip);
         RaiseLocalEvent(uid, ref maskEv);
 
         var wearerEv = new WearerMaskToggledEvent(mask.IsToggled);
         RaiseLocalEvent(wearer, ref wearerEv);
     }
+
+    private void OnFolded(Entity<MaskComponent> ent, ref FoldedEvent args)
+    {
+        ent.Comp.IsToggled = args.IsFolded;
+
+        ToggleMaskComponents(ent.Owner, ent.Comp, ent.Owner);
+    }
 }
diff --git a/Content.Shared/CriminalRecords/Components/CriminalRecordsConsoleComponent.cs b/Content.Shared/CriminalRecords/Components/CriminalRecordsConsoleComponent.cs
new file mode 100644
index 00000000000..70e927e3cb8
--- /dev/null
+++ b/Content.Shared/CriminalRecords/Components/CriminalRecordsConsoleComponent.cs
@@ -0,0 +1,45 @@
+using Content.Shared.CriminalRecords.Systems;
+using Content.Shared.Radio;
+using Content.Shared.StationRecords;
+using Robust.Shared.Prototypes;
+
+namespace Content.Shared.CriminalRecords.Components;
+
+/// <summary>
+/// A component for Criminal Record Console storing an active station record key and a currently applied filter
+/// </summary>
+[RegisterComponent]
+[Access(typeof(SharedCriminalRecordsConsoleSystem))]
+public sealed partial class CriminalRecordsConsoleComponent : Component
+{
+    /// <summary>
+    /// Currently active station record key.
+    /// There is no station parameter as the console uses the current station.
+    /// </summary>
+    /// <remarks>
+    /// TODO: in the future this should be clientside instead of something players can fight over.
+    /// Client selects a record and tells the server the key it wants records for.
+    /// Server then sends a state with just the records, not the listing or filter, and the client updates just that.
+    /// I don't know if it's possible to have multiple bui states right now.
+    /// </remarks>
+    [DataField]
+    public uint? ActiveKey;
+
+    /// <summary>
+    /// Currently applied filter.
+    /// </summary>
+    [DataField]
+    public StationRecordsFilter? Filter;
+
+    /// <summary>
+    /// Channel to send messages to when someone's status gets changed.
+    /// </summary>
+    [DataField]
+    public ProtoId<RadioChannelPrototype> SecurityChannel = "Security";
+
+    /// <summary>
+    /// Max length of arrest and crime history strings.
+    /// </summary>
+    [DataField]
+    public uint MaxStringLength = 256;
+}
diff --git a/Content.Shared/CriminalRecords/CriminalRecord.cs b/Content.Shared/CriminalRecords/CriminalRecord.cs
new file mode 100644
index 00000000000..0fe23d43954
--- /dev/null
+++ b/Content.Shared/CriminalRecords/CriminalRecord.cs
@@ -0,0 +1,38 @@
+using Content.Shared.Security;
+using Robust.Shared.Serialization;
+
+namespace Content.Shared.CriminalRecords;
+
+/// <summary>
+/// Criminal record for a crewmember.
+/// Can be viewed and edited in a criminal records console by security.
+/// </summary>
+[Serializable, NetSerializable, DataRecord]
+public sealed record CriminalRecord
+{
+    /// <summary>
+    /// Status of the person (None, Wanted, Detained).
+    /// </summary>
+    [DataField]
+    public SecurityStatus Status = SecurityStatus.None;
+
+    /// <summary>
+    /// When Status is Wanted, the reason for it.
+    /// Should never be set otherwise.
+    /// </summary>
+    [DataField]
+    public string? Reason;
+
+    /// <summary>
+    /// Criminal history of the person.
+    /// This should have charges and time served added after someone is detained.
+    /// </summary>
+    [DataField]
+    public List<CrimeHistory> History = new();
+}
+
+/// <summary>
+/// A line of criminal activity and the time it was added at.
+/// </summary>
+[Serializable, NetSerializable]
+public record struct CrimeHistory(TimeSpan AddTime, string Crime);
diff --git a/Content.Shared/CriminalRecords/CriminalRecordsUi.cs b/Content.Shared/CriminalRecords/CriminalRecordsUi.cs
new file mode 100644
index 00000000000..287de36ac73
--- /dev/null
+++ b/Content.Shared/CriminalRecords/CriminalRecordsUi.cs
@@ -0,0 +1,102 @@
+using Content.Shared.Security;
+using Content.Shared.StationRecords;
+using Robust.Shared.Serialization;
+
+namespace Content.Shared.CriminalRecords;
+
+[Serializable, NetSerializable]
+public enum CriminalRecordsConsoleKey : byte
+{
+    Key
+}
+
+/// <summary>
+///     Criminal records console state. There are a few states:
+///     - SelectedKey null, Record null, RecordListing null
+///         - The station record database could not be accessed.
+///     - SelectedKey null, Record null, RecordListing non-null
+///         - Records are populated in the database, or at least the station has
+///           the correct component.
+///     - SelectedKey non-null, Record null, RecordListing non-null
+///         - The selected key does not have a record tied to it.
+///     - SelectedKey non-null, Record non-null, RecordListing non-null
+///         - The selected key has a record tied to it, and the record has been sent.
+///
+///     - there is added new filters and so added new states
+///         -SelectedKey null, Record null, RecordListing null, filters non-null
+///            the station may have data, but they all did not pass through the filters
+///
+///     Other states are erroneous.
+/// </summary>
+[Serializable, NetSerializable]
+public sealed class CriminalRecordsConsoleState : BoundUserInterfaceState
+{
+    /// <summary>
+    /// Currently selected crewmember record key.
+    /// </summary>
+    public uint? SelectedKey = null;
+
+    public CriminalRecord? CriminalRecord = null;
+    public GeneralStationRecord? StationRecord = null;
+    public readonly Dictionary<uint, string>? RecordListing;
+    public readonly StationRecordsFilter? Filter;
+
+    public CriminalRecordsConsoleState(Dictionary<uint, string>? recordListing, StationRecordsFilter? newFilter)
+    {
+        RecordListing = recordListing;
+        Filter = newFilter;
+    }
+
+    /// <summary>
+    /// Default state for opening the console
+    /// </summary>
+    public CriminalRecordsConsoleState() : this(null, null)
+    {
+    }
+
+    public bool IsEmpty() => SelectedKey == null && StationRecord == null && CriminalRecord == null && RecordListing == null;
+}
+
+/// <summary>
+/// Used to change status, respecting the wanted/reason nullability rules in <see cref="CriminalRecord"/>.
+/// </summary>
+[Serializable, NetSerializable]
+public sealed class CriminalRecordChangeStatus : BoundUserInterfaceMessage
+{
+    public readonly SecurityStatus Status;
+    public readonly string? Reason;
+
+    public CriminalRecordChangeStatus(SecurityStatus status, string? reason)
+    {
+        Status = status;
+        Reason = reason;
+    }
+}
+
+/// <summary>
+/// Used to add a single line to the record's crime history.
+/// </summary>
+[Serializable, NetSerializable]
+public sealed class CriminalRecordAddHistory : BoundUserInterfaceMessage
+{
+    public readonly string Line;
+
+    public CriminalRecordAddHistory(string line)
+    {
+        Line = line;
+    }
+}
+
+/// <summary>
+/// Used to delete a single line from the crime history, by index.
+/// </summary>
+[Serializable, NetSerializable]
+public sealed class CriminalRecordDeleteHistory : BoundUserInterfaceMessage
+{
+    public readonly uint Index;
+
+    public CriminalRecordDeleteHistory(uint index)
+    {
+        Index = index;
+    }
+}
diff --git a/Content.Shared/CriminalRecords/Systems/SharedCriminalRecordsConsoleSystem.cs b/Content.Shared/CriminalRecords/Systems/SharedCriminalRecordsConsoleSystem.cs
new file mode 100644
index 00000000000..f9fc67c8964
--- /dev/null
+++ b/Content.Shared/CriminalRecords/Systems/SharedCriminalRecordsConsoleSystem.cs
@@ -0,0 +1,8 @@
+namespace Content.Shared.CriminalRecords.Systems;
+
+/// <summary>
+/// Nothing is predicted just exists for access.
+/// </summary>
+public abstract class SharedCriminalRecordsConsoleSystem : EntitySystem
+{
+}
diff --git a/Content.Shared/DeviceLinking/Components/TwoWayLeverComponent.cs b/Content.Shared/DeviceLinking/Components/TwoWayLeverComponent.cs
new file mode 100644
index 00000000000..6dfc25582a3
--- /dev/null
+++ b/Content.Shared/DeviceLinking/Components/TwoWayLeverComponent.cs
@@ -0,0 +1,26 @@
+using Robust.Shared.GameStates;
+using Robust.Shared.Prototypes;
+
+namespace Content.Shared.DeviceLinking.Components;
+
+/// <summary>
+/// Simple ternary state for device linking.
+/// </summary>
+[RegisterComponent, NetworkedComponent, AutoGenerateComponentState]
+public sealed partial class TwoWayLeverComponent : Component
+{
+    [DataField, AutoNetworkedField]
+    public TwoWayLeverState State;
+
+    [DataField, AutoNetworkedField]
+    public bool NextSignalLeft;
+
+    [DataField]
+    public ProtoId<SourcePortPrototype> LeftPort = "Left";
+
+    [DataField]
+    public ProtoId<SourcePortPrototype> RightPort = "Right";
+
+    [DataField]
+    public ProtoId<SourcePortPrototype> MiddlePort = "Middle";
+}
diff --git a/Content.Shared/DeviceLinking/SharedDeviceLinkSystem.cs b/Content.Shared/DeviceLinking/SharedDeviceLinkSystem.cs
index 02c0f608532..9610e2e6065 100644
--- a/Content.Shared/DeviceLinking/SharedDeviceLinkSystem.cs
+++ b/Content.Shared/DeviceLinking/SharedDeviceLinkSystem.cs
@@ -1,6 +1,7 @@
 using Content.Shared.Administration.Logs;
 using Content.Shared.Database;
 using Content.Shared.DeviceLinking.Events;
+using Content.Shared.DeviceNetwork;
 using Content.Shared.Popups;
 using Robust.Shared.Prototypes;
 using Robust.Shared.Utility;
@@ -148,6 +149,9 @@ private void OnSinkRemoved(EntityUid sinkUid, DeviceLinkSinkComponent sinkCompon
     /// </summary>
     public void EnsureSourcePorts(EntityUid uid, params string[] ports)
     {
+        if (ports.Length == 0)
+            return;
+
         var comp = EnsureComp<DeviceLinkSourceComponent>(uid);
         comp.Ports ??= new HashSet<string>();
 
@@ -163,6 +167,9 @@ public void EnsureSourcePorts(EntityUid uid, params string[] ports)
     /// </summary>
     public void EnsureSinkPorts(EntityUid uid, params string[] ports)
     {
+        if (ports.Length == 0)
+            return;
+
         var comp = EnsureComp<DeviceLinkSinkComponent>(uid);
         comp.Ports ??= new HashSet<string>();
 
@@ -550,4 +557,20 @@ private void CreateLinkPopup(EntityUid? userId, EntityUid sourceUid, string sour
                 ("machine2", sinkUid), ("port2", PortName<SinkPortPrototype>(sink))), userId.Value, PopupType.Medium);
     }
     #endregion
+
+    #region Sending & Receiving
+    /// <summary>
+    /// Sends a network payload directed at the sink entity.
+    /// Just raises a <see cref="SignalReceivedEvent"/> without data if the source or the sink doesn't have a <see cref="DeviceNetworkComponent"/>
+    /// </summary>
+    /// <param name="uid">The source uid that invokes the port</param>
+    /// <param name="port">The port to invoke</param>
+    /// <param name="data">Optional data to send along</param>
+    /// <param name="sourceComponent"></param>
+    public virtual void InvokePort(EntityUid uid, string port, NetworkPayload? data = null,
+        DeviceLinkSourceComponent? sourceComponent = null)
+    {
+        // NOOP on client for the moment.
+    }
+    #endregion
 }
diff --git a/Content.Server/DeviceLinking/Systems/TwoWayLeverSystem.cs b/Content.Shared/DeviceLinking/Systems/TwoWayLeverSystem.cs
similarity index 95%
rename from Content.Server/DeviceLinking/Systems/TwoWayLeverSystem.cs
rename to Content.Shared/DeviceLinking/Systems/TwoWayLeverSystem.cs
index 7d351dcac56..c8783b05fc7 100644
--- a/Content.Server/DeviceLinking/Systems/TwoWayLeverSystem.cs
+++ b/Content.Shared/DeviceLinking/Systems/TwoWayLeverSystem.cs
@@ -1,14 +1,13 @@
-using Content.Server.DeviceLinking.Components;
-using Content.Shared.DeviceLinking;
+using Content.Shared.DeviceLinking.Components;
 using Content.Shared.Interaction;
 using Content.Shared.Verbs;
 using Robust.Shared.Utility;
 
-namespace Content.Server.DeviceLinking.Systems
+namespace Content.Shared.DeviceLinking.Systems
 {
     public sealed class TwoWayLeverSystem : EntitySystem
     {
-        [Dependency] private readonly DeviceLinkSystem _signalSystem = default!;
+        [Dependency] private readonly SharedDeviceLinkSystem _signalSystem = default!;
         [Dependency] private readonly SharedAppearanceSystem _appearance = default!;
 
         const string _leftToggleImage = "rotate_ccw.svg.192dpi.png";
@@ -111,6 +110,7 @@ private void StateChanged(EntityUid uid, TwoWayLeverComponent component)
                 _ => throw new ArgumentOutOfRangeException()
             };
 
+            Dirty(uid, component);
             _signalSystem.InvokePort(uid, port);
         }
     }
diff --git a/Content.Shared/DeviceNetwork/NetworkPayload.cs b/Content.Shared/DeviceNetwork/NetworkPayload.cs
new file mode 100644
index 00000000000..32393740213
--- /dev/null
+++ b/Content.Shared/DeviceNetwork/NetworkPayload.cs
@@ -0,0 +1,24 @@
+using System.Diagnostics.CodeAnalysis;
+using Robust.Shared.Utility;
+
+namespace Content.Shared.DeviceNetwork;
+
+public sealed class NetworkPayload : Dictionary<string, object?>
+{
+    /// <summary>
+    /// Tries to get a value from the payload and checks if that value is of type  T.
+    /// </summary>
+    /// <typeparam name="T">The type that should be casted to</typeparam>
+    /// <returns>Whether the value was present in the payload and of the required type</returns>
+    public bool TryGetValue<T>(string key, [NotNullWhen(true)] out T? value)
+    {
+        if (this.TryCastValue(key, out T? result))
+        {
+            value = result;
+            return true;
+        }
+
+        value = default;
+        return false;
+    }
+}
diff --git a/Content.Shared/Doors/Systems/SharedDoorSystem.cs b/Content.Shared/Doors/Systems/SharedDoorSystem.cs
index 954c22df382..53d79cada7a 100644
--- a/Content.Shared/Doors/Systems/SharedDoorSystem.cs
+++ b/Content.Shared/Doors/Systems/SharedDoorSystem.cs
@@ -212,9 +212,9 @@ public bool TryToggleDoor(EntityUid uid, DoorComponent? door = null, EntityUid?
         if (!Resolve(uid, ref door))
             return false;
 
-        if (door.State == DoorState.Closed)
+        if (door.State is DoorState.Closed or DoorState.Denying)
         {
-            return TryOpen(uid, door, user, predicted);
+            return TryOpen(uid, door, user, predicted, quiet: door.State == DoorState.Denying);
         }
         else if (door.State == DoorState.Open)
         {
diff --git a/Content.Shared/Foldable/FoldableComponent.cs b/Content.Shared/Foldable/FoldableComponent.cs
index 1943327c0d7..74f6a209136 100644
--- a/Content.Shared/Foldable/FoldableComponent.cs
+++ b/Content.Shared/Foldable/FoldableComponent.cs
@@ -1,5 +1,4 @@
 using Robust.Shared.GameStates;
-using Robust.Shared.Serialization;
 
 namespace Content.Shared.Foldable;
 
@@ -9,23 +8,19 @@ namespace Content.Shared.Foldable;
 /// <remarks>
 /// Will prevent any insertions into containers while this item is unfolded.
 /// </remarks>
-[RegisterComponent]
-[NetworkedComponent]
+[RegisterComponent, NetworkedComponent, AutoGenerateComponentState(true)]
 [Access(typeof(FoldableSystem))]
 public sealed partial class FoldableComponent : Component
 {
-    [DataField("folded")]
+    [DataField("folded"), AutoNetworkedField]
     public bool IsFolded = false;
-}
 
-// ahhh, the ol' "state thats just a copy of the component".
-[Serializable, NetSerializable]
-public sealed class FoldableComponentState : ComponentState
-{
-    public readonly bool IsFolded;
+    [DataField]
+    public bool CanFoldInsideContainer = false;
+
+    [DataField]
+    public LocId UnfoldVerbText = "unfold-verb";
 
-    public FoldableComponentState(bool isFolded)
-    {
-        IsFolded = isFolded;
-    }
+    [DataField]
+    public LocId FoldVerbText = "fold-verb";
 }
diff --git a/Content.Shared/Foldable/FoldableSystem.cs b/Content.Shared/Foldable/FoldableSystem.cs
index 6f2e9f3ee5e..10baf8165b5 100644
--- a/Content.Shared/Foldable/FoldableSystem.cs
+++ b/Content.Shared/Foldable/FoldableSystem.cs
@@ -3,7 +3,6 @@
 using Content.Shared.Storage.Components;
 using Content.Shared.Verbs;
 using Robust.Shared.Containers;
-using Robust.Shared.GameStates;
 using Robust.Shared.Serialization;
 using Robust.Shared.Utility;
 
@@ -20,8 +19,7 @@ public override void Initialize()
         base.Initialize();
 
         SubscribeLocalEvent<FoldableComponent, GetVerbsEvent<AlternativeVerb>>(AddFoldVerb);
-        SubscribeLocalEvent<FoldableComponent, ComponentGetState>(OnGetState);
-        SubscribeLocalEvent<FoldableComponent, ComponentHandleState>(OnHandleState);
+        SubscribeLocalEvent<FoldableComponent, AfterAutoHandleStateEvent>(OnHandleState);
 
         SubscribeLocalEvent<FoldableComponent, ComponentInit>(OnFoldableInit);
         SubscribeLocalEvent<FoldableComponent, ContainerGettingInsertedAttemptEvent>(OnInsertEvent);
@@ -31,18 +29,9 @@ public override void Initialize()
         SubscribeLocalEvent<FoldableComponent, BuckleAttemptEvent>(OnBuckleAttempt);
     }
 
-    private void OnGetState(EntityUid uid, FoldableComponent component, ref ComponentGetState args)
+    private void OnHandleState(EntityUid uid, FoldableComponent component, ref AfterAutoHandleStateEvent args)
     {
-        args.State = new FoldableComponentState(component.IsFolded);
-    }
-
-    private void OnHandleState(EntityUid uid, FoldableComponent component, ref ComponentHandleState args)
-    {
-        if (args.Current is not FoldableComponentState state)
-            return;
-
-        if (state.IsFolded != component.IsFolded)
-            SetFolded(uid, component, state.IsFolded);
+        SetFolded(uid, component, component.IsFolded);
     }
 
     private void OnFoldableInit(EntityUid uid, FoldableComponent component, ComponentInit args)
@@ -90,11 +79,14 @@ public void SetFolded(EntityUid uid, FoldableComponent component, bool folded)
         Dirty(uid, component);
         _appearance.SetData(uid, FoldedVisuals.State, folded);
         _buckle.StrapSetEnabled(uid, !component.IsFolded);
+
+        var ev = new FoldedEvent(folded);
+        RaiseLocalEvent(uid, ref ev);
     }
 
     private void OnInsertEvent(EntityUid uid, FoldableComponent component, ContainerGettingInsertedAttemptEvent args)
     {
-        if (!component.IsFolded)
+        if (!component.IsFolded && !component.CanFoldInsideContainer)
             args.Cancel();
     }
 
@@ -108,8 +100,8 @@ public bool CanToggleFold(EntityUid uid, FoldableComponent? fold = null)
         if (!Resolve(uid, ref fold))
             return false;
 
-        // Can't un-fold in any container (locker, hands, inventory, whatever).
-        if (_container.IsEntityInContainer(uid))
+        // Can't un-fold in any container unless enabled (locker, hands, inventory, whatever).
+        if (_container.IsEntityInContainer(uid) && !fold.CanFoldInsideContainer)
             return false;
 
         var ev = new FoldAttemptEvent();
@@ -142,7 +134,7 @@ private void AddFoldVerb(EntityUid uid, FoldableComponent component, GetVerbsEve
         AlternativeVerb verb = new()
         {
             Act = () => TryToggleFold(uid, component),
-            Text = component.IsFolded ? Loc.GetString("unfold-verb") : Loc.GetString("fold-verb"),
+            Text = component.IsFolded ? Loc.GetString(component.UnfoldVerbText) : Loc.GetString(component.FoldVerbText),
             Icon = new SpriteSpecifier.Texture(new ("/Textures/Interface/VerbIcons/fold.svg.192dpi.png")),
 
             // If the object is unfolded and they click it, they want to fold it, if it's folded, they want to pick it up
@@ -167,3 +159,10 @@ public enum FoldedVisuals : byte
 /// <param name="Cancelled"></param>
 [ByRefEvent]
 public record struct FoldAttemptEvent(bool Cancelled = false);
+
+/// <summary>
+/// Event raised on an entity after it has been folded.
+/// </summary>
+/// <param name="IsFolded"></param>
+[ByRefEvent]
+public readonly record struct FoldedEvent(bool IsFolded);
diff --git a/Content.Shared/Follower/FollowerSystem.cs b/Content.Shared/Follower/FollowerSystem.cs
index 672f3d6487c..5656778a3f9 100644
--- a/Content.Shared/Follower/FollowerSystem.cs
+++ b/Content.Shared/Follower/FollowerSystem.cs
@@ -97,7 +97,7 @@ private void OnGetAlternativeVerbs(GetVerbsEvent<AlternativeVerb> ev)
 
     private void OnFollowerMove(EntityUid uid, FollowerComponent component, ref MoveInputEvent args)
     {
-        if ((args.Component.HeldMoveButtons & MoveButtons.AnyDirection) != MoveButtons.None)
+        if (args.HasDirectionalMovement)
             StopFollowingEntity(uid, component.Following);
     }
 
diff --git a/Content.Shared/Gibbing/Components/GibbableComponent.cs b/Content.Shared/Gibbing/Components/GibbableComponent.cs
new file mode 100644
index 00000000000..9c7501f0282
--- /dev/null
+++ b/Content.Shared/Gibbing/Components/GibbableComponent.cs
@@ -0,0 +1,34 @@
+using Content.Shared.Gibbing.Systems;
+using Robust.Shared.Audio;
+using Robust.Shared.GameStates;
+using Robust.Shared.Prototypes;
+
+namespace Content.Shared.Gibbing.Components;
+
+[RegisterComponent, NetworkedComponent, AutoGenerateComponentState, Access(typeof(GibbingSystem))]
+public sealed partial class GibbableComponent : Component
+{
+    /// <summary>
+    /// Giblet entity prototypes to randomly select from when spawning additional giblets
+    /// </summary>
+    [DataField, AutoNetworkedField]
+    public List<EntProtoId> GibPrototypes = new();
+
+    /// <summary>
+    /// Number of giblet entities to spawn in addition to entity contents
+    /// </summary>
+    [DataField, AutoNetworkedField]
+    public int GibCount;
+
+    /// <summary>
+    /// Sound to be played when this entity is gibbed, only played when playsound is true on the gibbing function
+    /// </summary>
+    [DataField, AutoNetworkedField]
+    public SoundSpecifier? GibSound = new SoundCollectionSpecifier("gib", AudioParams.Default.WithVariation(0.025f));
+
+    /// <summary>
+    /// Max distance giblets can be dropped from an entity when NOT using physics-based scattering
+    /// </summary>
+    [DataField, AutoNetworkedField]
+    public float GibScatterRange = 0.3f;
+}
diff --git a/Content.Shared/Gibbing/Events/GibbingEvents.cs b/Content.Shared/Gibbing/Events/GibbingEvents.cs
new file mode 100644
index 00000000000..949b10eab9a
--- /dev/null
+++ b/Content.Shared/Gibbing/Events/GibbingEvents.cs
@@ -0,0 +1,50 @@
+using Robust.Shared.Serialization;
+
+namespace Content.Shared.Gibbing.Events;
+
+
+
+/// <summary>
+/// Called just before we actually gib the target entity
+/// </summary>
+/// <param name="Target">The entity being gibed</param>
+/// <param name="GibType">What type of gibbing is occuring</param>
+/// <param name="AllowedContainers">Containers we are allow to gib</param>
+/// <param name="ExcludedContainers">Containers we are allow not allowed to gib</param>
+[ByRefEvent] public record struct AttemptEntityContentsGibEvent(
+    EntityUid Target,
+    GibContentsOption GibType,
+    List<string>? AllowedContainers,
+    List<string>? ExcludedContainers
+    );
+
+
+/// <summary>
+/// Called just before we actually gib the target entity
+/// </summary>
+/// <param name="Target">The entity being gibed</param>
+/// <param name="GibletCount">how many giblets to spawn</param>
+/// <param name="GibType">What type of gibbing is occuring</param>
+[ByRefEvent] public record struct AttemptEntityGibEvent(EntityUid Target, int GibletCount, GibType GibType);
+
+/// <summary>
+/// Called immediately after we gib the target entity
+/// </summary>
+/// <param name="Target">The entity being gibbed</param>
+/// <param name="DroppedEntities">Any entities that are spilled out (if any)</param>
+[ByRefEvent] public record struct EntityGibbedEvent(EntityUid Target, List<EntityUid> DroppedEntities);
+
+[Serializable, NetSerializable]
+public enum GibType : byte
+{
+    Skip,
+    Drop,
+    Gib,
+}
+
+public enum GibContentsOption : byte
+{
+    Skip,
+    Drop,
+    Gib
+}
diff --git a/Content.Shared/Gibbing/Systems/GibbingSystem.cs b/Content.Shared/Gibbing/Systems/GibbingSystem.cs
new file mode 100644
index 00000000000..2f5a9cb61c0
--- /dev/null
+++ b/Content.Shared/Gibbing/Systems/GibbingSystem.cs
@@ -0,0 +1,341 @@
+using System.Diagnostics.CodeAnalysis;
+using System.Numerics;
+using Content.Shared.Gibbing.Components;
+using Content.Shared.Gibbing.Events;
+using Robust.Shared.Audio.Systems;
+using Robust.Shared.Containers;
+using Robust.Shared.Map;
+using Robust.Shared.Physics.Systems;
+using Robust.Shared.Prototypes;
+using Robust.Shared.Random;
+
+namespace Content.Shared.Gibbing.Systems;
+
+public sealed class GibbingSystem : EntitySystem
+{
+    [Dependency] private readonly SharedContainerSystem _containerSystem = default!;
+    [Dependency] private readonly SharedTransformSystem _transformSystem = default!;
+    [Dependency] private readonly IPrototypeManager _prototypeManager = default!;
+    [Dependency] private readonly SharedAudioSystem _audioSystem = default!;
+    [Dependency] private readonly SharedPhysicsSystem _physicsSystem = default!;
+    [Dependency] private readonly IRobustRandom _random = default!;
+
+    //TODO: (future optimization) implement a system that "caps" giblet entities by deleting the oldest ones once we reach a certain limit, customizable via CVAR
+
+    /// <summary>
+    /// Attempt to gib a specified entity. That entity must have a gibable components. This method is NOT recursive will only
+    /// work on the target and any entities it contains (depending on gibContentsOption)
+    /// </summary>
+    /// <param name="outerEntity">The outermost entity we care about, used to place the dropped items</param>
+    /// <param name="gibbable">Target entity/comp we wish to gib</param>
+    /// <param name="gibType">What type of gibing are we performing</param>
+    /// <param name="gibContentsOption">What type of gibing do we perform on any container contents?</param>
+    /// <param name="droppedEntities">a hashset containing all the entities that have been dropped/created</param>
+    /// <param name="randomSpreadMod">How much to multiply the random spread on dropped giblets(if we are dropping them!)</param>
+    /// <param name="playAudio">Should we play audio</param>
+    /// <param name="allowedContainers">A list of containerIds on the target that permit gibing</param>
+    /// <param name="excludedContainers">A list of containerIds on the target that DO NOT permit gibing</param>
+    /// <param name="launchCone">The cone we are launching giblets in (if we are launching them!)</param>
+    /// <param name="launchGibs">Should we launch giblets or just drop them</param>
+    /// <param name="launchDirection">The direction to launch giblets (if we are launching them!)</param>
+    /// <param name="launchImpulse">The impluse to launch giblets at(if we are launching them!)</param>
+    /// /// <param name="logMissingGibable">Should we log if we are missing a gibbableComp when we call this function</param>
+    /// <param name="launchImpulseVariance">The variation in giblet launch impulse (if we are launching them!)</param>
+    /// <returns>True if successful, false if not</returns>
+    public bool TryGibEntity(EntityUid outerEntity, Entity<GibbableComponent?> gibbable, GibType gibType,
+        GibContentsOption gibContentsOption,
+        out HashSet<EntityUid> droppedEntities, bool launchGibs = true,
+        Vector2 launchDirection = default, float launchImpulse = 0f, float launchImpulseVariance = 0f,
+        Angle launchCone = default,
+        float randomSpreadMod = 1.0f, bool playAudio = true, List<string>? allowedContainers = null,
+        List<string>? excludedContainers = null, bool logMissingGibable = false)
+    {
+        droppedEntities = new();
+        return TryGibEntityWithRef(outerEntity, gibbable, gibType, gibContentsOption, ref droppedEntities,
+            launchGibs, launchDirection, launchImpulse, launchImpulseVariance, launchCone, randomSpreadMod, playAudio,
+            allowedContainers, excludedContainers, logMissingGibable);
+    }
+
+
+    /// <summary>
+    /// Attempt to gib a specified entity. That entity must have a gibable components. This method is NOT recursive will only
+    /// work on the target and any entities it contains (depending on gibContentsOption)
+    /// </summary>
+    /// <param name="outerEntity">The outermost entity we care about, used to place the dropped items</param>
+    /// <param name="gibbable">Target entity/comp we wish to gib</param>
+    /// <param name="gibType">What type of gibing are we performing</param>
+    /// <param name="gibContentsOption">What type of gibing do we perform on any container contents?</param>
+    /// <param name="droppedEntities">a hashset containing all the entities that have been dropped/created</param>
+    /// <param name="randomSpreadMod">How much to multiply the random spread on dropped giblets(if we are dropping them!)</param>
+    /// <param name="playAudio">Should we play audio</param>
+    /// <param name="allowedContainers">A list of containerIds on the target that permit gibing</param>
+    /// <param name="excludedContainers">A list of containerIds on the target that DO NOT permit gibing</param>
+    /// <param name="launchCone">The cone we are launching giblets in (if we are launching them!)</param>
+    /// <param name="launchGibs">Should we launch giblets or just drop them</param>
+    /// <param name="launchDirection">The direction to launch giblets (if we are launching them!)</param>
+    /// <param name="launchImpulse">The impluse to launch giblets at(if we are launching them!)</param>
+    /// <param name="launchImpulseVariance">The variation in giblet launch impulse (if we are launching them!)</param>
+    /// <param name="logMissingGibable">Should we log if we are missing a gibbableComp when we call this function</param>
+    /// <returns>True if successful, false if not</returns>
+    public bool TryGibEntityWithRef(
+        EntityUid outerEntity,
+        Entity<GibbableComponent?> gibbable,
+        GibType gibType,
+        GibContentsOption gibContentsOption,
+        ref HashSet<EntityUid> droppedEntities,
+        bool launchGibs = true,
+        Vector2? launchDirection = null,
+        float launchImpulse = 0f,
+        float launchImpulseVariance = 0f,
+        Angle launchCone = default,
+        float randomSpreadMod = 1.0f,
+        bool playAudio = true,
+        List<string>? allowedContainers = null,
+        List<string>? excludedContainers = null,
+        bool logMissingGibable = false)
+    {
+        if (!Resolve(gibbable, ref gibbable.Comp, logMissing: false))
+        {
+            DropEntity(gibbable, Transform(outerEntity), randomSpreadMod, ref droppedEntities,
+                launchGibs, launchDirection, launchImpulse, launchImpulseVariance, launchCone);
+            if (logMissingGibable)
+            {
+                Log.Warning($"{ToPrettyString(gibbable)} does not have a GibbableComponent! " +
+                            $"This is not required but may cause issues contained items to not be dropped.");
+            }
+
+            return false;
+        }
+
+        if (gibType == GibType.Skip && gibContentsOption == GibContentsOption.Skip)
+            return true;
+        if (launchGibs)
+        {
+            randomSpreadMod = 0;
+        }
+
+        var parentXform = Transform(outerEntity);
+        HashSet<BaseContainer> validContainers = new();
+        var gibContentsAttempt =
+            new AttemptEntityContentsGibEvent(gibbable, gibContentsOption, allowedContainers, excludedContainers);
+        RaiseLocalEvent(gibbable, ref gibContentsAttempt);
+
+        foreach (var container in _containerSystem.GetAllContainers(gibbable))
+        {
+            var valid = true;
+            if (allowedContainers != null)
+                valid = allowedContainers.Contains(container.ID);
+            if (excludedContainers != null)
+                valid = valid && !excludedContainers.Contains(container.ID);
+            if (valid)
+                validContainers.Add(container);
+        }
+
+        switch (gibContentsOption)
+        {
+            case GibContentsOption.Skip:
+                break;
+            case GibContentsOption.Drop:
+            {
+                foreach (var container in validContainers)
+                {
+                    foreach (var ent in container.ContainedEntities)
+                    {
+                        DropEntity(new Entity<GibbableComponent?>(ent, null), parentXform, randomSpreadMod,
+                            ref droppedEntities, launchGibs,
+                            launchDirection, launchImpulse, launchImpulseVariance, launchCone);
+                    }
+                }
+
+                break;
+            }
+            case GibContentsOption.Gib:
+            {
+                foreach (var container in validContainers)
+                {
+                    foreach (var ent in container.ContainedEntities)
+                    {
+                        GibEntity(new Entity<GibbableComponent?>(ent, null), parentXform, randomSpreadMod,
+                            ref droppedEntities, launchGibs,
+                            launchDirection, launchImpulse, launchImpulseVariance, launchCone);
+                    }
+                }
+
+                break;
+            }
+        }
+
+        switch (gibType)
+        {
+            case GibType.Skip:
+                break;
+            case GibType.Drop:
+            {
+                DropEntity(gibbable, parentXform, randomSpreadMod, ref droppedEntities, launchGibs,
+                    launchDirection, launchImpulse, launchImpulseVariance, launchCone);
+                break;
+            }
+            case GibType.Gib:
+            {
+                GibEntity(gibbable, parentXform, randomSpreadMod, ref droppedEntities, launchGibs,
+                    launchDirection, launchImpulse, launchImpulseVariance, launchCone);
+                break;
+            }
+        }
+
+        if (playAudio)
+        {
+            _audioSystem.PlayPredicted(gibbable.Comp.GibSound, parentXform.Coordinates, null);
+        }
+
+        if (gibType == GibType.Gib)
+            QueueDel(gibbable);
+        return true;
+    }
+
+    private void DropEntity(Entity<GibbableComponent?> gibbable, TransformComponent parentXform, float randomSpreadMod,
+        ref HashSet<EntityUid> droppedEntities, bool flingEntity, Vector2? scatterDirection, float scatterImpulse,
+        float scatterImpulseVariance, Angle scatterCone)
+    {
+        var gibCount = 0;
+        if (Resolve(gibbable, ref gibbable.Comp, logMissing: false))
+        {
+            gibCount = gibbable.Comp.GibCount;
+        }
+
+        var gibAttemptEvent = new AttemptEntityGibEvent(gibbable, gibCount, GibType.Drop);
+        RaiseLocalEvent(gibbable, ref gibAttemptEvent);
+        switch (gibAttemptEvent.GibType)
+        {
+            case GibType.Skip:
+                return;
+            case GibType.Gib:
+                GibEntity(gibbable, parentXform, randomSpreadMod, ref droppedEntities, flingEntity, scatterDirection,
+                    scatterImpulse, scatterImpulseVariance, scatterCone, deleteTarget: false);
+                return;
+        }
+
+        _transformSystem.AttachToGridOrMap(gibbable);
+        _transformSystem.SetCoordinates(gibbable, parentXform.Coordinates);
+        _transformSystem.SetWorldRotation(gibbable, _random.NextAngle());
+        droppedEntities.Add(gibbable);
+        if (flingEntity)
+        {
+            FlingDroppedEntity(gibbable, scatterDirection, scatterImpulse, scatterImpulseVariance, scatterCone);
+        }
+
+        var gibbedEvent = new EntityGibbedEvent(gibbable, new List<EntityUid> {gibbable});
+        RaiseLocalEvent(gibbable, ref gibbedEvent);
+    }
+
+    private List<EntityUid> GibEntity(Entity<GibbableComponent?> gibbable, TransformComponent parentXform,
+        float randomSpreadMod,
+        ref HashSet<EntityUid> droppedEntities, bool flingEntity, Vector2? scatterDirection, float scatterImpulse,
+        float scatterImpulseVariance, Angle scatterCone, bool deleteTarget = true)
+    {
+        var localGibs = new List<EntityUid>();
+        var gibCount = 0;
+        var gibProtoCount = 0;
+        if (Resolve(gibbable, ref gibbable.Comp, logMissing: false))
+        {
+            gibCount = gibbable.Comp.GibCount;
+            gibProtoCount = gibbable.Comp.GibPrototypes.Count;
+        }
+
+        var gibAttemptEvent = new AttemptEntityGibEvent(gibbable, gibCount, GibType.Drop);
+        RaiseLocalEvent(gibbable, ref gibAttemptEvent);
+        switch (gibAttemptEvent.GibType)
+        {
+            case GibType.Skip:
+                return localGibs;
+            case GibType.Drop:
+                DropEntity(gibbable, parentXform, randomSpreadMod, ref droppedEntities, flingEntity,
+                    scatterDirection, scatterImpulse, scatterImpulseVariance, scatterCone);
+                localGibs.Add(gibbable);
+                return localGibs;
+        }
+
+        if (gibbable.Comp != null && gibProtoCount > 0)
+        {
+            if (flingEntity)
+            {
+                for (var i = 0; i < gibAttemptEvent.GibletCount; i++)
+                {
+                    if (!TryCreateRandomGiblet(gibbable.Comp, parentXform.Coordinates, false, out var giblet,
+                            randomSpreadMod))
+                        continue;
+                    FlingDroppedEntity(giblet.Value, scatterDirection, scatterImpulse, scatterImpulseVariance,
+                        scatterCone);
+                    droppedEntities.Add(giblet.Value);
+                }
+            }
+            else
+            {
+                for (var i = 0; i < gibAttemptEvent.GibletCount; i++)
+                {
+                    if (TryCreateRandomGiblet(gibbable.Comp, parentXform.Coordinates, false, out var giblet,
+                            randomSpreadMod))
+                        droppedEntities.Add(giblet.Value);
+                }
+            }
+        }
+
+        _transformSystem.AttachToGridOrMap(gibbable, Transform(gibbable));
+        if (flingEntity)
+        {
+            FlingDroppedEntity(gibbable, scatterDirection, scatterImpulse, scatterImpulseVariance, scatterCone);
+        }
+
+        var gibbedEvent = new EntityGibbedEvent(gibbable, localGibs);
+        RaiseLocalEvent(gibbable, ref gibbedEvent);
+        if (deleteTarget)
+            QueueDel(gibbable);
+        return localGibs;
+    }
+
+
+    public bool TryCreateRandomGiblet(Entity<GibbableComponent?> gibbable, [NotNullWhen(true)] out EntityUid? gibletEntity,
+        float randomSpreadModifier = 1.0f, bool playSound = true)
+    {
+        gibletEntity = null;
+        return Resolve(gibbable, ref gibbable.Comp) && TryCreateRandomGiblet(gibbable.Comp, Transform(gibbable).Coordinates,
+            playSound, out gibletEntity, randomSpreadModifier);
+    }
+
+    public bool TryCreateAndFlingRandomGiblet(Entity<GibbableComponent?> gibbable, [NotNullWhen(true)] out EntityUid? gibletEntity,
+        Vector2 scatterDirection, float force, float scatterImpulseVariance, Angle scatterCone = default,
+        bool playSound = true)
+    {
+        gibletEntity = null;
+        if (!Resolve(gibbable, ref gibbable.Comp) ||
+            !TryCreateRandomGiblet(gibbable.Comp, Transform(gibbable).Coordinates, playSound, out gibletEntity))
+            return false;
+        FlingDroppedEntity(gibletEntity.Value, scatterDirection, force, scatterImpulseVariance, scatterCone);
+        return true;
+    }
+
+    private void FlingDroppedEntity(EntityUid target, Vector2? direction, float impulse, float impulseVariance,
+        Angle scatterConeAngle)
+    {
+        var scatterAngle = direction?.ToAngle() ?? _random.NextAngle();
+        var scatterVector = _random.NextAngle(scatterAngle - scatterConeAngle / 2, scatterAngle + scatterConeAngle / 2)
+            .ToVec() * (impulse + _random.NextFloat(impulseVariance));
+        _physicsSystem.ApplyLinearImpulse(target, scatterVector);
+    }
+
+    private bool TryCreateRandomGiblet(GibbableComponent gibbable, EntityCoordinates coords,
+        bool playSound, [NotNullWhen(true)] out EntityUid? gibletEntity, float? randomSpreadModifier = null)
+    {
+        gibletEntity = null;
+        if (gibbable.GibPrototypes.Count == 0)
+            return false;
+        gibletEntity = Spawn(gibbable.GibPrototypes[_random.Next(0, gibbable.GibPrototypes.Count)],
+            randomSpreadModifier == null
+                ? coords
+                : coords.Offset(_random.NextVector2(gibbable.GibScatterRange * randomSpreadModifier.Value)));
+        if (playSound)
+            _audioSystem.PlayPredicted(gibbable.GibSound, coords, null);
+        _transformSystem.SetWorldRotation(gibletEntity.Value, _random.NextAngle());
+        return true;
+    }
+}
diff --git a/Content.Shared/MedicalScanner/HealthAnalyzerScannedUserMessage.cs b/Content.Shared/MedicalScanner/HealthAnalyzerScannedUserMessage.cs
index eb50323d38f..1e2c2575d9c 100644
--- a/Content.Shared/MedicalScanner/HealthAnalyzerScannedUserMessage.cs
+++ b/Content.Shared/MedicalScanner/HealthAnalyzerScannedUserMessage.cs
@@ -11,12 +11,14 @@ public sealed class HealthAnalyzerScannedUserMessage : BoundUserInterfaceMessage
     public readonly NetEntity? TargetEntity;
     public float Temperature;
     public float BloodLevel;
+    public bool? ScanMode;
 
-    public HealthAnalyzerScannedUserMessage(NetEntity? targetEntity, float temperature, float bloodLevel)
+    public HealthAnalyzerScannedUserMessage(NetEntity? targetEntity, float temperature, float bloodLevel, bool? scanMode)
     {
         TargetEntity = targetEntity;
         Temperature = temperature;
         BloodLevel = bloodLevel;
+        ScanMode = scanMode;
     }
 }
 
diff --git a/Content.Shared/Mobs/Systems/MobStateSystem.Subscribers.cs b/Content.Shared/Mobs/Systems/MobStateSystem.Subscribers.cs
index 8ce12db5183..51991332539 100644
--- a/Content.Shared/Mobs/Systems/MobStateSystem.Subscribers.cs
+++ b/Content.Shared/Mobs/Systems/MobStateSystem.Subscribers.cs
@@ -9,6 +9,7 @@
 using Content.Shared.Item;
 using Content.Shared.Mobs.Components;
 using Content.Shared.Movement.Events;
+using Content.Shared.Pointing;
 using Content.Shared.Pulling.Events;
 using Content.Shared.Speech;
 using Content.Shared.Standing;
@@ -38,6 +39,7 @@ private void SubscribeEvents()
         SubscribeLocalEvent<MobStateComponent, StartPullAttemptEvent>(CheckAct);
         SubscribeLocalEvent<MobStateComponent, UpdateCanMoveEvent>(CheckAct);
         SubscribeLocalEvent<MobStateComponent, StandAttemptEvent>(CheckAct);
+        SubscribeLocalEvent<MobStateComponent, PointAttemptEvent>(CheckAct);
         SubscribeLocalEvent<MobStateComponent, TryingToSleepEvent>(OnSleepAttempt);
         SubscribeLocalEvent<MobStateComponent, CombatModeShouldHandInteractEvent>(OnCombatModeShouldHandInteract);
         SubscribeLocalEvent<MobStateComponent, AttemptPacifiedAttackEvent>(OnAttemptPacifiedAttack);
diff --git a/Content.Shared/Movement/Events/MoveInputEvent.cs b/Content.Shared/Movement/Events/MoveInputEvent.cs
index 2d0f07e6c02..1c677a42e87 100644
--- a/Content.Shared/Movement/Events/MoveInputEvent.cs
+++ b/Content.Shared/Movement/Events/MoveInputEvent.cs
@@ -13,6 +13,8 @@ public readonly struct MoveInputEvent
     public readonly InputMoverComponent Component;
     public readonly MoveButtons OldMovement;
 
+    public bool HasDirectionalMovement => (Component.HeldMoveButtons & MoveButtons.AnyDirection) != MoveButtons.None;
+
     public MoveInputEvent(EntityUid entity, InputMoverComponent component, MoveButtons oldMovement)
     {
         Entity = entity;
diff --git a/Content.Shared/Pointing/Components/SharedPointingArrowComponent.cs b/Content.Shared/Pointing/Components/SharedPointingArrowComponent.cs
index 07613c77463..66cca50c2ed 100644
--- a/Content.Shared/Pointing/Components/SharedPointingArrowComponent.cs
+++ b/Content.Shared/Pointing/Components/SharedPointingArrowComponent.cs
@@ -1,13 +1,22 @@
 using Robust.Shared.GameStates;
+using System.Numerics;
 
 namespace Content.Shared.Pointing.Components;
 
 [NetworkedComponent]
 public abstract partial class SharedPointingArrowComponent : Component
 {
+    /// <summary>
+    /// The position of the sender when the point began.
+    /// </summary>
+    [DataField]
+    [ViewVariables(VVAccess.ReadWrite)]
+    public Vector2 StartPosition;
+
     /// <summary>
     /// When the pointing arrow ends
     /// </summary>
-    [ViewVariables(VVAccess.ReadWrite), DataField("endTime")]
+    [DataField]
+    [ViewVariables(VVAccess.ReadWrite)]
     public TimeSpan EndTime;
 }
diff --git a/Content.Shared/Pointing/SharedPointingSystem.cs b/Content.Shared/Pointing/SharedPointingSystem.cs
index 05e4b4aa27a..bb3436a14b5 100644
--- a/Content.Shared/Pointing/SharedPointingSystem.cs
+++ b/Content.Shared/Pointing/SharedPointingSystem.cs
@@ -1,17 +1,36 @@
 using Robust.Shared.Serialization;
+using System.Numerics;
 
 namespace Content.Shared.Pointing;
 
 public abstract class SharedPointingSystem : EntitySystem
 {
+    protected readonly TimeSpan PointDuration = TimeSpan.FromSeconds(4);
+    protected readonly float PointKeyTimeMove = 0.1f;
+    protected readonly float PointKeyTimeHover = 0.5f;
+
     [Serializable, NetSerializable]
-    protected sealed class PointingArrowComponentState : ComponentState
+    public sealed class SharedPointingArrowComponentState : ComponentState
     {
-        public TimeSpan EndTime;
+        public Vector2 StartPosition { get; init; }
+        public TimeSpan EndTime { get; init; }
+    }
+
+    public bool CanPoint(EntityUid uid)
+    {
+        var ev = new PointAttemptEvent(uid);
+        RaiseLocalEvent(uid, ev, true);
+
+        return !ev.Cancelled;
+    }
+}
 
-        public PointingArrowComponentState(TimeSpan endTime)
-        {
-            EndTime = endTime;
-        }
+public sealed class PointAttemptEvent : CancellableEntityEventArgs
+{
+    public PointAttemptEvent(EntityUid uid)
+    {
+        Uid = uid;
     }
+
+    public EntityUid Uid { get; }
 }
diff --git a/Content.Shared/Preferences/HumanoidCharacterProfile.cs b/Content.Shared/Preferences/HumanoidCharacterProfile.cs
index eed4e018917..24d2c4f56e6 100644
--- a/Content.Shared/Preferences/HumanoidCharacterProfile.cs
+++ b/Content.Shared/Preferences/HumanoidCharacterProfile.cs
@@ -120,7 +120,7 @@ public HumanoidCharacterProfile() : this(
                new HumanoidCharacterAppearance(),
             ClothingPreference.Jumpsuit,
             BackpackPreference.Backpack,
-            SpawnPriorityPreference.Arrivals,
+            SpawnPriorityPreference.None,
             new Dictionary<string, JobPriority>
             {
                 {SharedGameTicker.FallbackOverflowJob, JobPriority.High}
@@ -149,7 +149,7 @@ public static HumanoidCharacterProfile DefaultWithSpecies(string species = Share
                 HumanoidCharacterAppearance.DefaultWithSpecies(species),
                 ClothingPreference.Jumpsuit,
                 BackpackPreference.Backpack,
-                SpawnPriorityPreference.Arrivals,
+                SpawnPriorityPreference.None,
                 new Dictionary<string, JobPriority>
                 {
                     {SharedGameTicker.FallbackOverflowJob, JobPriority.High}
@@ -198,7 +198,7 @@ public static HumanoidCharacterProfile RandomWithSpecies(string species = Shared
 
             var name = GetName(species, gender);
 
-            return new HumanoidCharacterProfile(name, "", species, voiceId, age, sex, gender, HumanoidCharacterAppearance.Random(species, sex), ClothingPreference.Jumpsuit, BackpackPreference.Backpack, SpawnPriorityPreference.Arrivals,
+            return new HumanoidCharacterProfile(name, "", species, voiceId, age, sex, gender, HumanoidCharacterAppearance.Random(species, sex), ClothingPreference.Jumpsuit, BackpackPreference.Backpack, SpawnPriorityPreference.None,
                 new Dictionary<string, JobPriority>
                 {
                     {SharedGameTicker.FallbackOverflowJob, JobPriority.High},
@@ -498,9 +498,10 @@ public void EnsureValid(string[] sponsorPrototypes)
 
             var spawnPriority = SpawnPriority switch
             {
+                SpawnPriorityPreference.None => SpawnPriorityPreference.None,
                 SpawnPriorityPreference.Arrivals => SpawnPriorityPreference.Arrivals,
                 SpawnPriorityPreference.Cryosleep => SpawnPriorityPreference.Cryosleep,
-                _ => SpawnPriorityPreference.Arrivals // Invalid enum values.
+                _ => SpawnPriorityPreference.None // Invalid enum values.
             };
 
             var priorities = new Dictionary<string, JobPriority>(JobPriorities
diff --git a/Content.Shared/Rounding/ContentHelpers.cs b/Content.Shared/Rounding/ContentHelpers.cs
index b1525ed4ee6..9ecee22998b 100644
--- a/Content.Shared/Rounding/ContentHelpers.cs
+++ b/Content.Shared/Rounding/ContentHelpers.cs
@@ -35,27 +35,7 @@ public static int RoundToLevels(double actual, double max, int levels)
             }
 
             var toOne = actual / max;
-            double threshold;
-            if (levels % 2 == 0)
-            {
-                // Basically, if we have an even count of levels, there's no exact "mid point".
-                // Thus, I nominate the first one below the 50% mark.
-                threshold = ((levels / 2f) - 1) / (levels - 1);
-            }
-            else
-            {
-                threshold = 0.5f;
-            }
-
-            var preround = toOne * (levels - 1);
-            if (toOne < threshold || levels <= 2)
-            {
-                return (int) Math.Ceiling(preround);
-            }
-            else
-            {
-                return (int) Math.Floor(preround);
-            }
+            return (int) Math.Ceiling(toOne * (levels - 2));
         }
 
         /// <summary>
diff --git a/Content.Shared/Security/SecurityStatus.cs b/Content.Shared/Security/SecurityStatus.cs
new file mode 100644
index 00000000000..95250a86459
--- /dev/null
+++ b/Content.Shared/Security/SecurityStatus.cs
@@ -0,0 +1,15 @@
+namespace Content.Shared.Security;
+
+/// <summary>
+/// Status used in Criminal Records.
+///
+/// None - the default value
+/// Wanted - the person is being wanted by security
+/// Detained - the person is detained by security
+/// </summary>
+public enum SecurityStatus : byte
+{
+    None,
+    Wanted,
+    Detained
+}
diff --git a/Content.Shared/Silicons/Laws/Components/IonStarmTargetComponent.cs b/Content.Shared/Silicons/Laws/Components/IonStormTargetComponent.cs
similarity index 100%
rename from Content.Shared/Silicons/Laws/Components/IonStarmTargetComponent.cs
rename to Content.Shared/Silicons/Laws/Components/IonStormTargetComponent.cs
diff --git a/Content.Shared/Silicons/Laws/SharedSiliconLawSystem.cs b/Content.Shared/Silicons/Laws/SharedSiliconLawSystem.cs
index 9aa0aa9a381..c0619e6e43d 100644
--- a/Content.Shared/Silicons/Laws/SharedSiliconLawSystem.cs
+++ b/Content.Shared/Silicons/Laws/SharedSiliconLawSystem.cs
@@ -21,6 +21,14 @@ public override void Initialize()
 
     protected virtual void OnAttemptEmag(EntityUid uid, EmagSiliconLawComponent component, ref OnAttemptEmagEvent args)
     {
+        //prevent self emagging
+        if (uid == args.UserUid)
+        {
+            _popup.PopupClient(Loc.GetString("law-emag-cannot-emag-self"), uid, args.UserUid);
+            args.Handled = true;
+            return;
+        }
+
         if (component.RequireOpenPanel &&
             TryComp<WiresPanelComponent>(uid, out var panel) &&
             !panel.Open)
diff --git a/Content.Shared/Slippery/SlidingSystem.cs b/Content.Shared/Slippery/SlidingSystem.cs
index 0af6b203cc5..d44ddc883b9 100644
--- a/Content.Shared/Slippery/SlidingSystem.cs
+++ b/Content.Shared/Slippery/SlidingSystem.cs
@@ -59,5 +59,4 @@ private void OnEndCollide(EntityUid uid, SlidingComponent component, ref EndColl
 
         Dirty(uid, component);
     }
-
 }
diff --git a/Content.Shared/Slippery/SlipperySystem.cs b/Content.Shared/Slippery/SlipperySystem.cs
index 59a1c208ed2..1f602b9b52b 100644
--- a/Content.Shared/Slippery/SlipperySystem.cs
+++ b/Content.Shared/Slippery/SlipperySystem.cs
@@ -9,6 +9,7 @@
 using Robust.Shared.Containers;
 using Robust.Shared.Physics.Components;
 using Robust.Shared.Physics.Systems;
+using Robust.Shared.Utility;
 
 namespace Content.Shared.Slippery;
 
@@ -75,7 +76,11 @@ private void TrySlip(EntityUid uid, SlipperyComponent component, EntityUid other
             _physics.SetLinearVelocity(other, physics.LinearVelocity * component.LaunchForwardsMultiplier, body: physics);
 
             if (component.SuperSlippery)
-                EnsureComp<SlidingComponent>(other);
+            {
+                var sliding = EnsureComp<SlidingComponent>(other);
+                sliding.CollidingEntities.Add(uid);
+                DebugTools.Assert(_physics.GetContactingEntities(other, physics).Contains(uid));
+            }
         }
 
         var playSound = !_statusEffects.HasStatusEffect(other, "KnockedDown");
diff --git a/Content.Shared/StationRecords/SharedGeneralStationRecordConsoleSystem.cs b/Content.Shared/StationRecords/GeneralRecordsUi.cs
similarity index 65%
rename from Content.Shared/StationRecords/SharedGeneralStationRecordConsoleSystem.cs
rename to Content.Shared/StationRecords/GeneralRecordsUi.cs
index 27288a7a1f9..860454efde5 100644
--- a/Content.Shared/StationRecords/SharedGeneralStationRecordConsoleSystem.cs
+++ b/Content.Shared/StationRecords/GeneralRecordsUi.cs
@@ -30,14 +30,16 @@ public enum GeneralStationRecordConsoleKey : byte
 public sealed class GeneralStationRecordConsoleState : BoundUserInterfaceState
 {
     /// <summary>
-    ///     Current selected key.
+    /// Current selected key.
+    /// Station is always the station that owns the console.
     /// </summary>
-    public (NetEntity, uint)? SelectedKey { get; }
-    public GeneralStationRecord? Record { get; }
-    public Dictionary<(NetEntity, uint), string>? RecordListing { get; }
-    public GeneralStationRecordsFilter? Filter { get; }
-    public GeneralStationRecordConsoleState((NetEntity, uint)? key, GeneralStationRecord? record,
-        Dictionary<(NetEntity, uint), string>? recordListing, GeneralStationRecordsFilter? newFilter)
+    public readonly uint? SelectedKey;
+    public readonly GeneralStationRecord? Record;
+    public readonly Dictionary<uint, string>? RecordListing;
+    public readonly StationRecordsFilter? Filter;
+
+    public GeneralStationRecordConsoleState(uint? key, GeneralStationRecord? record,
+        Dictionary<uint, string>? recordListing, StationRecordsFilter? newFilter)
     {
         SelectedKey = key;
         Record = record;
@@ -45,16 +47,24 @@ public GeneralStationRecordConsoleState((NetEntity, uint)? key, GeneralStationRe
         Filter = newFilter;
     }
 
+    public GeneralStationRecordConsoleState() : this(null, null, null, null)
+    {
+    }
+
     public bool IsEmpty() => SelectedKey == null
         && Record == null && RecordListing == null;
 }
 
+/// <summary>
+/// Select a specific crewmember's record, or deselect.
+/// Used by any kind of records console including general and criminal.
+/// </summary>
 [Serializable, NetSerializable]
-public sealed class SelectGeneralStationRecord : BoundUserInterfaceMessage
+public sealed class SelectStationRecord : BoundUserInterfaceMessage
 {
-    public (NetEntity, uint)? SelectedKey { get; }
+    public readonly uint? SelectedKey;
 
-    public SelectGeneralStationRecord((NetEntity, uint)? selectedKey)
+    public SelectStationRecord(uint? selectedKey)
     {
         SelectedKey = selectedKey;
     }
diff --git a/Content.Shared/StationRecords/GeneralStationRecord.cs b/Content.Shared/StationRecords/GeneralStationRecord.cs
index de4cda8f251..2ca34a4ffbd 100644
--- a/Content.Shared/StationRecords/GeneralStationRecord.cs
+++ b/Content.Shared/StationRecords/GeneralStationRecord.cs
@@ -7,46 +7,46 @@ namespace Content.Shared.StationRecords;
 ///     General station record. Indicates the crewmember's name and job.
 /// </summary>
 [Serializable, NetSerializable]
-public sealed class GeneralStationRecord
+public sealed record GeneralStationRecord
 {
     /// <summary>
     ///     Name tied to this station record.
     /// </summary>
-    [ViewVariables]
+    [DataField]
     public string Name = string.Empty;
 
     /// <summary>
     ///     Age of the person that this station record represents.
     /// </summary>
-    [ViewVariables]
+    [DataField]
     public int Age;
 
     /// <summary>
     ///     Job title tied to this station record.
     /// </summary>
-    [ViewVariables]
+    [DataField]
     public string JobTitle = string.Empty;
 
     /// <summary>
     ///     Job icon tied to this station record.
     /// </summary>
-    [ViewVariables]
+    [DataField]
     public string JobIcon = string.Empty;
 
-    [ViewVariables]
+    [DataField]
     public string JobPrototype = string.Empty;
 
     /// <summary>
     ///     Species tied to this station record.
     /// </summary>
-    [ViewVariables]
+    [DataField]
     public string Species = string.Empty;
 
     /// <summary>
     ///     Gender identity tied to this station record.
     /// </summary>
     /// <remarks>Sex should be placed in a medical record, not a general record.</remarks>
-    [ViewVariables]
+    [DataField]
     public Gender Gender = Gender.Epicene;
 
     /// <summary>
@@ -54,18 +54,18 @@ public sealed class GeneralStationRecord
     ///     This is taken from the 'weight' of a job prototype,
     ///     usually.
     /// </summary>
-    [ViewVariables]
+    [DataField]
     public int DisplayPriority;
 
     /// <summary>
     ///     Fingerprint of the person.
     /// </summary>
-    [ViewVariables]
+    [DataField]
     public string? Fingerprint;
 
     /// <summary>
     ///     DNA of the person.
     /// </summary>
-    [ViewVariables]
+    [DataField]
     public string? DNA;
 }
diff --git a/Content.Shared/StationRecords/GeneralStationRecordsFilter.cs b/Content.Shared/StationRecords/GeneralStationRecordsFilter.cs
deleted file mode 100644
index f0322420119..00000000000
--- a/Content.Shared/StationRecords/GeneralStationRecordsFilter.cs
+++ /dev/null
@@ -1,38 +0,0 @@
-using Robust.Shared.Serialization;
-
-namespace Content.Shared.StationRecords;
-
-[Serializable, NetSerializable]
-public sealed class GeneralStationRecordsFilter
-{
-    public GeneralStationRecordFilterType Type { get; set; }
-        = GeneralStationRecordFilterType.Name;
-    public string Value { get; set; } = "";
-    public GeneralStationRecordsFilter(GeneralStationRecordFilterType filterType, string newValue = "")
-    {
-        Type = filterType;
-        Value = newValue;
-    }
-}
-
-[Serializable, NetSerializable]
-public sealed class GeneralStationRecordsFilterMsg : BoundUserInterfaceMessage
-{
-    public string Value { get; }
-    public GeneralStationRecordFilterType Type { get; }
-
-    public GeneralStationRecordsFilterMsg(GeneralStationRecordFilterType filterType,
-        string filterValue)
-    {
-        Type = filterType;
-        Value = filterValue;
-    }
-}
-
-[Serializable, NetSerializable]
-public enum GeneralStationRecordFilterType : byte
-{
-    Name,
-    Prints,
-    DNA,
-}
diff --git a/Content.Shared/StationRecords/StationRecordKey.cs b/Content.Shared/StationRecords/StationRecordKey.cs
index 937c3aa3ef1..3693c0f57d9 100644
--- a/Content.Shared/StationRecords/StationRecordKey.cs
+++ b/Content.Shared/StationRecords/StationRecordKey.cs
@@ -1,10 +1,14 @@
 namespace Content.Shared.StationRecords;
 
-// Station record keys. These should be stored somewhere,
-// preferably within an ID card.
+/// <summary>
+/// Station record keys. These should be stored somewhere,
+/// preferably within an ID card.
+/// This refers to both the id and station. This is suitable for an access reader field etc,
+/// but when you already know the station just store the id itself.
+/// </summary>
 public readonly struct StationRecordKey : IEquatable<StationRecordKey>
 {
-    [DataField("id")]
+    [DataField]
     public readonly uint Id;
 
     [DataField("station")]
diff --git a/Content.Shared/StationRecords/StationRecordsFilter.cs b/Content.Shared/StationRecords/StationRecordsFilter.cs
new file mode 100644
index 00000000000..10b94dda998
--- /dev/null
+++ b/Content.Shared/StationRecords/StationRecordsFilter.cs
@@ -0,0 +1,44 @@
+using Robust.Shared.Serialization;
+
+namespace Content.Shared.StationRecords;
+
+[Serializable, NetSerializable]
+public sealed class StationRecordsFilter
+{
+    public StationRecordFilterType Type = StationRecordFilterType.Name;
+    public string Value  = "";
+
+    public StationRecordsFilter(StationRecordFilterType filterType, string newValue = "")
+    {
+        Type = filterType;
+        Value = newValue;
+    }
+}
+
+/// <summary>
+/// Message for updating the filter on any kind of records console.
+/// </summary>
+[Serializable, NetSerializable]
+public sealed class SetStationRecordFilter : BoundUserInterfaceMessage
+{
+    public readonly string Value;
+    public readonly StationRecordFilterType Type;
+
+    public SetStationRecordFilter(StationRecordFilterType filterType,
+        string filterValue)
+    {
+        Type = filterType;
+        Value = filterValue;
+    }
+}
+
+/// <summary>
+/// Different strings that results can be filtered by.
+/// </summary>
+[Serializable, NetSerializable]
+public enum StationRecordFilterType : byte
+{
+    Name,
+    Prints,
+    DNA,
+}
diff --git a/Content.Shared/Storage/Components/SharedEntityStorageComponent.cs b/Content.Shared/Storage/Components/SharedEntityStorageComponent.cs
index b4cd18f4d5c..b02c97db711 100644
--- a/Content.Shared/Storage/Components/SharedEntityStorageComponent.cs
+++ b/Content.Shared/Storage/Components/SharedEntityStorageComponent.cs
@@ -14,7 +14,7 @@ public abstract partial class SharedEntityStorageComponent : Component
     public readonly float MaxSize = 1.0f; // maximum width or height of an entity allowed inside the storage.
 
     public static readonly TimeSpan InternalOpenAttemptDelay = TimeSpan.FromSeconds(0.5);
-    public TimeSpan LastInternalOpenAttempt;
+    public TimeSpan NextInternalOpenAttempt;
 
     /// <summary>
     ///     Collision masks that get removed when the storage gets opened.
@@ -139,13 +139,16 @@ public sealed class EntityStorageComponentState : ComponentState
 
     public float EnteringRange;
 
-    public EntityStorageComponentState(bool open, int capacity, bool isCollidableWhenOpen, bool openOnMove, float enteringRange)
+    public TimeSpan NextInternalOpenAttempt;
+
+    public EntityStorageComponentState(bool open, int capacity, bool isCollidableWhenOpen, bool openOnMove, float enteringRange, TimeSpan nextInternalOpenAttempt)
     {
         Open = open;
         Capacity = capacity;
         IsCollidableWhenOpen = isCollidableWhenOpen;
         OpenOnMove = openOnMove;
         EnteringRange = enteringRange;
+        NextInternalOpenAttempt = nextInternalOpenAttempt;
     }
 }
 
diff --git a/Content.Shared/Storage/EntitySystems/SharedEntityStorageSystem.cs b/Content.Shared/Storage/EntitySystems/SharedEntityStorageSystem.cs
index 19e41848a1e..636c6038348 100644
--- a/Content.Shared/Storage/EntitySystems/SharedEntityStorageSystem.cs
+++ b/Content.Shared/Storage/EntitySystems/SharedEntityStorageSystem.cs
@@ -48,13 +48,19 @@ public abstract class SharedEntityStorageSystem : EntitySystem
 
     public const string ContainerName = "entity_storage";
 
+    protected void OnEntityUnpausedEvent(EntityUid uid, SharedEntityStorageComponent component, EntityUnpausedEvent args)
+    {
+        component.NextInternalOpenAttempt += args.PausedTime;
+    }
+
     protected void OnGetState(EntityUid uid, SharedEntityStorageComponent component, ref ComponentGetState args)
     {
         args.State = new EntityStorageComponentState(component.Open,
             component.Capacity,
             component.IsCollidableWhenOpen,
             component.OpenOnMove,
-            component.EnteringRange);
+            component.EnteringRange,
+            component.NextInternalOpenAttempt);
     }
 
     protected void OnHandleState(EntityUid uid, SharedEntityStorageComponent component, ref ComponentHandleState args)
@@ -66,6 +72,7 @@ protected void OnHandleState(EntityUid uid, SharedEntityStorageComponent compone
         component.IsCollidableWhenOpen = state.IsCollidableWhenOpen;
         component.OpenOnMove = state.OpenOnMove;
         component.EnteringRange = state.EnteringRange;
+        component.NextInternalOpenAttempt = state.NextInternalOpenAttempt;
     }
 
     protected virtual void OnComponentInit(EntityUid uid, SharedEntityStorageComponent component, ComponentInit args)
@@ -123,10 +130,12 @@ protected void OnRelayMovement(EntityUid uid, SharedEntityStorageComponent compo
         if (!HasComp<HandsComponent>(args.Entity))
             return;
 
-        if (_timing.CurTime < component.LastInternalOpenAttempt + SharedEntityStorageComponent.InternalOpenAttemptDelay)
+        if (_timing.CurTime < component.NextInternalOpenAttempt)
             return;
 
-        component.LastInternalOpenAttempt = _timing.CurTime;
+        component.NextInternalOpenAttempt = _timing.CurTime + SharedEntityStorageComponent.InternalOpenAttemptDelay;
+        Dirty(uid, component);
+
         if (component.OpenOnMove)
         {
             TryOpenStorage(args.Entity, uid);
@@ -198,6 +207,9 @@ public void OpenStorage(EntityUid uid, SharedEntityStorageComponent? component =
         if (!ResolveStorage(uid, ref component))
             return;
 
+        if (component.Open)
+            return;
+
         var beforeev = new StorageBeforeOpenEvent();
         RaiseLocalEvent(uid, ref beforeev);
         component.Open = true;
@@ -216,6 +228,16 @@ public void CloseStorage(EntityUid uid, SharedEntityStorageComponent? component
         if (!ResolveStorage(uid, ref component))
             return;
 
+        if (!component.Open)
+            return;
+
+        // Prevent the container from closing if it is queued for deletion. This is so that the container-emptying
+        // behaviour of DestructionEventArgs is respected. This exists because malicious players were using
+        // destructible boxes to delete entities by having two players simultaneously destroy and close the box in
+        // the same tick.
+        if (EntityManager.IsQueuedForDeletion(uid))
+            return;
+
         component.Open = false;
         Dirty(uid, component);
 
@@ -246,7 +268,7 @@ public void CloseStorage(EntityUid uid, SharedEntityStorageComponent? component
         ModifyComponents(uid, component);
         if (_net.IsClient && _timing.IsFirstTimePredicted)
             _audio.PlayPvs(component.CloseSound, uid);
-        component.LastInternalOpenAttempt = default;
+
         var afterev = new StorageAfterCloseEvent();
         RaiseLocalEvent(uid, ref afterev);
     }
diff --git a/Content.Shared/Store/ListingPrototype.cs b/Content.Shared/Store/ListingPrototype.cs
index b0f72e6dfe6..2f067afbeeb 100644
--- a/Content.Shared/Store/ListingPrototype.cs
+++ b/Content.Shared/Store/ListingPrototype.cs
@@ -2,6 +2,7 @@
 using Content.Shared.FixedPoint;
 using Robust.Shared.Prototypes;
 using Robust.Shared.Serialization;
+using Robust.Shared.Serialization.TypeSerializers.Implementations;
 using Robust.Shared.Serialization.TypeSerializers.Implementations.Custom.Prototype;
 using Robust.Shared.Serialization.TypeSerializers.Implementations.Custom.Prototype.Dictionary;
 using Robust.Shared.Serialization.TypeSerializers.Implementations.Custom.Prototype.List;
@@ -77,6 +78,20 @@ public partial class ListingData : IEquatable<ListingData>, ICloneable
     [DataField("productAction", customTypeSerializer: typeof(PrototypeIdSerializer<EntityPrototype>))]
     public string? ProductAction;
 
+    /// <summary>
+    ///     The listing ID of the related upgrade listing. Can be used to link a <see cref="ProductAction"/> to an
+    ///         upgrade or to use standalone as an upgrade
+    /// </summary>
+    [DataField]
+    public ProtoId<ListingPrototype>? ProductUpgradeID;
+
+    /// <summary>
+    ///     Keeps track of the current action entity this is tied to, for action upgrades
+    /// </summary>
+    [DataField]
+    [NonSerialized]
+    public EntityUid? ProductActionEntity;
+
     /// <summary>
     /// The event that is broadcast when the listing is purchased.
     /// </summary>
@@ -146,6 +161,8 @@ public object Clone()
             Priority = Priority,
             ProductEntity = ProductEntity,
             ProductAction = ProductAction,
+            ProductUpgradeID = ProductUpgradeID,
+            ProductActionEntity = ProductActionEntity,
             ProductEvent = ProductEvent,
             PurchaseAmount = PurchaseAmount,
             RestockTime = RestockTime,
diff --git a/Content.Shared/Store/StoreUi.cs b/Content.Shared/Store/StoreUi.cs
index a142cf4e4fb..27a8ada1855 100644
--- a/Content.Shared/Store/StoreUi.cs
+++ b/Content.Shared/Store/StoreUi.cs
@@ -18,11 +18,14 @@ public sealed class StoreUpdateState : BoundUserInterfaceState
 
     public readonly bool ShowFooter;
 
-    public StoreUpdateState(HashSet<ListingData> listings, Dictionary<string, FixedPoint2> balance, bool showFooter)
+    public readonly bool AllowRefund;
+
+    public StoreUpdateState(HashSet<ListingData> listings, Dictionary<string, FixedPoint2> balance, bool showFooter, bool allowRefund)
     {
         Listings = listings;
         Balance = balance;
         ShowFooter = showFooter;
+        AllowRefund = allowRefund;
     }
 }
 
@@ -72,3 +75,12 @@ public StoreRequestWithdrawMessage(string currency, int amount)
         Amount = amount;
     }
 }
+
+/// <summary>
+///     Used when the refund button is pressed
+/// </summary>
+[Serializable, NetSerializable]
+public sealed class StoreRequestRefundMessage : BoundUserInterfaceMessage
+{
+
+}
diff --git a/Content.Shared/Weapons/Melee/SharedMeleeWeaponSystem.cs b/Content.Shared/Weapons/Melee/SharedMeleeWeaponSystem.cs
index f7ac249f5f2..12455a1f496 100644
--- a/Content.Shared/Weapons/Melee/SharedMeleeWeaponSystem.cs
+++ b/Content.Shared/Weapons/Melee/SharedMeleeWeaponSystem.cs
@@ -524,24 +524,10 @@ protected virtual void DoLightAttack(EntityUid user, LightAttackEvent ev, Entity
                     $"{ToPrettyString(user):actor} melee attacked (light) {ToPrettyString(target.Value):subject} using {ToPrettyString(meleeUid):tool} and dealt {damageResult.GetTotal():damage} damage");
             }
 
-            PlayHitSound(target.Value, user, GetHighestDamageSound(modifiedDamage, _protoManager), hitEvent.HitSoundOverride, component.HitSound);
-        }
-        else
-        {
-            if (hitEvent.HitSoundOverride != null)
-            {
-                Audio.PlayPredicted(hitEvent.HitSoundOverride, meleeUid, user);
-            }
-            else if (!GetDamage(meleeUid, user, component).Any() && component.HitSound != null)
-            {
-                Audio.PlayPredicted(component.HitSound, meleeUid, user);
-            }
-            else
-            {
-                Audio.PlayPredicted(component.NoDamageSound, meleeUid, user);
-            }
         }
 
+        PlayHitSound(target.Value, user, GetHighestDamageSound(modifiedDamage, _protoManager), hitEvent.HitSoundOverride, component.HitSound, component.NoDamageSound);
+
         if (damageResult?.GetTotal() > FixedPoint2.Zero)
         {
             DoDamageEffect(targets, user, targetXform);
@@ -677,22 +663,8 @@ private bool DoHeavyAttack(EntityUid user, HeavyAttackEvent ev, EntityUid meleeU
 
         if (entities.Count != 0)
         {
-            if (appliedDamage.GetTotal() > FixedPoint2.Zero)
-            {
-                var target = entities.First();
-                PlayHitSound(target, user, GetHighestDamageSound(appliedDamage, _protoManager), hitEvent.HitSoundOverride, component.HitSound);
-            }
-            else
-            {
-                if (hitEvent.HitSoundOverride != null)
-                {
-                    Audio.PlayPredicted(hitEvent.HitSoundOverride, meleeUid, user);
-                }
-                else
-                {
-                    Audio.PlayPredicted(component.NoDamageSound, meleeUid, user);
-                }
-            }
+            var target = entities.First();
+            PlayHitSound(target, user, GetHighestDamageSound(appliedDamage, _protoManager), hitEvent.HitSoundOverride, component.HitSound, component.NoDamageSound);
         }
 
         if (appliedDamage.GetTotal() > FixedPoint2.Zero)
@@ -736,7 +708,7 @@ protected virtual bool ArcRaySuccessful(EntityUid targetUid, Vector2 position, A
         return true;
     }
 
-    public void PlayHitSound(EntityUid target, EntityUid? user, string? type, SoundSpecifier? hitSoundOverride, SoundSpecifier? hitSound)
+    public void PlayHitSound(EntityUid target, EntityUid? user, string? type, SoundSpecifier? hitSoundOverride, SoundSpecifier? hitSound, SoundSpecifier? noDamageSound)
     {
         var playedSound = false;
 
@@ -778,6 +750,11 @@ public void PlayHitSound(EntityUid target, EntityUid? user, string? type, SoundS
                 Audio.PlayPredicted(hitSound, coords, user, AudioParams.Default.WithVariation(DamagePitchVariation));
                 playedSound = true;
             }
+            else if (noDamageSound != null)
+            {
+                Audio.PlayPredicted(noDamageSound, coords, user, AudioParams.Default.WithVariation(DamagePitchVariation));
+                playedSound = true;
+            }
         }
 
         // Fallback to generic sounds.
diff --git a/Content.Shared/Wires/SharedWiresSystem.cs b/Content.Shared/Wires/SharedWiresSystem.cs
index a5b43da482e..a40f4283299 100644
--- a/Content.Shared/Wires/SharedWiresSystem.cs
+++ b/Content.Shared/Wires/SharedWiresSystem.cs
@@ -1,29 +1,71 @@
+using Content.Shared.Administration.Logs;
+using Content.Shared.Database;
 using Content.Shared.Examine;
+using Content.Shared.Interaction;
 using Content.Shared.Tools.Systems;
-using Robust.Shared.Prototypes;
+using Robust.Shared.Audio.Systems;
 
 namespace Content.Shared.Wires;
 
 public abstract class SharedWiresSystem : EntitySystem
 {
+    [Dependency] protected readonly ISharedAdminLogManager AdminLogger = default!;
+    [Dependency] protected readonly SharedAppearanceSystem Appearance = default!;
+    [Dependency] protected readonly SharedAudioSystem Audio = default!;
+    [Dependency] protected readonly SharedToolSystem Tool = default!;
+
     public override void Initialize()
     {
         base.Initialize();
 
+        SubscribeLocalEvent<WiresPanelComponent, WirePanelDoAfterEvent>(OnPanelDoAfter);
+        SubscribeLocalEvent<WiresPanelComponent, InteractUsingEvent>(OnInteractUsing);
         SubscribeLocalEvent<WiresPanelComponent, ExaminedEvent>(OnExamine);
     }
 
+    private void OnPanelDoAfter(EntityUid uid, WiresPanelComponent panel, WirePanelDoAfterEvent args)
+    {
+        if (args.Cancelled)
+            return;
+
+        TogglePanel(uid, panel, !panel.Open);
+        AdminLogger.Add(LogType.Action, LogImpact.Low, $"{ToPrettyString(args.User):user} screwed {ToPrettyString(uid):target}'s maintenance panel {(panel.Open ? "open" : "closed")}");
+
+        var sound = panel.Open ? panel.ScrewdriverOpenSound : panel.ScrewdriverCloseSound;
+        Audio.PlayPredicted(sound, uid, args.User);
+    }
+
+    private void OnInteractUsing(Entity<WiresPanelComponent> ent, ref InteractUsingEvent args)
+    {
+        if (!Tool.UseTool(
+                args.Used,
+                args.User,
+                ent,
+                (float) ent.Comp.OpenDelay.TotalSeconds,
+                ent.Comp.OpeningTool,
+                new WirePanelDoAfterEvent()))
+        {
+            return;
+        }
+
+        AdminLogger.Add(LogType.Action, LogImpact.Low,
+            $"{ToPrettyString(args.User):user} is screwing {ToPrettyString(ent):target}'s {(ent.Comp.Open ? "open" : "closed")} maintenance panel at {Transform(ent).Coordinates:targetlocation}");
+        args.Handled = true;
+    }
+
     private void OnExamine(EntityUid uid, WiresPanelComponent component, ExaminedEvent args)
     {
         using (args.PushGroup(nameof(WiresPanelComponent)))
         {
             if (!component.Open)
             {
-                args.PushMarkup(Loc.GetString("wires-panel-component-on-examine-closed"));
+                if (!string.IsNullOrEmpty(component.ExamineTextClosed))
+                    args.PushMarkup(Loc.GetString(component.ExamineTextClosed));
             }
             else
             {
-                args.PushMarkup(Loc.GetString("wires-panel-component-on-examine-open"));
+                if (!string.IsNullOrEmpty(component.ExamineTextOpen))
+                    args.PushMarkup(Loc.GetString(component.ExamineTextOpen));
 
                 if (TryComp<WiresPanelSecurityComponent>(uid, out var wiresPanelSecurity) &&
                     wiresPanelSecurity.Examine != null)
@@ -33,4 +75,34 @@ private void OnExamine(EntityUid uid, WiresPanelComponent component, ExaminedEve
             }
         }
     }
+
+    protected void UpdateAppearance(EntityUid uid, WiresPanelComponent panel)
+    {
+        if (TryComp<AppearanceComponent>(uid, out var appearance))
+            Appearance.SetData(uid, WiresVisuals.MaintenancePanelState, panel.Open && panel.Visible, appearance);
+    }
+
+    public void TogglePanel(EntityUid uid, WiresPanelComponent component, bool open)
+    {
+        component.Open = open;
+        UpdateAppearance(uid, component);
+        Dirty(uid, component);
+
+        var ev = new PanelChangedEvent(component.Open);
+        RaiseLocalEvent(uid, ref ev);
+    }
+
+    public bool IsPanelOpen(Entity<WiresPanelComponent?> entity)
+    {
+        if (!Resolve(entity, ref entity.Comp, false))
+            return true;
+
+        // Listen, i don't know what the fuck this component does. it's stapled on shit for airlocks
+        // but it looks like an almost direct duplication of WiresPanelComponent except with a shittier API.
+        if (TryComp<WiresPanelSecurityComponent>(entity, out var wiresPanelSecurity) &&
+            !wiresPanelSecurity.WiresAccessible)
+            return false;
+
+        return entity.Comp.Open;
+    }
 }
diff --git a/Content.Shared/Wires/WiresPanelComponent.cs b/Content.Shared/Wires/WiresPanelComponent.cs
index 1162d050338..9c7444778e7 100644
--- a/Content.Shared/Wires/WiresPanelComponent.cs
+++ b/Content.Shared/Wires/WiresPanelComponent.cs
@@ -1,5 +1,7 @@
+using Content.Shared.Tools;
 using Robust.Shared.Audio;
 using Robust.Shared.GameStates;
+using Robust.Shared.Prototypes;
 
 namespace Content.Shared.Wires;
 
@@ -27,6 +29,32 @@ public sealed partial class WiresPanelComponent : Component
 
     [DataField("screwdriverCloseSound")]
     public SoundSpecifier ScrewdriverCloseSound = new SoundPathSpecifier("/Audio/Machines/screwdriverclose.ogg");
+
+    /// <summary>
+    /// Amount of times in seconds it takes to open
+    /// </summary>
+    [DataField]
+    public TimeSpan OpenDelay = TimeSpan.FromSeconds(1);
+
+    /// <summary>
+    /// The tool quality needed to open this panel.
+    /// </summary>
+    [DataField]
+    public ProtoId<ToolQualityPrototype> OpeningTool = "Screwing";
+
+    /// <summary>
+    /// Text showed on examine when the panel is closed.
+    /// </summary>
+    /// <returns></returns>
+    [DataField]
+    public LocId? ExamineTextClosed = "wires-panel-component-on-examine-closed";
+
+    /// <summary>
+    /// Text showed on examine when the panel is open.
+    /// </summary>
+    /// <returns></returns>
+    [DataField]
+    public LocId? ExamineTextOpen = "wires-panel-component-on-examine-open";
 }
 
 /// <summary>
diff --git a/Content.Tests/Shared/Utility/ContentHelpers_Test.cs b/Content.Tests/Shared/Utility/ContentHelpers_Test.cs
index 52d4286b8ce..6a546238922 100644
--- a/Content.Tests/Shared/Utility/ContentHelpers_Test.cs
+++ b/Content.Tests/Shared/Utility/ContentHelpers_Test.cs
@@ -18,15 +18,15 @@ public sealed class ContentHelpers_Test
                 (0.01f, 10, 5, 1),
                 (1, 10, 5, 1),
                 (2, 10, 5, 1),
-                (2.5f, 10, 5, 1),
-                (2.51f, 10, 5, 2),
-                (3, 10, 5, 2),
+                (3, 10, 5, 1),
+                (3.33f, 10, 5, 1),
+                (3.34f, 10, 5, 2),
                 (4, 10, 5, 2),
                 (5, 10, 5, 2),
                 (6, 10, 5, 2),
-                (7, 10, 5, 2),
-                (7.49f, 10, 5, 2),
-                (7.5f, 10, 5, 3),
+                (6.66f, 10, 5, 2),
+                (6.67f, 10, 5, 3),
+                (7, 10, 5, 3),
                 (8, 10, 5, 3),
                 (9, 10, 5, 3),
                 (10, 10, 5, 4),
diff --git a/README.md b/README.md
index ce6f2e107a5..a48d2f74d85 100644
--- a/README.md
+++ b/README.md
@@ -14,7 +14,8 @@ Space Station 14 это ремейк SS13, который работает на
 
 ## Контрибьют
 
-В случае если вы хотите добавить новый контент будет лучше, если сначала вы предложите его в [основной репозиторий](https://github.com/space-wizards/space-station-14) или обсудите его необходимость на нашем сервере [Discord](https://discord.station14.ru).
+Мы рады принять вклад от любого человека. Заходите в Discord, если хотите помочь. У нас есть [список проблем](https://github.com/space-syndicate/space-station-14-content/issues), которые нужно решить, и любой может за них взяться. Не бойтесь просить о помощи!
+Только убедитесь, что ваши изменения и PRы соответствуют [руководству по контрибьюту](https://docs.spacestation14.com/en/general-development/codebase-info/pull-request-guidelines.html).
 
 ## Сборка
 
diff --git a/Resources/Changelog/Changelog.yml b/Resources/Changelog/Changelog.yml
index 932f7208ee3..dfa8109198f 100644
--- a/Resources/Changelog/Changelog.yml
+++ b/Resources/Changelog/Changelog.yml
@@ -1,377 +1,4 @@
 Entries:
-- author: Ubaser
-  changes:
-  - message: Chaplains can smack their bible on water to create holy water.
-    type: Add
-  id: 5369
-  time: '2023-12-15T09:52:21.0000000+00:00'
-- author: EmoGarbage404
-  changes:
-  - message: Added the electrolysis unit and the centrifuge. These will be used for
-      chemistry in the future.
-    type: Add
-  id: 5370
-  time: '2023-12-15T09:52:46.0000000+00:00'
-- author: themias
-  changes:
-  - message: Gibbed body parts contain their victim's DNA
-    type: Tweak
-  - message: Implanters, syringes, hyposprays, medipens, and cigarettes transfer DNA
-    type: Tweak
-  - message: Melee weapons that deal blunt/slash/pierce damage transfer DNA
-    type: Tweak
-  - message: Soap and rags can be used to clean evidence off of items, but leave evidence
-      of their own
-    type: Tweak
-  id: 5371
-  time: '2023-12-15T09:52:56.0000000+00:00'
-- author: TheShuEd
-  changes:
-  - message: Added hypodart into uplink. It is capable of piercing armor and injecting
-      up to 7u reagents.
-    type: Add
-  id: 5372
-  time: '2023-12-15T09:55:57.0000000+00:00'
-- author: tgrkzus
-  changes:
-  - message: Open tanks will no longer make noise at very low release pressure.
-    type: Tweak
-  id: 5373
-  time: '2023-12-15T09:56:17.0000000+00:00'
-- author: MendaxxDev
-  changes:
-  - message: The flare gun now explodes, damages and stuns the player when used with
-      wrong ammo
-    type: Tweak
-  id: 5374
-  time: '2023-12-15T09:57:59.0000000+00:00'
-- author: TheShuEd
-  changes:
-  - message: 'Added 2 new artifact effect: attraction and repulsion'
-    type: Add
-  id: 5375
-  time: '2023-12-15T15:39:25.0000000+00:00'
-- author: mirrorcult
-  changes:
-  - message: Explosion visuals now last slightly longer
-    type: Add
-  - message: You will now hear a reverbed explosion sound effect for explosions that
-      are far away from you
-    type: Add
-  - message: Smaller explosions now make a distinct sound compared to larger ones
-    type: Add
-  id: 5376
-  time: '2023-12-15T16:57:46.0000000+00:00'
-- author: Ubaser
-  changes:
-  - message: Artistic toolboxes now have a filled variant that can be found in maintenance
-      occasionally.
-    type: Tweak
-  id: 5377
-  time: '2023-12-15T20:44:42.0000000+00:00'
-- author: Ilya246
-  changes:
-  - message: Cyborg jobs now start with a positronic brain.
-    type: Tweak
-  id: 5378
-  time: '2023-12-15T20:45:31.0000000+00:00'
-- author: deltanedas
-  changes:
-  - message: Borgs can wear hats now. Time to get festive!
-    type: Tweak
-  id: 5379
-  time: '2023-12-15T22:33:52.0000000+00:00'
-- author: mirrorcult
-  changes:
-  - message: Chasms no longer spawn on lava expeditions
-    type: Tweak
-  id: 5380
-  time: '2023-12-15T22:34:09.0000000+00:00'
-- author: EmoGarbage404
-  changes:
-  - message: The guidebook now shows you if a chemical's recipe needs an alternative
-      mixing method, such as a chaplain's blessing or electrolysis.
-    type: Fix
-  id: 5381
-  time: '2023-12-15T23:59:54.0000000+00:00'
-- author: deltanedas
-  changes:
-  - message: Added smoke grenades to the syndicate uplink for 1 TC, they create a
-      large smoke cloud to provide cover for your heinous activites.
-    type: Add
-  - message: Added tear gas grenades to the SecTech and security belts, use them to
-      control riots.
-    type: Add
-  id: 5382
-  time: '2023-12-16T01:49:30.0000000+00:00'
-- author: metalgearsloth
-  changes:
-  - message: Fix map boundaries not pushing you back.
-    type: Fix
-  id: 5383
-  time: '2023-12-16T02:19:54.0000000+00:00'
-- author: Ubaser
-  changes:
-  - message: Crayons boxes now hold a white crayon.
-    type: Tweak
-  id: 5384
-  time: '2023-12-16T03:20:40.0000000+00:00'
-- author: Ubaser
-  changes:
-  - message: Chefs get black pepper packets in their lockers.
-    type: Tweak
-  id: 5385
-  time: '2023-12-16T03:20:51.0000000+00:00'
-- author: Flareguy
-  changes:
-  - message: Resprited the Kammerer, Double-Barrel, and Enforcer shotguns using sprites
-      courtesy of /tg/station.
-    type: Tweak
-  id: 5386
-  time: '2023-12-16T04:23:57.0000000+00:00'
-- author: mirrorcult
-  changes:
-  - message: Scientists can now fabricate faux grass planet and ice tiles with a tier
-      2 civilian services research! They're just as good as the real thing, while
-      being removable.
-    type: Add
-  id: 5387
-  time: '2023-12-16T08:20:57.0000000+00:00'
-- author: Ubaser
-  changes:
-  - message: Lawyers, librarians and reporters now spawn with a luxury pen in their
-      PDA.
-    type: Add
-  id: 5388
-  time: '2023-12-16T08:21:24.0000000+00:00'
-- author: TheShuEd
-  changes:
-  - message: Added 9 new cargo bounties!
-    type: Add
-  id: 5389
-  time: '2023-12-16T08:23:35.0000000+00:00'
-- author: mirrorcult
-  changes:
-  - message: Everyone can toggle fire alarms now, not just atmos
-    type: Tweak
-  id: 5390
-  time: '2023-12-16T08:24:00.0000000+00:00'
-- author: EmoGarbage404
-  changes:
-  - message: A variety of chemicals can now be decomposed via electrolysis or centrifugal
-      force.
-    type: Add
-  id: 5391
-  time: '2023-12-16T08:26:12.0000000+00:00'
-- author: mirrorcult
-  changes:
-  - message: Ejecting a tank from a canister will now try to put it in your hand first
-    type: Fix
-  id: 5392
-  time: '2023-12-16T08:28:28.0000000+00:00'
-- author: TheShuEd
-  changes:
-  - message: Added brother of cak - bread dog! 5 cognizine, sausage bread, animal
-      heart, cooked spaceshrooms and 15 second in microwave = bread dog.
-    type: Add
-  id: 5393
-  time: '2023-12-16T08:30:20.0000000+00:00'
-- author: Ubaser
-  changes:
-  - message: Chemistry now has vials, similar to bottles but are much more durable.
-    type: Add
-  id: 5394
-  time: '2023-12-16T14:29:54.0000000+00:00'
-- author: Vasilis
-  changes:
-  - message: Added Poppy the Safety Opposum!
-    type: Add
-  - message: Opossums have received some new sprites. Old sprites are still available
-      to be spawned in by admins.
-    type: Tweak
-  id: 5395
-  time: '2023-12-16T14:34:54.0000000+00:00'
-- author: deltanedas
-  changes:
-  - message: Fixed explosion resistance from bags being applied to the wearer.
-    type: Fix
-  id: 5396
-  time: '2023-12-16T17:17:09.0000000+00:00'
-- author: deltanedas
-  changes:
-  - message: Added the power sensor for checking power stats in logic circuits.
-    type: Add
-  id: 5397
-  time: '2023-12-16T18:32:42.0000000+00:00'
-- author: Flareguy
-  changes:
-  - message: Standardized all material sheets to 10u of total reagents when grinded.
-      Alloys are still worth the sum of their parts.
-    type: Tweak
-  - message: You can now grind plastic into oil and phosphorous.
-    type: Tweak
-  - message: Steel sheets no longer contain trace amounts of lead in them.
-    type: Tweak
-  id: 5398
-  time: '2023-12-16T20:52:11.0000000+00:00'
-- author: SlamBamActionman
-  changes:
-  - message: Discord bot Changelog now includes hyperlinks to the PRs.
-    type: Add
-  id: 5399
-  time: '2023-12-16T21:00:59.0000000+00:00'
-  url: null
-- author: brainfood1183
-  changes:
-  - message: Crystals now drop crystal shards, you can use them to craft colored light
-      tubes.
-    type: Add
-  id: 5400
-  time: '2023-12-16T22:20:14.0000000+00:00'
-  url: null
-- author: Ilya246
-  changes:
-  - message: Pens now embed and deal damage on throw like spears.
-    type: Add
-  id: 5401
-  time: '2023-12-16T22:23:08.0000000+00:00'
-  url: null
-- author: Emisse
-  changes:
-  - message: Svalinn Laser Pistol and accompanying T3 tech.
-    type: Add
-  id: 5402
-  time: '2023-12-17T03:43:50.0000000+00:00'
-  url: null
-- author: mirrorcult
-  changes:
-  - message: You can now pet the recycler
-    type: Add
-  id: 5403
-  time: '2023-12-17T07:44:37.0000000+00:00'
-  url: null
-- author: Ubaser
-  changes:
-  - message: Mindbreaker is now hallucinogenic.
-    type: Tweak
-  id: 5404
-  time: '2023-12-17T07:44:54.0000000+00:00'
-  url: null
-- author: JoeHammad
-  changes:
-  - message: Paramedics now have a rollerbed in their bag by default
-    type: Add
-  id: 5405
-  time: '2023-12-17T09:55:29.0000000+00:00'
-  url: null
-- author: Ilya246
-  changes:
-  - message: Large cardboard boxes and stealth boxes now inherit their mover's access.
-    type: Fix
-  id: 5406
-  time: '2023-12-17T09:55:40.0000000+00:00'
-  url: null
-- author: TheShuEd
-  changes:
-  - message: Changed hypodart cost from 3 to 2 tc
-    type: Tweak
-  id: 5407
-  time: '2023-12-17T16:08:11.0000000+00:00'
-  url: null
-- author: yathxyz
-  changes:
-  - message: Fixed nix devShell
-    type: Fix
-  id: 5408
-  time: '2023-12-17T16:55:37.0000000+00:00'
-  url: null
-- author: Ubaser
-  changes:
-  - message: HoS parade uniforms are available at the uniform printer.
-    type: Add
-  id: 5409
-  time: '2023-12-17T23:20:04.0000000+00:00'
-  url: null
-- author: Alzore
-  changes:
-  - message: Security zipties are now tiny and easier to store.
-    type: Tweak
-  id: 5410
-  time: '2023-12-17T23:27:01.0000000+00:00'
-  url: null
-- author: Aexxie
-  changes:
-  - message: Added RCDs to all engineering lockers.
-    type: Add
-  id: 5411
-  time: '2023-12-18T02:38:37.0000000+00:00'
-  url: null
-- author: Ubaser
-  changes:
-  - message: Traitors and Nukies can now purchase a Chemical Synthesis Kit for 4TC
-      which contains Vestine.
-    type: Add
-  - message: Nocturine, Tazinide, Stimulants, Lexorin and Mute Toxin are now locked
-      behind Vestine.
-    type: Tweak
-  - message: Lexorin and Heartbreaker toxin are buffed, while Licoxide is nerfed.
-    type: Tweak
-  - message: You can no longer purchase Nocturine through the uplink.
-    type: Remove
-  id: 5412
-  time: '2023-12-18T02:40:28.0000000+00:00'
-  url: null
-- author: Ubaser
-  changes:
-  - message: Janitors now get rubber gloves for cleaning.
-    type: Add
-  id: 5413
-  time: '2023-12-18T03:11:19.0000000+00:00'
-  url: null
-- author: Velcroboy
-  changes:
-  - message: Added coal. Coal has been added to the steel recipe in the Ore Processor.
-      Coal can be ground up for Carbon and other elements. Coal can be mined or received
-      as a gift if you've been naughty.
-    type: Add
-  id: 5414
-  time: '2023-12-18T19:38:12.0000000+00:00'
-  url: null
-- author: Flareguy
-  changes:
-  - message: You can now walk into external and shuttle airlocks to open them, like
-      all other airlocks.
-    type: Tweak
-  id: 5415
-  time: '2023-12-18T19:44:50.0000000+00:00'
-  url: null
-- author: iacore
-  changes:
-  - message: normal closets can now be constructed and deconstructed
-    type: Add
-  id: 5416
-  time: '2023-12-18T19:46:16.0000000+00:00'
-  url: null
-- author: Emisse
-  changes:
-  - message: Walls are stronger and windows are weaker.
-    type: Tweak
-  - message: Secure crates and lockers are a lot stronger.
-    type: Tweak
-  - message: Melee weapons are now more balanced within a closer range of damage.
-    type: Tweak
-  - message: Double energy sword and fireaxe are now unavailable in uplink.
-    type: Tweak
-  id: 5417
-  time: '2023-12-19T02:38:49.0000000+00:00'
-  url: null
-- author: EmoGarbage404
-  changes:
-  - message: Added the RCD and RCD ammo crates to cargo.
-    type: Add
-  id: 5418
-  time: '2023-12-19T02:40:55.0000000+00:00'
-  url: null
 - author: ElectroJr
   changes:
   - message: The fireaxe can now fight fires (melee hits reduce fire stacks).
@@ -3870,3 +3497,380 @@
   id: 5868
   time: '2024-02-02T12:39:13.0000000+00:00'
   url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24749
+- author: Anzarot121
+  changes:
+  - message: Fixed a problem in the code due to which mobs, including hamsters, slimes,
+      spiders, xenos, could not pull things.
+    type: Fix
+  id: 5869
+  time: '2024-02-03T01:25:11.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/22485
+- author: Tayrtahn
+  changes:
+  - message: 'Added a new flavor of Donk Pockets: Stonk Pockets'
+    type: Add
+  id: 5870
+  time: '2024-02-03T01:55:03.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24876
+- author: Hmeister
+  changes:
+  - message: The guidebook entry for cargo is now up to date, and some other minor
+      changes to the guidebook.
+    type: Tweak
+  id: 5871
+  time: '2024-02-03T02:07:21.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24828
+- author: FairlySadPanda
+  changes:
+  - message: The round restart audio, again...
+    type: Fix
+  id: 5872
+  time: '2024-02-03T02:11:53.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24754
+- author: Adrian16199
+  changes:
+  - message: Added scarfs to the uniform printer.
+    type: Add
+  id: 5873
+  time: '2024-02-03T02:12:38.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24735
+- author: Jajsha
+  changes:
+  - message: Emagged Cyborgs are no longer affected by Ion Storm events.
+    type: Fix
+  - message: Improved wording of cyborg laws.
+    type: Tweak
+  id: 5874
+  time: '2024-02-03T02:29:41.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24870
+- author: metalgearsloth
+  changes:
+  - message: Moving entities that are pulled now throws them instead of moving them
+      manually.
+    type: Tweak
+  id: 5875
+  time: '2024-02-03T03:36:09.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/20906
+- author: lzk228
+  changes:
+  - message: Soapy water removed.
+    type: Remove
+  id: 5876
+  time: '2024-02-03T04:23:34.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24301
+- author: Krunk
+  changes:
+  - message: Characters can properly select 'None' as a preference for their spawn
+      priority.
+    type: Fix
+  id: 5877
+  time: '2024-02-03T08:06:44.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24897
+- author: Krunk
+  changes:
+  - message: Pointing arrows now begin at the player and smoothly animate to their
+      target.
+    type: Add
+  id: 5878
+  time: '2024-02-03T08:09:20.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24864
+- author: Dygon
+  changes:
+  - message: Single tile sized puddles of space lube won't let you slide extremely
+      far anymore.
+    type: Fix
+  id: 5879
+  time: '2024-02-03T08:10:51.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24846
+- author: shampunj
+  changes:
+  - message: Fixed incorrect path to the uranium spear image in the construction menu
+    type: Fix
+  id: 5880
+  time: '2024-02-03T08:11:02.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24895
+- author: nikthechampiongr
+  changes:
+  - message: End of round messages no longer loop until the heat death of the universe.
+    type: Fix
+  id: 5881
+  time: '2024-02-03T16:43:50.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24920
+- author: EmoGarbage404
+  changes:
+  - message: Changed the colors used for chat names.
+    type: Tweak
+  id: 5882
+  time: '2024-02-03T17:33:58.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24922
+- author: deltanedas
+  changes:
+  - message: Dissolved the biochem technology discipline into others and roundstart
+      availability.
+    type: Add
+  id: 5883
+  time: '2024-02-03T18:13:30.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24871
+- author: themias
+  changes:
+  - message: EMPs temporarily disable suit sensors
+    type: Tweak
+  id: 5884
+  time: '2024-02-04T00:50:24.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24869
+- author: themias
+  changes:
+  - message: Added face bandanas
+    type: Add
+  - message: Bandanas can be switched between head and face type with an alt verb
+      (Fold)
+    type: Tweak
+  id: 5885
+  time: '2024-02-04T00:52:44.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24597
+- author: metalgearsloth
+  changes:
+  - message: Moving to open lockers is now predicted.
+    type: Fix
+  id: 5886
+  time: '2024-02-04T02:23:16.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24937
+- author: Tayrtahn
+  changes:
+  - message: Added opened/closed visuals and fill levels for a variety of drinks.
+    type: Add
+  id: 5887
+  time: '2024-02-04T20:13:48.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24600
+- author: deltanedas
+  changes:
+  - message: Grilles are no longer incredibly strong.
+    type: Tweak
+  id: 5888
+  time: '2024-02-04T20:48:06.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24881
+- author: Scribbles0
+  changes:
+  - message: Holoparasites can now autoattack at their max attack rate when holding
+      down their attack button.
+    type: Add
+  id: 5889
+  time: '2024-02-04T23:01:49.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24944
+- author: EdenTheLiznerd
+  changes:
+  - message: Sectech no longer says "Let's crack communist skulls!" It now says "Let's
+      crack syndicate skulls!"
+    type: Tweak
+  id: 5890
+  time: '2024-02-05T12:24:52.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24965
+- author: Varen
+  changes:
+  - message: Rebalanced electrocution damage to ramp up slower with power levels.
+    type: Tweak
+  id: 5891
+  time: '2024-02-05T18:47:52.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24829
+- author: ficcialfaint and deltanedas
+  changes:
+  - message: Criminal records and the console that manages them have been added to
+      the game. They also have a guidebook entry.
+    type: Add
+  id: 5892
+  time: '2024-02-05T23:03:04.754935+00:00'
+  url: null
+- author: themias
+  changes:
+  - message: Outlaw Glasses fully hide your identity again
+    type: Tweak
+  id: 5893
+  time: '2024-02-05T23:23:44.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24971
+- author: Emisse
+  changes:
+  - message: Nonstandard pens now embed again. (explosive pen good again)
+    type: Tweak
+  id: 5894
+  time: '2024-02-05T23:30:06.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24849
+- author: FungiFellow
+  changes:
+  - message: Altered content of several Borg Modules for QoL
+    type: Tweak
+  - message: Removed Gas Analyzer Module
+    type: Remove
+  id: 5895
+  time: '2024-02-05T23:46:39.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24702
+- author: Rainfey
+  changes:
+  - message: Health Analysers now continuously update their UI after scanning a patient
+    type: Tweak
+  id: 5896
+  time: '2024-02-06T13:20:10.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/22449
+- author: ada-please
+  changes:
+  - message: A Surveillance Camera Monitor Board has been added to the Syndicate Observation
+      Kit.
+    type: Add
+  id: 5897
+  time: '2024-02-06T16:25:07.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24979
+- author: snebl
+  changes:
+  - message: Fixed the glass version of cargo airlock looking like an engineering
+      door when opened.
+    type: Fix
+  id: 5898
+  time: '2024-02-06T19:38:39.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/25003
+- author: Mangohydra
+  changes:
+  - message: New cargo shuttle for fland
+    type: Tweak
+  id: 5899
+  time: '2024-02-07T08:49:06.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/25016
+- author: Ilya246
+  changes:
+  - message: Atmos devices can now be built behind directional windows and on lattice.
+    type: Tweak
+  id: 5900
+  time: '2024-02-08T23:07:42.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/25057
+- author: Ubaser
+  changes:
+  - message: T-Ray scanner sprite is tweaked.
+    type: Tweak
+  id: 5901
+  time: '2024-02-08T23:09:00.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/25047
+- author: nikthechampiongr
+  changes:
+  - message: Brig timers display their label properly again.
+    type: Fix
+  id: 5902
+  time: '2024-02-08T23:12:05.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/25033
+- author: vero5123
+  changes:
+  - message: fixes mop buckets being indestructible.
+    type: Fix
+  id: 5903
+  time: '2024-02-08T23:15:12.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/25001
+- author: Adrian16199
+  changes:
+  - message: Added a straw hat that can be crafted with wheat.
+    type: Add
+  id: 5904
+  time: '2024-02-08T23:17:01.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24997
+- author: Sk1tch
+  changes:
+  - message: Guidebook entries are now alphabetically sorted
+    type: Tweak
+  id: 5905
+  time: '2024-02-08T23:23:35.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24963
+- author: FairlySadPanda
+  changes:
+  - message: Swapped out the Skelly Vs The Rev art with a new, higher-res version.
+    type: Tweak
+  id: 5906
+  time: '2024-02-10T02:06:02.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/25088
+- author: Potato1234_x
+  changes:
+  - message: Added laughin' peas, a new mutation for peas that can be ground into
+      Laughter, a chem that forces people to laugh.
+    type: Add
+  id: 5907
+  time: '2024-02-10T08:21:44.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/25089
+- author: themias
+  changes:
+  - message: Soft caps can be flipped backwards with an alt-verb (Flip)
+    type: Tweak
+  id: 5908
+  time: '2024-02-10T08:44:19.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24961
+- author: Blackern5000
+  changes:
+  - message: Shotgun beanbag rounds now deal 40 stamina damage and stun in 3 hits.
+    type: Tweak
+  id: 5909
+  time: '2024-02-10T08:49:24.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24653
+- author: metalgearsloth
+  changes:
+  - message: Fix screenspace popups e.g. inventory / access popups drawing below the
+      UI.
+    type: Fix
+  id: 5910
+  time: '2024-02-10T08:51:11.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24987
+- author: themias
+  changes:
+  - message: The ID card console now correctly updates the ID's department when you
+      update its job
+    type: Fix
+  - message: The Agent ID will update its department depending on the selected icon
+    type: Fix
+  id: 5911
+  time: '2024-02-10T09:17:26.0000000+00:00'
+  url: https://api.github.com/repos/space-wizards/space-station-14/pulls/24975
+- author: Nimfar11
+  changes:
+  - message: Adds a glass showcase for an antique laser pistol.
+    type: Add
+  id: 5912
+  time: '2024-02-10T23:36:19.0000000+00:00'
+  url: https://github.com/space-wizards/space-station-14/pull/25104
+- author: Jezithyr
+  changes:
+  - message: Changed gibbing to now rotate giblets randomly when they are spawned.
+    type: Tweak
+  - message: Giblets are now thrown around the body instead of spawning in a rough
+      pile.
+    type: Tweak
+  id: 5913
+  time: '2024-02-10T23:37:06.0000000+00:00'
+  url: https://github.com/space-wizards/space-station-14/pull/24989
+- author: Jajsha
+  changes:
+  - message: Cyborgs can no longer Emag themselves.
+    type: Fix
+  id: 5914
+  time: '2024-02-11T06:23:32.0000000+00:00'
+  url: https://github.com/space-wizards/space-station-14/pull/24748
+- author: Ubaser
+  changes:
+  - message: Grinding ectoplasm now gives Necrosol.
+    type: Tweak
+  id: 5915
+  time: '2024-02-11T06:24:35.0000000+00:00'
+  url: https://github.com/space-wizards/space-station-14/pull/25053
+- author: Ubaser
+  changes:
+  - message: Food Service research is now roundstart.
+    type: Tweak
+  id: 5916
+  time: '2024-02-11T06:37:12.0000000+00:00'
+  url: https://github.com/space-wizards/space-station-14/pull/25046
+- author: SlamBamActionman
+  changes:
+  - message: Added setting to toggle chat name color in Options.
+    type: Add
+  id: 5917
+  time: '2024-02-11T06:38:55.0000000+00:00'
+  url: https://github.com/space-wizards/space-station-14/pull/24625
+- author: Emisse
+  changes:
+  - message: Ambuzol now requires zombie blood
+    type: Tweak
+  id: 5918
+  time: '2024-02-11T20:47:58.0000000+00:00'
+  url: https://github.com/space-wizards/space-station-14/pull/25119
diff --git a/Resources/Credits/GitHub.txt b/Resources/Credits/GitHub.txt
index f0be2149567..5e5694d3a31 100644
--- a/Resources/Credits/GitHub.txt
+++ b/Resources/Credits/GitHub.txt
@@ -1 +1 @@
-08A, 0x6273, 2013HORSEMEATSCANDAL, 20kdc, 21Melkuu, 4dplanner, 612git, 778b, Ablankmann, Acruid, actioninja, adamsong, Admiral-Obvious-001, Adrian16199, Aerocrux, Aexxie, Agoichi, Ahion, AJCM-git, AjexRose, Alekshhh, AlexMorgan3817, AlmondFlour, AlphaQwerty, Altoids1, amylizzle, ancientpower, areitpog, Arendian, arimah, artak10t, Arteben, AruMoon, as334, AsikKEsel, asperger-sind, astriloqua, avghdev, AzzyIsNotHere, BananaFlambe, BasedUser, BGare, bhespiritu, BingoJohnson-zz, BismarckShuffle, Bixkitts, Blackern5000, Blazeror, Boaz1111, BobdaBiscuit, brainfood1183, Brandon-Huu, Bright0, brndd, BubblegumBlue, BYONDFuckery, c0rigin, c4llv07e, CakeQ, CaptainSqrBeard, Carbonhell, casperr04, CatTheSystem, Centronias, chairbender, Charlese2, Cheackraze, cheesePizza2, Chief-Engineer, chromiumboy, Chronophylos, civilCornball, clement-or, Clyybber, ColdAutumnRain, collinlunn, ComicIronic, coolmankid12345, corentt, crazybrain23, creadth, CrigCrag, Crotalus, CrudeWax, CrzyPotato, Cyberboss, d34d10cc, Daemon, daerSeebaer, dahnte, dakamakat, DamianX, DangerRevolution, daniel-cr, Darkenson, DawBla, dch-GH, Deahaka, DEATHB4DEFEAT, DeathCamel58, deathride58, DebugOk, Decappi, degradka, Delete69, deltanedas, DerbyX, DmitriyMX, DoctorBeard, DogZeroX, dontbetank, Doru991, DoubleRiceEddiedd, DrMelon, drongood12, DrSmugleaf, drteaspoon420, DTanxxx, DubiousDoggo, Duddino, Dutch-VanDerLinde, Easypoller, eclips_e, EEASAS, Efruit, efzapa, ElectroSR, elthundercloud, Emisse, EmoGarbage404, Endecc, enumerate0, eoineoineoin, ERORR404V1, Errant-4, estacaoespacialpirata, exp111, Fahasor, FairlySadPanda, ficcialfaint, FillerVK, Fishfish458, Flareguy, FluffiestFloof, FluidRock, FoLoKe, fooberticus, forthbridge, Fortune117, freeman2651, Fromoriss, GalacticChimp, gbasood, Geekyhobo, Genkail, Git-Nivrak, github-actions[bot], gituhabu, GNF54, GoodWheatley, Gotimanga, graevy, GreyMario, gusxyz, h3half, Hanzdegloker, Hardly3D, harikattar, Hebiman, Henry12116, HerCoyote23, HoofedEar, hord-brayden, hubismal, Hugal31, Hyenh, iacore, IamVelcroboy, icekot8, iczero, igorsaux, ike709, illersaver, Illiux, Ilya246, IlyaElDunaev, Injazz, InquisitivePenguin, Insineer, IntegerTempest, Interrobang01, IProduceWidgets, ItsMeThom, j-giebel, Jackal298, Jackrost, jamessimo, janekvap, JerryImMouse, Jessetriesagain, jessicamaybe, Jezithyr, jicksaw, JiimBob, JoeHammad1844, joelhed, JohnGinnane, johnku1, joshepvodka, jproads, Jrpl, juliangiebel, JustCone14, JustinTether, JustinTrotter, Kadeo64, KaiShibaa, kalane15, kalanosh, KEEYNy, Keikiru, Kelrak, kerisargit, keronshb, KIBORG04, KingFroozy, kira-er, Kit0vras, KittenColony, Klaypexx, Kmc2000, komunre, koteq, Krunklehorn, kxvvv, lajolico, Lamrr, LankLTE, laok233, lapatison, Leander-0, LetterN, Level10Cybermancer, lever1209, LightVillet, liltenhead, LittleBuilderJane, Lomcastar, LordCarve, LordEclipse, luckyshotpictures, LudwigVonChesterfield, Lukasz825700516, lunarcomets, luringens, lvvova1, lzimann, lzk228, M3739, MACMAN2003, Macoron, magmodius, MagnusCrowe, ManelNavola, matthst, Matz05, MehimoNemo, MeltedPixel, MemeProof, Menshin, Mervill, metalgearsloth, mhamsterr, MilenVolf, Minty642, Mirino97, mirrorcult, MishaUnity, MisterMecky, Mith-randalf, ModeratelyAware, Moneyl, Moomoobeef, moony, Morb0, mr-bo-jangles, Mr0maks, Myakot, Myctai, N3X15, Nails-n-Tape, Nairodian, Naive817, namespace-Memory, NickPowers43, nikthechampiongr, Nimfar11, Nirnael, nmajask, nok-ko, notafet, notquitehadouken, noudoit, noverd, nuke-haus, NULL882, Nylux, och-och, OctoRocket, OldDanceJacket, OliverOtter, onoira, Owai-Seek, pali6, Pangogie, patrikturi, PaulRitter, Peptide90, peptron1, pewter-wiz, Phantom-Lily, Phill101, PixelTheKermit, PJB3005, pofitlo, pointer-to-null, PoorMansDreams, potato1234x, ProfanedBane, ProPandaBear, PrPleGoo, Psychpsyo, psykzz, PuroSlavKing, PursuitInAshes, Putnam3145, quatre, QuietlyWhisper, qwerltaz, Radosvik, Radrark, Rainbeon, Rainfey, Rane, Ranger6012, ravage123321, rbertoche, Redict, RedlineTriad, RednoWCirabrab, RemberBM, RemieRichards, RemTim, rene-descartes2021, renodubois, RiceMar1244, RieBi, RIKELOLDABOSS, Rinkashikachi, Rockdtben, rolfero, Saakra, SadAways, Samsterious, SamV522, SaphireLattice, ScalyChimp, scrato, Scribbles0, ScumbagDog, Serkket, SethLafuente, ShadowCommander, Shadowtheprotogen546, SignalWalker, Simyon264, SirDragooon, Sirionaut, siyengar04, Skarletto, Skrauz, Skyedra, SlamBamActionman, Slava0135, Snowni, SonicHDC, SoulSloth, SpaceManiac, SpeltIncorrectyl, spoogemonster, ssdaniel24, Stanislav4ix, Stealthbomber16, StrawberryMoses, Subversionary, SweptWasTaken, Szunti, TaralGit, Tayrtahn, tday93, TekuNut, TemporalOroboros, tentekal, tgrkzus, thatrandomcanadianguy, TheArturZh, theashtronaut, thedraccx, themias, Theomund, theOperand, TheShuEd, ThunderBear2006, timothyteakettle, TimrodDX, Titian3, TK-A369, tkdrg, tmtmtl30, tom-leys, tomasalves8, Tomeno, tosatur, Tryded, TsjipTsjip, Tunguso4ka, TurboTrackerss14, Tyler-IN, Tyzemol, UbaserB, UKNOWH, Uriende, UristMcDorf, Vaaankas, Varen, VasilisThePikachu, veliebm, Veritius, Verslebas, VigersRay, Visne, Volotomite, volundr-, Vordenburg, vulppine, Warentan, waylon531, weaversam8, Willhelm53, wixoaGit, WlarusFromDaSpace, wrexbe, WTCWR68, xRiriq, yathxyz, Ygg01, YotaXP, youarereadingthis, YuriyKiss, zach-hill, Zandario, ZelteHonor, zerorulez, ZeWaka, zionnBE, zlodo, ZNixian, ZoldorfTheWizard, Zth--, Zumorica, Zymem
+08A, 0x6273, 2013HORSEMEATSCANDAL, 20kdc, 21Melkuu, 4dplanner, 612git, 778b, Ablankmann, Acruid, actioninja, ada-please, adamsong, Admiral-Obvious-001, Adrian16199, Aerocrux, Aexxie, africalimedrop, Agoichi, Ahion, AJCM-git, AjexRose, Alekshhh, AlexMorgan3817, AlmondFlour, AlphaQwerty, Altoids1, amylizzle, ancientpower, areitpog, Arendian, arimah, artak10t, Arteben, AruMoon, as334, AsikKEsel, asperger-sind, astriloqua, avghdev, AzzyIsNotHere, BananaFlambe, BasedUser, BGare, bhespiritu, BingoJohnson-zz, BismarckShuffle, Bixkitts, Blackern5000, Blazeror, Boaz1111, BobdaBiscuit, brainfood1183, Brandon-Huu, Bright0, brndd, BubblegumBlue, BYONDFuckery, c0rigin, c4llv07e, CakeQ, CaptainSqrBeard, Carbonhell, casperr04, CatTheSystem, Centronias, chairbender, Charlese2, Cheackraze, cheesePizza2, Chief-Engineer, chromiumboy, Chronophylos, civilCornball, clement-or, Clyybber, ColdAutumnRain, collinlunn, ComicIronic, coolmankid12345, corentt, crazybrain23, creadth, CrigCrag, Crotalus, CrudeWax, CrzyPotato, Cyberboss, d34d10cc, Daemon, daerSeebaer, dahnte, dakamakat, DamianX, DangerRevolution, daniel-cr, Darkenson, DawBla, dch-GH, Deahaka, DEATHB4DEFEAT, DeathCamel58, deathride58, DebugOk, Decappi, degradka, Delete69, deltanedas, DerbyX, DmitriyMX, DoctorBeard, DogZeroX, dontbetank, Doru991, DoubleRiceEddiedd, DrMelon, drongood12, DrSmugleaf, drteaspoon420, DTanxxx, DubiousDoggo, Duddino, Dutch-VanDerLinde, Easypoller, eclips_e, EdenTheLiznerd, EEASAS, Efruit, efzapa, ElectroSR, elthundercloud, Emisse, emmafornash, EmoGarbage404, Endecc, enumerate0, eoineoineoin, ERORR404V1, Errant-4, estacaoespacialpirata, exp111, Fahasor, FairlySadPanda, ficcialfaint, FillerVK, Fishfish458, Flareguy, FluffiestFloof, FluidRock, FoLoKe, fooberticus, forthbridge, Fortune117, freeman2651, Fromoriss, FungiFellow, GalacticChimp, gbasood, Geekyhobo, Genkail, Git-Nivrak, github-actions[bot], gituhabu, GNF54, GoodWheatley, Gotimanga, graevy, GreyMario, gusxyz, h3half, Hanzdegloker, Hardly3D, harikattar, Hebiman, Henry12116, HerCoyote23, Hmeister-real, HoofedEar, hord-brayden, hubismal, Hugal31, Hyenh, iacore, IamVelcroboy, icekot8, igorsaux, ike709, Illiux, Ilya246, IlyaElDunaev, Injazz, Insineer, IntegerTempest, Interrobang01, IProduceWidgets, ItsMeThom, j-giebel, Jackal298, Jackrost, jamessimo, janekvap, JerryImMouse, Jessetriesagain, jessicamaybe, Jezithyr, jicksaw, JiimBob, JoeHammad1844, joelhed, JohnGinnane, johnku1, joshepvodka, jproads, Jrpl, juliangiebel, JustCone14, JustinTether, JustinTrotter, Kadeo64, KaiShibaa, kalane15, kalanosh, KEEYNy, Keikiru, Kelrak, kerisargit, keronshb, KIBORG04, KingFroozy, kira-er, Kit0vras, KittenColony, Kmc2000, komunre, koteq, Krunklehorn, kxvvv, Lamrr, LankLTE, laok233, lapatison, Leander-0, LetterN, Level10Cybermancer, lever1209, LightVillet, liltenhead, LittleBuilderJane, Lomcastar, LordCarve, LordEclipse, luckyshotpictures, LudwigVonChesterfield, Lukasz825700516, lunarcomets, luringens, lvvova1, lzimann, lzk228, M3739, MACMAN2003, Macoron, MagnusCrowe, ManelNavola, Mangohydra, matthst, Matz05, MehimoNemo, MeltedPixel, MemeProof, Menshin, Mervill, metalgearsloth, mhamsterr, MilenVolf, Minty642, Mirino97, mirrorcult, MishaUnity, MisterMecky, Mith-randalf, ModeratelyAware, Moneyl, Moomoobeef, moony, Morb0, Mr0maks, Myakot, Myctai, N3X15, Nails-n-Tape, Nairodian, Naive817, namespace-Memory, NickPowers43, nikthechampiongr, Nimfar11, Nirnael, nmajask, nok-ko, Nopey, notafet, notquitehadouken, noudoit, noverd, nuke-haus, NULL882, Nylux, OctoRocket, OldDanceJacket, OliverOtter, onoira, Owai-Seek, pali6, Pangogie, patrikturi, PaulRitter, Peptide90, peptron1, Phantom-Lily, Phill101, PixelTheKermit, PJB3005, pofitlo, pointer-to-null, PoorMansDreams, potato1234x, ProfanedBane, ProPandaBear, PrPleGoo, Psychpsyo, psykzz, PuroSlavKing, PursuitInAshes, Putnam3145, quatre, QuietlyWhisper, qwerltaz, Radosvik, Radrark, Rainbeon, Rainfey, Rane, Ranger6012, ravage123321, rbertoche, Redict, RedlineTriad, RednoWCirabrab, RemberBM, RemieRichards, RemTim, rene-descartes2021, renodubois, RiceMar1244, RieBi, RIKELOLDABOSS, Rinkashikachi, Rockdtben, rolfero, Saakra, SadAways, Samsterious, SamV522, SaphireLattice, ScalyChimp, scrato, Scribbles0, ScumbagDog, Serkket, SethLafuente, ShadowCommander, Shadowtheprotogen546, SignalWalker, Simyon264, SirDragooon, Sirionaut, siyengar04, Skarletto, Skrauz, Skyedra, SlamBamActionman, Slava0135, snebl, Snowni, snowsignal, SonicHDC, SoulSloth, SpaceManiac, SpeltIncorrectyl, spoogemonster, ssdaniel24, Stanislav4ix, Stealthbomber16, StrawberryMoses, Subversionary, SweptWasTaken, Szunti, TaralGit, Tayrtahn, tday93, TekuNut, TemporalOroboros, tentekal, tgrkzus, thatrandomcanadianguy, TheArturZh, theashtronaut, thedraccx, themias, Theomund, theOperand, TheShuEd, ThunderBear2006, timothyteakettle, TimrodDX, Titian3, TK-A369, tkdrg, tmtmtl30, tom-leys, tomasalves8, Tomeno, tosatur, Tryded, TsjipTsjip, Tunguso4ka, TurboTrackerss14, Tyler-IN, Tyzemol, UbaserB, UKNOWH, Uriende, UristMcDorf, Vaaankas, Varen, VasilisThePikachu, veliebm, Veritius, Verslebas, VigersRay, Visne, Volotomite, volundr-, Vordenburg, vulppine, Warentan, waylon531, weaversam8, Willhelm53, wixoaGit, WlarusFromDaSpace, wrexbe, WTCWR68, xRiriq, yathxyz, Ygg01, YotaXP, youarereadingthis, YuriyKiss, zach-hill, Zandario, Zap527, ZelteHonor, zerorulez, ZeWaka, zionnBE, zlodo, ZNixian, ZoldorfTheWizard, Zth--, Zumorica, Zymem
diff --git a/Resources/Locale/en-US/actions/actions/wagging.ftl b/Resources/Locale/en-US/actions/actions/wagging.ftl
index 2fbcb676f4e..da0cfa0f27b 100644
--- a/Resources/Locale/en-US/actions/actions/wagging.ftl
+++ b/Resources/Locale/en-US/actions/actions/wagging.ftl
@@ -1,5 +1,2 @@
 action-name-toggle-wagging = Wagging Tail
 action-description-toggle-wagging = Start or stop wagging tail.
-
-wagging-emote-start = starts wagging {POSS-ADJ($ent)} tail.
-wagging-emote-stop = stops wagging {POSS-ADJ($ent)} tail.
\ No newline at end of file
diff --git a/Resources/Locale/en-US/advertisements/vending/sectech.ftl b/Resources/Locale/en-US/advertisements/vending/sectech.ftl
index 1edaa980cdd..8f028971429 100644
--- a/Resources/Locale/en-US/advertisements/vending/sectech.ftl
+++ b/Resources/Locale/en-US/advertisements/vending/sectech.ftl
@@ -1,4 +1,4 @@
-advertisement-sectech-1 = Crack communist skulls!
+advertisement-sectech-1 = Crack syndicate skulls!
 advertisement-sectech-2 = Beat some heads in!
 advertisement-sectech-3 = Don't forget - harm is good!
 advertisement-sectech-4 = Your weapons are right here.
diff --git a/Resources/Locale/en-US/cartridge-loader/cartridges.ftl b/Resources/Locale/en-US/cartridge-loader/cartridges.ftl
index 7d31f6e1915..f5cda2f2a18 100644
--- a/Resources/Locale/en-US/cartridge-loader/cartridges.ftl
+++ b/Resources/Locale/en-US/cartridge-loader/cartridges.ftl
@@ -18,4 +18,4 @@ log-probe-program-name = LogProbe
 log-probe-scan = Downloaded logs from {$device}!
 log-probe-label-time = Time
 log-probe-label-accessor = Accessed by
-log-probe-label-number = Number
+log-probe-label-number = #
diff --git a/Resources/Locale/en-US/chat/managers/chat-manager.ftl b/Resources/Locale/en-US/chat/managers/chat-manager.ftl
index 6bbb3cd449b..a165a02f9d8 100644
--- a/Resources/Locale/en-US/chat/managers/chat-manager.ftl
+++ b/Resources/Locale/en-US/chat/managers/chat-manager.ftl
@@ -21,10 +21,10 @@ chat-manager-whisper-headset-on-message = You can't whisper on the radio!
 chat-manager-server-wrap-message = [bold]{$message}[/bold]
 chat-manager-sender-announcement-wrap-message = [font size=14][bold]{$sender} Announcement:[/font][font size=12]
                                                 {$message}[/bold][/font]
-chat-manager-entity-say-wrap-message = [BubbleHeader][bold]{$entityName}[/bold][/BubbleHeader] {$verb}, [font={$fontType} size={$fontSize}]"[BubbleContent]{$message}[/BubbleContent]"[/font]
-chat-manager-entity-say-bold-wrap-message = [BubbleHeader][bold]{$entityName}[/bold][/BubbleHeader] {$verb}, [font={$fontType} size={$fontSize}]"[BubbleContent][bold]{$message}[/bold][/BubbleContent]"[/font]
+chat-manager-entity-say-wrap-message = [BubbleHeader][bold][Name]{$entityName}[/Name][/bold][/BubbleHeader] {$verb}, [font={$fontType} size={$fontSize}]"[BubbleContent]{$message}[/BubbleContent]"[/font]
+chat-manager-entity-say-bold-wrap-message = [BubbleHeader][bold][Name]{$entityName}[/Name][/bold][/BubbleHeader] {$verb}, [font={$fontType} size={$fontSize}]"[BubbleContent][bold]{$message}[/bold][/BubbleContent]"[/font]
 
-chat-manager-entity-whisper-wrap-message = [font size=11][italic][BubbleHeader]{$entityName}[/BubbleHeader] whispers,"[BubbleContent]{$message}[/BubbleContent]"[/italic][/font]
+chat-manager-entity-whisper-wrap-message = [font size=11][italic][BubbleHeader][Name]{$entityName}[/Name][/BubbleHeader] whispers,"[BubbleContent]{$message}[/BubbleContent]"[/italic][/font]
 chat-manager-entity-whisper-unknown-wrap-message = [font size=11][italic][BubbleHeader]Someone[/BubbleHeader] whispers, "[BubbleContent]{$message}[/BubbleContent]"[/italic][/font]
 
 # THE() is not used here because the entity and its name can technically be disconnected if a nameOverride is passed...
diff --git a/Resources/Locale/en-US/criminal-records/criminal-records.ftl b/Resources/Locale/en-US/criminal-records/criminal-records.ftl
new file mode 100644
index 00000000000..49cd59914ac
--- /dev/null
+++ b/Resources/Locale/en-US/criminal-records/criminal-records.ftl
@@ -0,0 +1,44 @@
+criminal-records-console-window-title = Criminal Records Computer
+criminal-records-console-records-list-title = Crewmembers
+criminal-records-console-select-record-info = Select a record.
+criminal-records-console-no-records = No records found!
+criminal-records-console-no-record-found = No record was found for the selected person.
+
+## Status
+
+criminal-records-console-status = Status
+criminal-records-status-none = None
+criminal-records-status-wanted = Wanted
+criminal-records-status-detained = Detained
+
+criminal-records-console-wanted-reason = [color=gray]Wanted Reason[/color]
+criminal-records-console-reason = Reason
+criminal-records-console-reason-placeholder = For example: {$placeholder}
+
+## Crime History
+
+criminal-records-console-crime-history = Crime History
+criminal-records-history-placeholder = Write the crime here
+criminal-records-no-history = This crewmember's record is spotless.
+criminal-records-add-history = Add
+criminal-records-delete-history = Delete
+
+criminal-records-permission-denied = Permission denied
+
+## Security channel notifications
+
+criminal-records-console-wanted = {$name} is wanted by {$officer} for: {$reason}.
+criminal-records-console-detained = {$name} has been detained by {$officer}.
+criminal-records-console-released = {$name} has been released by {$officer}.
+criminal-records-console-not-wanted = {$name} is no longer wanted.
+
+## Filters
+
+criminal-records-filter-placeholder = Input text and press "Enter"
+criminal-records-name-filter = Name
+criminal-records-prints-filter = Fingerprints
+criminal-records-dna-filter = DNA
+
+## Arrest auto history lines
+criminal-records-console-auto-history = ARRESTED: {$reason}
+criminal-records-console-unspecified-reason = <unspecified reason>
diff --git a/Resources/Locale/en-US/escape-menu/ui/options-menu.ftl b/Resources/Locale/en-US/escape-menu/ui/options-menu.ftl
index 4dd0ea9eb19..b8253c69293 100644
--- a/Resources/Locale/en-US/escape-menu/ui/options-menu.ftl
+++ b/Resources/Locale/en-US/escape-menu/ui/options-menu.ftl
@@ -45,6 +45,7 @@ ui-options-opaque-storage-window = Opaque storage window
 ui-options-show-looc-on-head = Show LOOC chat above characters head
 ui-options-fancy-speech = Show names in speech bubbles
 ui-options-fancy-name-background = Add background to speech bubble names
+ui-options-enable-color-name = Add colors to character names
 ui-options-reduced-motion = Reduce motion of visual effects
 ui-options-screen-shake-intensity = Screen shake intensity
 ui-options-screen-shake-percent = { TOSTRING($intensity, "P0") }
diff --git a/Resources/Locale/en-US/flavors/flavor-profiles.ftl b/Resources/Locale/en-US/flavors/flavor-profiles.ftl
index 0fa0f7dfe12..3ff86e38752 100644
--- a/Resources/Locale/en-US/flavors/flavor-profiles.ftl
+++ b/Resources/Locale/en-US/flavors/flavor-profiles.ftl
@@ -165,6 +165,8 @@ flavor-complex-glue = like glue
 flavor-complex-spaceshroom-cooked = like space umami
 flavor-complex-lost-friendship = like lost friendship
 flavor-complex-light = like a light gone out
+flavor-complex-profits = like profits
+flavor-complex-fishops = like the dreaded fishops
 
 # Drink-specific flavors.
 
diff --git a/Resources/Locale/en-US/foldable/components/foldable-component.ftl b/Resources/Locale/en-US/foldable/components/foldable-component.ftl
index d3e4ecefb52..539b4fd9e71 100644
--- a/Resources/Locale/en-US/foldable/components/foldable-component.ftl
+++ b/Resources/Locale/en-US/foldable/components/foldable-component.ftl
@@ -3,3 +3,5 @@
 foldable-deploy-fail = You can't deploy the {$object} here.
 fold-verb = Fold
 unfold-verb = Unfold
+
+fold-flip-verb = Flip
\ No newline at end of file
diff --git a/Resources/Locale/en-US/guidebook/guides.ftl b/Resources/Locale/en-US/guidebook/guides.ftl
index 93f613ecbd2..5571e58e4fd 100644
--- a/Resources/Locale/en-US/guidebook/guides.ftl
+++ b/Resources/Locale/en-US/guidebook/guides.ftl
@@ -48,6 +48,7 @@ guide-entry-cyborgs = Cyborgs
 guide-entry-security = Security
 guide-entry-forensics = Forensics
 guide-entry-defusal = Large Bomb Defusal
+guide-entry-criminal-records = Criminal Records
 
 guide-entry-antagonists = Antagonists
 guide-entry-nuclear-operatives = Nuclear Operatives
diff --git a/Resources/Locale/en-US/holiday/greet/holiday-greet.ftl b/Resources/Locale/en-US/holiday/greet/holiday-greet.ftl
index 825f4a803fa..fde896df39b 100644
--- a/Resources/Locale/en-US/holiday/greet/holiday-greet.ftl
+++ b/Resources/Locale/en-US/holiday/greet/holiday-greet.ftl
@@ -8,7 +8,6 @@ holiday-name-new-year = New Year
 holiday-name-mister-lizard = Mister Lizard's Birthday
 holiday-name-chinese-new-year = Chinese New Year
 holiday-name-groundhog-day = Groundhog Day
-holiday-name-travis-scott-day = Travis Scott Day
 holiday-name-valentines-day = Valentine's Day
 holiday-name-birthday13 = Birthday of Space Station 13
 holiday-name-random-kindness = Random Acts of Kindness Day
diff --git a/Resources/Locale/en-US/medical/components/health-analyzer-component.ftl b/Resources/Locale/en-US/medical/components/health-analyzer-component.ftl
index d232be5c4d9..9b0a8dd3ee3 100644
--- a/Resources/Locale/en-US/medical/components/health-analyzer-component.ftl
+++ b/Resources/Locale/en-US/medical/components/health-analyzer-component.ftl
@@ -8,6 +8,10 @@ health-analyzer-window-damage-group-text = {$damageGroup}: {$amount}
 health-analyzer-window-damage-type-text = {$damageType}: {$amount}
 health-analyzer-window-damage-type-duplicate-text = {$damageType}: {$amount} (duplicate)
 
+health-analyzer-window-scan-mode-text = Scan Mode:
+health-analyzer-window-scan-mode-active = ACTIVE
+health-analyzer-window-scan-mode-inactive = INACTIVE
+
 health-analyzer-window-damage-group-Brute = Brute
 health-analyzer-window-damage-type-Blunt = Blunt
 health-analyzer-window-damage-type-Slash = Slash
diff --git a/Resources/Locale/en-US/navmap-beacons/station-beacons.ftl b/Resources/Locale/en-US/navmap-beacons/station-beacons.ftl
index e94f6dd11df..6434311f21f 100644
--- a/Resources/Locale/en-US/navmap-beacons/station-beacons.ftl
+++ b/Resources/Locale/en-US/navmap-beacons/station-beacons.ftl
@@ -71,3 +71,4 @@ station-beacon-theater = Theater
 station-beacon-tools = Tools
 station-beacon-disposals = Disposals
 station-beacon-cryosleep = Cryosleep
+station-beacon-escape-pod = Escape Pod
diff --git a/Resources/Locale/en-US/reagents/laughter.ftl b/Resources/Locale/en-US/reagents/laughter.ftl
new file mode 100644
index 00000000000..b9f7c583cdd
--- /dev/null
+++ b/Resources/Locale/en-US/reagents/laughter.ftl
@@ -0,0 +1 @@
+laughter-effect-control-laughter = You can't contain your laughter!
diff --git a/Resources/Locale/en-US/reagents/meta/cleaning.ftl b/Resources/Locale/en-US/reagents/meta/cleaning.ftl
index e770594956e..8603711b6eb 100644
--- a/Resources/Locale/en-US/reagents/meta/cleaning.ftl
+++ b/Resources/Locale/en-US/reagents/meta/cleaning.ftl
@@ -5,10 +5,7 @@ reagent-name-space-cleaner = space cleaner
 reagent-desc-space-cleaner = This is able to clean almost all surfaces of almost anything that may dirty them. The janitor is likely to appreciate refills.
 
 reagent-name-soap = soap
-reagent-desc-soap = Soap can be used to make soapy water.
-
-reagent-name-soapy-water = soapy water
-reagent-desc-soapy-water = It's just soap and water. Good for cleaning gunk off of surfaces and also slippier than regular water.
+reagent-desc-soap = I wouldn't clean my mouth out with this if I were you.
 
 reagent-name-space-lube = space lube
 reagent-desc-space-lube = Space Lube is a high performance lubricant intended for maintenance of extremely complex mechanical equipment (and certainly not used to make people slip).
diff --git a/Resources/Locale/en-US/reagents/meta/consumable/food/condiments.ftl b/Resources/Locale/en-US/reagents/meta/consumable/food/condiments.ftl
index a448b45a10f..38cd16b01c7 100644
--- a/Resources/Locale/en-US/reagents/meta/consumable/food/condiments.ftl
+++ b/Resources/Locale/en-US/reagents/meta/consumable/food/condiments.ftl
@@ -22,6 +22,9 @@ reagent-desc-ketchup = Made from pureed tomatoes and flavored with spices.
 reagent-name-ketchunaise = ketchunaise
 reagent-desc-ketchunaise = So-called Russian dressing, popular among Space Americans.
 
+reagent-name-laughin-syrup = laughin' syrup
+reagent-desc-laughin-syrup = The product of juicing Laughin' Peas. Fizzy, and seems to change flavour based on what it's used with!
+
 reagent-name-mayo = mayonnaise
 reagent-desc-mayo = Creamy sauce, made from oil, egg, and some (edible) acid.
 
diff --git a/Resources/Locale/en-US/reagents/meta/fun.ftl b/Resources/Locale/en-US/reagents/meta/fun.ftl
index 510d9d084aa..68de618a365 100644
--- a/Resources/Locale/en-US/reagents/meta/fun.ftl
+++ b/Resources/Locale/en-US/reagents/meta/fun.ftl
@@ -21,3 +21,7 @@ reagent-desc-razorium = A strange, non-newtonian chemical. It is produced when t
 
 reagent-name-fresium = Fresium
 reagent-desc-fresium = A mysterious compound that slows the vibration of atoms and molecules... somehow. In layman's terms, it makes things cold... REALLY cold. Can cause long-lasting movement issues if ingested.
+
+reagent-name-laughter = Laughter
+reagent-desc-laughter = Some say that this is the best medicine, but recent studies have proven that to be untrue.
+
diff --git a/Resources/Locale/en-US/reagents/meta/physical-desc.ftl b/Resources/Locale/en-US/reagents/meta/physical-desc.ftl
index 8d55e592f87..24340e63a61 100644
--- a/Resources/Locale/en-US/reagents/meta/physical-desc.ftl
+++ b/Resources/Locale/en-US/reagents/meta/physical-desc.ftl
@@ -91,6 +91,7 @@ reagent-physical-desc-energizing = energizing
 reagent-physical-desc-exhilarating = exhilarating
 reagent-physical-desc-vibrant = vibrant
 reagent-physical-desc-fluffy = fluffy
+reagent-physical-desc-funny = funny
 reagent-physical-desc-alkaline = alkaline
 reagent-physical-desc-reflective = reflective
 reagent-physical-desc-holy = holy
diff --git a/Resources/Locale/en-US/research/technologies.ftl b/Resources/Locale/en-US/research/technologies.ftl
index 411ce429ab7..37f0bb58824 100644
--- a/Resources/Locale/en-US/research/technologies.ftl
+++ b/Resources/Locale/en-US/research/technologies.ftl
@@ -1,6 +1,5 @@
 research-discipline-none = None
 research-discipline-industrial = Industrial
-research-discipline-biochemical = Biochemical
 research-discipline-arsenal = Arsenal
 research-discipline-experimental = Experimental
 research-discipline-civilian-services = Civilian Services
@@ -21,18 +20,6 @@ research-technology-super-powercells = Super Powercells
 research-technology-bluespace-storage = Bluespace Storage
 research-technology-portable-fission = Portable Fission
 
-research-technology-chemistry = Chemistry
-research-technology-surgical-tools = Surgical Tools
-research-technology-biochemical-stasis = Biochemical Stasis
-research-technology-mechanized-treatment = Mechanized Treatment
-research-technology-virology = Virology
-research-technology-cryogenics = Cryogenics
-research-technology-chemical-dispensary = Chemical Dispensary
-research-technology-biofabrication = Biofabrication
-research-technology-crew-monitoring = Crew Monitoring
-research-technology-bluespace-chemistry = Bluespace Chemistry
-research-technology-cloning = Cloning
-
 research-technology-salvage-weapons = Salvage Weapons
 research-technology-draconic-munitions = Draconic Munitions
 research-technology-uranium-munitions = Uranium Munitions
@@ -72,6 +59,8 @@ research-technology-food-service = Food Service
 research-technology-advanced-entertainment = Advanced Entertainment
 research-technology-audio-visual-communication = A/V Communication
 research-technology-faux-astro-tiles = Faux Astro-Tiles
+research-technology-biochemical-stasis = Biochemical Stasis
+research-technology-mechanized-treatment = Mechanized Treatment
 research-technology-robotic-cleanliness = Robotic Cleanliness
 research-technology-advanced-cleaning = Advanced Cleaning
 research-technology-meat-manipulation = Meat Manipulation
@@ -79,3 +68,4 @@ research-technology-honk-mech = H.O.N.K. Mech
 research-technology-advanced-spray = Advanced Spray
 research-technology-bluespace-cargo-transport = Bluespace Cargo Transport
 research-technology-quantum-fiber-weaving = Quantum Fiber Weaving
+research-technology-bluespace-chemistry = Bluespace Chemistry
diff --git a/Resources/Locale/en-US/seeds/seeds.ftl b/Resources/Locale/en-US/seeds/seeds.ftl
index f4c136e2952..dca67fa04c4 100644
--- a/Resources/Locale/en-US/seeds/seeds.ftl
+++ b/Resources/Locale/en-US/seeds/seeds.ftl
@@ -71,6 +71,8 @@ seeds-poppy-name = poppy
 seeds-poppy-display-name = poppies
 seeds-aloe-name = aloe
 seeds-aloe-display-name = aloe
+seeds-laughin-pea-name = laughin' peas
+seeds-laughin-pea-display-name = laughin' peas
 seeds-lingzhi-name = lingzhi
 seeds-lingzhi-display-name = lingzhi
 seeds-ambrosiavulgaris-name = ambrosia vulgaris
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/body/organs/animal/animal.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/body/organs/animal/animal.ftl
index 54e09a8f646..59a05cca9c1 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/body/organs/animal/animal.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/body/organs/animal/animal.ftl
@@ -1,5 +1,7 @@
-ent-BaseAnimalOrgan = { ent-BaseItem }
+ent-BaseAnimalOrganUnGibbable = { ent-BaseItem }
     .desc = { ent-BaseItem.desc }
+ent-BaseAnimalOrgan = { ent-BaseAnimalOrganUnGibbable }
+    .desc = { ent-BaseAnimalOrganUnGibbable.desc }
 ent-OrganAnimalLungs = lungs
     .desc = { ent-BaseAnimalOrgan.desc }
 ent-OrganAnimalStomach = stomach
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/body/organs/human.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/body/organs/human.ftl
index 370bcc86c94..3fd9e92d250 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/body/organs/human.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/body/organs/human.ftl
@@ -1,5 +1,7 @@
-ent-BaseHumanOrgan = { ent-BaseItem }
+ent-BaseHumanOrganUnGibbable = { ent-BaseItem }
     .desc = { ent-BaseItem.desc }
+ent-BaseHumanOrgan = { ent-BaseHumanOrganUnGibbable }
+    .desc = { ent-BaseHumanOrganUnGibbable.desc }
 ent-OrganHumanBrain = brain
     .desc = The source of incredible, unending intelligence. Honk.
 ent-OrganHumanEyes = eyes
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/catalog/fills/items/belt.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/catalog/fills/items/belt.ftl
index 638c37a7a4c..79eaaf5782c 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/catalog/fills/items/belt.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/catalog/fills/items/belt.ftl
@@ -16,9 +16,9 @@ ent-ClothingBeltJanitorFilled = { ent-ClothingBeltJanitor }
 ent-ClothingBeltMedicalFilled = { ent-ClothingBeltMedical }
     .suffix = Filled
     .desc = { ent-ClothingBeltMedical.desc }
-ent-ClothingBeltParamedicFilled = EMT belt
+ent-ClothingBeltMedicalEMTFilled = { ent-ClothingBeltMedicalEMT }
     .suffix = Paramedic,Filled
-    .desc = { ent-ClothingBeltMedical.desc }
+    .desc = { ent-ClothingBeltMedicalEMT.desc }
 ent-ClothingBeltPlantFilled = { ent-ClothingBeltPlant }
     .suffix = Filled
     .desc = { ent-ClothingBeltPlant.desc }
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/catalog/fills/lockers/heads.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/catalog/fills/lockers/heads.ftl
index 45fc4374df9..7a9cded267d 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/catalog/fills/lockers/heads.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/catalog/fills/lockers/heads.ftl
@@ -5,6 +5,9 @@ ent-LockerCaptainFilledHardsuit = { ent-LockerCaptain }
     .suffix = Filled, Hardsuit
     .desc = { ent-LockerCaptain.desc }
 ent-LockerCaptainFilled = { ent-LockerCaptain }
+    .suffix = Filled, AntiqueLaser
+    .desc = { ent-LockerCaptain.desc }
+ent-LockerCaptainFilledNoLaser = { ent-LockerCaptain }
     .suffix = Filled
     .desc = { ent-LockerCaptain.desc }
 ent-LockerHeadOfPersonnelFilled = { ent-LockerHeadOfPersonnel }
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/corvax/catalog/fills/paper/document.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/corvax/catalog/fills/paper/document.ftl
index 9ddaf4235d6..bae7ece90df 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/corvax/catalog/fills/paper/document.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/corvax/catalog/fills/paper/document.ftl
@@ -57,8 +57,7 @@ ent-PrintedDocumentRequestModernization = Request for modernization
 ent-PrintedDocumentComplaintViolationLaborRules = Complaint for violation of labor order
     .desc = { ent-PrintedDocument.desc }
 ent-PrintedDocumentComplaintOffense = Complaint about an offense
-
-  .desc = { ent-PrintedDocument.desc }
+    .desc = { ent-PrintedDocument.desc }
 ent-PrintedDocumentPermissionEquipment = Authorization to use equipment
     .desc = { ent-PrintedDocument.desc }
 ent-PrintedDocumentPermissionToTravelInCaseOfThreat = Permission to travel in case of threat
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/belt/belts.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/belt/belts.ftl
index 4433fbaa4bf..da8133a7918 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/belt/belts.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/belt/belts.ftl
@@ -8,6 +8,8 @@ ent-ClothingBeltJanitor = janibelt
     .desc = A belt used to hold most janitorial supplies.
 ent-ClothingBeltMedical = medical belt
     .desc = Can hold various medical equipment.
+ent-ClothingBeltMedicalEMT = EMT belt
+    .desc = Perfect for holding various equipment for medical emergencies.
 ent-ClothingBeltPlant = botanical belt
     .desc = A belt used to hold most hydroponics supplies. Suprisingly, not green.
 ent-ClothingBeltChef = chef belt
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/head/bandanas.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/head/bandanas.ftl
index 9d20a52a04b..4761ec38edc 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/head/bandanas.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/head/bandanas.ftl
@@ -1,3 +1,5 @@
+ent-ClothingHeadBandBase = { ent-ClothingHeadBaseButcherable }
+  .desc = { ent-ClothingHeadBaseButcherable.desc }
 ent-ClothingHeadBandBlack = black bandana
     .desc = A black bandana to make you look cool.
 ent-ClothingHeadBandBlue = blue bandana
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/head/hats.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/head/hats.ftl
index e4e661f3246..15d1b1dccf3 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/head/hats.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/head/hats.ftl
@@ -10,6 +10,8 @@ ent-ClothingHeadHatBeretRND = scientific beret
     .desc = A beret for real scientists.
 ent-ClothingHeadHatBeretEngineering = engineering beret
     .desc = A beret with the engineering insignia emblazoned on it. For engineers that are more inclined towards style than safety.
+ent-ClothingHeadHatBeretQM = quartermaster's beret
+    .desc = A beret with the cargo's insignia emblazoned on it. For quartermasters that are more inclined towards style.
 ent-ClothingHeadHatBeretHoS = head of security's beret
     .desc = A black beret with a commander's rank emblem. For officers that are more inclined towards style than safety.
 ent-ClothingHeadHatBeretWarden = warden's beret
@@ -150,3 +152,5 @@ ent-ClothingHeadHatCowboyWhite = white cowboy hat
     .desc = { ent-ClothingHeadHatCowboyBrown.desc }
 ent-ClothingHeadHatCowboyBountyHunter = bounty hunter cowboy hat
     .desc = { ent-ClothingHeadHatCowboyBrown.desc }
+ent-ClothingHeadHatStrawHat = straw hat
+    .desc = A fancy hat for hot days! Not recommended to wear near fires.
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/head/soft.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/head/soft.ftl
index 69c092e43d5..c5874424664 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/head/soft.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/head/soft.ftl
@@ -1,60 +1,65 @@
+ent-ClothingHeadHeadHatBaseFlippable = { ent-ClothingHeadBaseButcherable }
+  .desc = { ent-ClothingHeadBaseButcherable.desc }
+ent-ClothingHeadHeadHatBaseFlipped = { ent-ClothingHeadHeadHatBaseFlippable }
+    .suffix = flipped
+    .desc = { ent-ClothingHeadHeadHatBaseFlippable.desc }
 ent-ClothingHeadHatBluesoft = blue cap
     .desc = It's a baseball hat in a tasteless blue colour.
-ent-ClothingHeadHatBluesoftFlipped = blue cap flipped
-    .desc = It's a baseball hat in a tasteless blue colour. Flipped.
+ent-ClothingHeadHatBluesoftFlipped = blue cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
 ent-ClothingHeadHatCargosoft = cargo cap
     .desc = It's a baseball hat painted in Cargo colours.
-ent-ClothingHeadHatCargosoftFlipped = cargo cap flipped
-    .desc = It's a baseball hat painted in Cargo colours. Flipped.
+ent-ClothingHeadHatCargosoftFlipped = cargo cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
 ent-ClothingHeadHatQMsoft = quartermaster's cap
     .desc = It's a baseball hat painted in the Quartermaster's colors.
-ent-ClothingHeadHatQMsoftFlipped = quartermaster's cap flipped
-    .desc = It's a baseball hat painted in the Quartermaster's colors. Flipped.
+ent-ClothingHeadHatQMsoftFlipped = quartermaster's cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
 ent-ClothingHeadHatCorpsoft = corporate cap
     .desc = A baseball bat in corporation colors.
-ent-ClothingHeadHatCorpsoftFlipped = corporate cap flipped
-    .desc = A baseball bat in corporation colors. Flipped.
+ent-ClothingHeadHatCorpsoftFlipped = corporate cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
 ent-ClothingHeadHatGreensoft = green cap
     .desc = It's a baseball hat in a tasteless green colour.
-ent-ClothingHeadHatGreensoftFlipped = green cap flipped
-    .desc = It's a baseball hat in a tasteless green colour. Flipped.
+ent-ClothingHeadHatGreensoftFlipped = green cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
 ent-ClothingHeadHatBlacksoft = black cap
     .desc = It's a baseball hat in a tasteless black colour.
-ent-ClothingHeadHatBlacksoftFlipped = black cap flipped
-    .desc = It's a baseball hat in a tasteless black colour. Flipped.
+ent-ClothingHeadHatBlacksoftFlipped = black cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
 ent-ClothingHeadHatGreysoft = grey cap
     .desc = It's a baseball hat in a tasteless grey colour.
-ent-ClothingHeadHatGreysoftFlipped = grey cap flipped
-    .desc = It's a baseball hat in a tasteless grey colour. Flipped.
+ent-ClothingHeadHatGreysoftFlipped = grey cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
 ent-ClothingHeadHatMimesoft = mime cap
     .desc = It's a baseball hat in a tasteless white colour.
-ent-ClothingHeadHatMimesoftFlipped = mime cap flipped
-    .desc = It's a baseball hat in a tasteless white colour. Flipped.
+ent-ClothingHeadHatMimesoftFlipped = mime cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
 ent-ClothingHeadHatOrangesoft = orange cap
     .desc = It's a baseball hat in a good-looking orange colour.
-ent-ClothingHeadHatOrangesoftFlipped = orange cap flipped
-    .desc = It's a baseball hat in a good-looking orange colour. Flipped.
+ent-ClothingHeadHatOrangesoftFlipped = orange cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
 ent-ClothingHeadHatPurplesoft = purple cap
     .desc = It's a baseball hat in a tasteless purple colour.
-ent-ClothingHeadHatPurplesoftFlipped = purple cap flipped
-    .desc = It's a baseball hat in a tasteless purple colour. Flipped.
+ent-ClothingHeadHatPurplesoftFlipped = purple cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
 ent-ClothingHeadHatRedsoft = red cap
     .desc = It's a baseball hat in a tasteless red colour.
-ent-ClothingHeadHatRedsoftFlipped = red cap flipped
-    .desc = It's a baseball hat in a tasteless purple colour. Flipped.
+ent-ClothingHeadHatRedsoftFlipped = red cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
 ent-ClothingHeadHatSecsoft = security cap
     .desc = It's a robust baseball hat in tasteful red colour.
-ent-ClothingHeadHatSecsoftFlipped = security cap flipped
-    .desc = It's a robust baseball hat in tasteful red colour. Flipped.
+ent-ClothingHeadHatSecsoftFlipped = security cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
 ent-ClothingHeadHatYellowsoft = yellow cap
     .desc = A yellow baseball hat.
-ent-ClothingHeadHatYellowsoftFlipped = yellow cap flipped
-    .desc = A yellow flipped baseball hat.
-ent-ClothingHeadHatBizarreSoft = troublemaker's soft
+ent-ClothingHeadHatYellowsoftFlipped = yellow cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
+ent-ClothingHeadHatBizarreSoft = troublemaker's cap
     .desc = A truly.. bizarre accessory.
-ent-ClothingHeadHatBizarreSoftFlipped = troublemaker's soft flipped
-    .desc = A truly.. bizarre accessory, flipped.
+ent-ClothingHeadHatBizarreSoftFlipped = troublemaker's cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
 ent-ClothingHeadHatParamedicsoft = paramedic cap
     .desc = It's a paramedic's baseball hat with a medical logo.
-ent-ClothingHeadHatParamedicsoftFlipped = paramedic cap flipped
-    .desc = It's a paramedic's baseball hat with a medical logo. Flipped.
+ent-ClothingHeadHatParamedicsoftFlipped = paramedic cap
+  .desc = { ent-ClothingHeadHeadHatBaseFlipped.desc }
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/masks/bandanas.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/masks/bandanas.ftl
new file mode 100644
index 00000000000..2cfa21964a3
--- /dev/null
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/masks/bandanas.ftl
@@ -0,0 +1,22 @@
+ent-ClothingMaskBandanaBase = { ent-ClothingMaskBaseButcherable }
+  .desc = { ent-ClothingMaskBaseButcherable.desc }
+ent-ClothingMaskBandBlack = black bandana
+    .desc = A black bandana to make you look cool.
+ent-ClothingMaskBandBlue = blue bandana
+    .desc = A blue bandana to make you look cool.
+ent-ClothingMaskBandBotany = botany bandana
+    .desc = A botany bandana to make you look cool, made from natural fibers.
+ent-ClothingMaskBandGold = gold bandana
+    .desc = A gold bandana to make you look cool.
+ent-ClothingMaskBandGreen = green bandana
+    .desc = A green bandana to make you look cool.
+ent-ClothingMaskBandGrey = grey bandana
+    .desc = A grey bandana to make you look cool.
+ent-ClothingMaskBandRed = red bandana
+    .desc = A red bandana to make you look cool.
+ent-ClothingMaskBandSkull = skull bandana
+    .desc = A bandana with a skull to make you look even cooler.
+ent-ClothingMaskBandMerc = mercenary bandana
+    .desc = To protect the head from the sun, insects and other dangers of the higher path.
+ent-ClothingMaskBandBrown = brown bandana
+    .desc = A brown bandana to make you look cool.
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/masks/base_clothingmask.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/masks/base_clothingmask.ftl
index 0c902c316f5..b180586cf4f 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/masks/base_clothingmask.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/masks/base_clothingmask.ftl
@@ -4,3 +4,5 @@ ent-ClothingMaskPullableBase = { ent-ClothingMaskBase }
     .desc = { ent-ClothingMaskBase.desc }
 ent-ActionToggleMask = Toggle Mask
     .desc = Handy, but prevents insertion of pie into your pie hole.
+ent-ClothingMaskBaseButcherable = { ent-ClothingMaskBase }
+    .desc = { ent-ClothingMaskBase.desc }
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/uniforms/jumpsuits.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/uniforms/jumpsuits.ftl
index 3baa38615f8..44f16a25304 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/uniforms/jumpsuits.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/clothing/uniforms/jumpsuits.ftl
@@ -84,6 +84,8 @@ ent-ClothingUniformJumpsuitQM = quartermaster's jumpsuit
     .desc = What can brown do for you?
 ent-ClothingUniformJumpsuitQMTurtleneck = quartermasters's turtleneck
     .desc = A sharp turtleneck made for the hardy work environment of supply.
+ent-ClothingUniformJumpsuitQMFormal = quartermasters's formal suit
+    .desc = Inspired by the quartermasters of military's past, the perfect outfit for supplying a formal occasion.
 ent-ClothingUniformJumpsuitResearchDirector = research director's turtleneck
     .desc = It's a turtleneck worn by those with the know-how to achieve the position of Research Director. Its fabric provides minor protection from biological contaminants.
 ent-ClothingUniformJumpsuitScientist = scientist jumpsuit
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks-cartons.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks-cartons.ftl
index ede56a03b03..f7f6cf76818 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks-cartons.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks-cartons.ftl
@@ -1,5 +1,7 @@
 ent-DrinkCartonBaseFull = { ent-DrinkBase }
     .desc = { ent-DrinkBase.desc }
+ent-DrinkCartonVisualsOpenable = { "" }
+    .desc = { "" }
 ent-DrinkJuiceLimeCarton = lime juice
     .desc = Sweet-sour goodness.
 ent-DrinkJuiceOrangeCarton = orange juice
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks.ftl
index 668c27c78e1..57a79d02638 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks.ftl
@@ -6,244 +6,361 @@ ent-DrinkGlass = metamorphic glass
     .desc = A metamorphic glass that automagically turns into a glass appropriate for the drink within. There's a sanded off patent number on the bottom.
 ent-DrinkGlassCoupeShaped = coupe glass
     .desc = A classic thin neck coupe glass, the icon of fragile labels on crates around the galaxy.
-ent-DrinkAbsintheGlass = absinthe glass
-    .desc = Wormwood, anise, oh my.
-ent-DrinkAcidSpitGlass = acid spit glass
-    .desc = A drink from the company archives. Made from live aliens.
-ent-DrinkAleGlass = ale glass
-    .desc = A freezing pint of delicious ale
-ent-DrinkAlliesCocktail = allies cocktail
-    .desc = A drink made from your allies.
-ent-DrinkAloe = aloe glass
-    .desc = Very, very, very good.
-ent-DrinkAmasecGlass = amasec glass
-    .desc = Always handy before COMBAT!!!
-ent-DrinkAndalusia = andalusia glass
-    .desc = A nice drink with a strange name.
-ent-DrinkAntifreeze = anti-freeze glass
-    .desc = The ultimate refreshment.
-ent-DrinkAtomicBombGlass = atomic bomb glass
-    .desc = We cannot take legal responsibility for your actions after imbibing.
-ent-DrinkB52Glass = b-52 glass
-    .desc = Coffee, Irish Cream, and cognac. You will get bombed.
-ent-DrinkBahamaMama = bahama mama glass
-    .desc = Tropical cocktail.
-ent-DrinkBananaHonkGlass = banana honk glass
-    .desc = A drink from Banana Heaven.
-ent-DrinkBarefootGlass = barefoot glass
-    .desc = Barefoot and pregnant.
-ent-DrinkBeepskySmashGlass = beepsky smash glass
-    .desc = Heavy, hot and strong. Just like the Iron fist of the LAW.
-ent-DrinkBeerglass = beer glass
-    .desc = A freezing pint of beer.
-ent-DrinkBerryJuice = berry juice
-    .desc = Berry juice. Or maybe it's jam. Who cares?
-ent-DrinkBlackRussianGlass = black russian glass
-    .desc = For the lactose-intolerant. Still as classy as a White Russian.
-ent-DrinkBlueCuracaoGlass = blue curacao
-    .desc = Exotically blue, fruity drink, distilled from oranges.
-ent-DrinkBloodyMaryGlass = bloody mary glass
-    .desc = Tomato juice, mixed with Vodka and a lil' bit of lime. Tastes like liquid murder.
-ent-DrinkBooger = booger
-    .desc = Ewww...
-ent-DrinkBraveBullGlass = brave bull glass
-    .desc = Tequilla and coffee liquor, brought together in a mouthwatering mixture. Drink up.
-ent-DrinkCarrotJuice = carrot juice
-    .desc = It's just like a carrot but without crunching.
-ent-DrinkChocolateGlass = hot chocolate
-    .desc = A heated drink consisting melted chocolate and heated milk.
-ent-DrinkCoffee = coffee
-    .desc = Don't drop it, or you'll send scalding liquid and glass shards everywhere.
-ent-DrinkCognacGlass = cognac glass
-    .desc = Damn, you feel like some kind of French aristocrat just by holding this.
-ent-DrinkCream = cream
-    .desc = Ewwww...
-ent-DrinkCubaLibreGlass = cuba libre glass
-    .desc = A classic mix of rum and cola.
-ent-DrinkDeadRumGlass = deadrum glass
-    .desc = Popular with the sailors. Not very popular with everyone else.
-ent-DrinkDemonsBlood = demons blood
-    .desc = Just looking at this thing makes the hair at the back of your neck stand up.
-ent-DrinkDevilsKiss = devil's kiss
-    .desc = Creepy time!
-ent-DrinkDoctorsDelightGlass = the doctor's delight
-    .desc = A healthy mixture of juices, guaranteed to keep you healthy until the next toolboxing takes place.
-ent-DrinkDriestMartiniGlass = driest martini glass
-    .desc = Only for the experienced. You think you see sand floating in the glass.
-ent-DrinkDrGibbGlass = Dr. Gibb glass
-    .desc = Dr. Gibb. Not as dangerous as the name might imply.
-ent-DrinkErikaSurprise = erika surprise
-    .desc = The surprise is, it's green!
-ent-DrinkFourteenLokoGlass = Fourteen Loko glass
-    .desc = This is a container of Fourteen Loko, it appears to be of the highest quality. The drink, not the container.
-ent-DrinkGargleBlasterGlass = pan-galactic gargle blaster
-    .desc = Does... does this mean that Arthur and Ford are on the ship? Oh joy.
-ent-DrinkGinGlass = gin
-    .desc = Crystal clear Griffeater gin.
-ent-DrinkGinFizzGlass = gin fizz glass
-    .desc = Refreshingly lemony, deliciously dry.
-ent-DrinkGinTonicglass = gin and tonic
-    .desc = A mild but still great cocktail. Drink up, like a true Englishman.
-ent-DrinkGildlagerGlass = gildlager glass
-    .desc = 100 proof that teen girls will drink anything with gold in it.
-ent-DrinkGrapeJuice = grape juice
-    .desc = It's grrrrrape!
-ent-DrinkGrapeSodaGlass = grape soda glass
-    .desc = Looks like a delicious drink!
-ent-DrinkGreenTeaGlass = green tea glass
-    .desc = Tasty green tea. It has antioxidants; it's good for you!
-ent-DrinkGrenadineGlass = grenadine syrup glass
-    .desc = Sweet and tangy, a bar syrup used to add color or flavor to drinks.
-ent-DrinkGrogGlass = grog glass
-    .desc = A fine and cepa drink for Space.
-ent-DrinkHippiesDelightGlass = hippies' delight glass
-    .desc = A drink enjoyed by people during the 1960's.
-ent-DrinkHoochGlass = hooch
+ent-DrinkAbsintheGlass = { ent-DrinkGlass }
+    .suffix = absinthe
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkAcidSpitGlass = { ent-DrinkGlass }
+    .suffix = acid spit
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkAleGlass = { ent-DrinkGlass }
+    .suffix = ale
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkAlliesCocktail = { ent-DrinkGlass }
+    .suffix = allies cocktail
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkAloe = { ent-DrinkGlass }
+    .suffix = aloe
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkAmasecGlass = { ent-DrinkGlass }
+    .suffix = amasec
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkAndalusia = { ent-DrinkGlass }
+    .suffix = andalusia
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkAntifreeze = { ent-DrinkGlass }
+    .suffix = antifreeze
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkAtomicBombGlass = { ent-DrinkGlass }
+    .suffix = atomic bomb
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkB52Glass = { ent-DrinkGlass }
+    .suffix = b-52
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkBahamaMama = { ent-DrinkGlass }
+    .suffix = bahama mama
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkBananaHonkGlass = { ent-DrinkGlass }
+    .suffix = banana honk
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkBarefootGlass = { ent-DrinkGlass }
+    .suffix = barefoot
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkBeepskySmashGlass = { ent-DrinkGlass }
+    .suffix = beepsky smash
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkBeerglass = { ent-DrinkGlass }
+    .suffix = beer
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkBerryJuice = { ent-DrinkGlass }
+    .suffix = berry juice
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkBlackRussianGlass = { ent-DrinkGlass }
+    .suffix = black russian
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkBlueCuracaoGlass = { ent-DrinkGlass }
+    .suffix = blue curacao
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkBloodyMaryGlass = { ent-DrinkGlass }
+    .suffix = bloody mary
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkBooger = { ent-DrinkGlass }
+    .suffix = booger
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkBraveBullGlass = { ent-DrinkGlass }
+    .suffix = brave bull
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkCarrotJuice = { ent-DrinkGlass }
+    .suffix = carrot juice
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkChocolateGlass = { ent-DrinkGlass }
+    .suffix = chocolate
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkCoffee = { ent-DrinkGlass }
+    .suffix = coffee
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkCognacGlass = { ent-DrinkGlass }
+    .suffix = cognac
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkCream = { ent-DrinkGlass }
+    .suffix = cream
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkCubaLibreGlass = { ent-DrinkGlass }
+    .suffix = cuba libre
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkDeadRumGlass = { ent-DrinkGlass }
+    .suffix = dead rum
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkDemonsBlood = { ent-DrinkGlass }
+    .suffix = demon's blood
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkDevilsKiss = { ent-DrinkGlass }
+    .suffix = devil's kiss
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkDoctorsDelightGlass = { ent-DrinkGlass }
+    .suffix = doctor's delight
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkDriestMartiniGlass = { ent-DrinkGlass }
+    .suffix = driest martini
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkDrGibbGlass = { ent-DrinkGlass }
+    .suffix = dr gibb
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkErikaSurprise = { ent-DrinkGlass }
+    .suffix = erika surprise
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkFourteenLokoGlass = { ent-DrinkGlass }
+    .suffix = fourteen loko
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkGargleBlasterGlass = { ent-DrinkGlass }
+    .suffix = pan-galactic gargle blaster
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkGinGlass = { ent-DrinkGlass }
+    .suffix = gin
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkGinFizzGlass = { ent-DrinkGlass }
+    .suffix = gin fizz
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkGinTonicglass = { ent-DrinkGlass }
+    .suffix = gin and tonic
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkGildlagerGlass = { ent-DrinkGlass }
+    .suffix = gildlager
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkGrapeJuice = { ent-DrinkGlass }
+    .suffix = grape juice
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkGrapeSodaGlass = { ent-DrinkGlass }
+    .suffix = grape soda
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkGreenTeaGlass = { ent-DrinkGlass }
+    .suffix = green tea
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkGrenadineGlass = { ent-DrinkGlass }
+    .suffix = grenadine
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkGrogGlass = { ent-DrinkGlass }
+    .suffix = grog
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkHippiesDelightGlass = { ent-DrinkGlass }
+    .suffix = hippies' delight
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkHoochGlass = { ent-DrinkGlass }
     .desc = You've really hit rock bottom now... your liver packed its bags and left last night.
-ent-DrinkIcedCoffeeGlass = iced coffee glass
-    .desc = A drink to perk you up and refresh you!
-ent-DrinkIcedGreenTeaGlass = iced green tea glass
-    .desc = It looks like green tea with ice. One might even call it iced green tea.
-ent-DrinkIcedTeaGlass = iced tea
-    .desc = A refreshing southern beverage.
-ent-DrinkIcedBeerGlass = iced beer glass
-    .desc = A beer so frosty, the air around it freezes.
-ent-DrinkIceGlass = ice glass
-    .desc = Generally, you're supposed to put something else in there too...
-ent-DrinkIceCreamGlass = ice cream glass
-    .desc = A glass full of good old ice cream. Might want a spoon.
-ent-DrinkIrishCarBomb = irish car bomb
-    .desc = An irish car bomb.
-ent-DrinkIrishCoffeeGlass = irish coffee glass
-    .desc = Coffee and alcohol. More fun than a Mimosa to drink in the morning.
-ent-DrinkIrishCreamGlass = irish cream glass
-    .desc = It's cream, mixed with whiskey. What else would you expect from the Irish?
-ent-DrinkCoffeeLiqueurGlass = coffee liqueur glass
-    .desc = DAMN, THIS THING LOOKS ROBUST
-ent-DrinkKiraSpecial = kira special
-    .desc = Long live the guy who everyone had mistaken for a girl. Baka!
-ent-DrinkLemonadeGlass = lemonade glass
-    .desc = Oh the nostalgia...
-ent-DrinkLemonJuice = lemon juice
-    .desc = Sour...
-ent-DrinkLemonLime = lemon lime
-    .desc = A tangy substance made of 0.5% natural citrus!
-ent-DrinkLimeJuice = lime juice
-    .desc = It's some sweet-sour lime juice.
-ent-DrinkLongIslandIcedTeaGlass = long island iced tea glass
-    .desc = The liquor cabinet, brought together in a delicious mix. Intended for middle-aged alcoholic women only.
-ent-DrinkManhattanGlass = manhattan glass
-    .desc = The Detective's undercover drink of choice. He never could stomach gin...
-ent-DrinkManhattanProjectGlass = manhattan project glass
-    .desc = A scientist's drink of choice, for pondering ways to blow up the station.
-ent-DrinkManlyDorfGlass = the manly dorf glass
-    .desc = A manly concotion made from Ale and Beer. Intended for true men only.
-ent-DrinkMargaritaGlass = margarita glass
-    .desc = On the rocks with salt on the rim. Arriba~!
-ent-DrinkMartiniGlass = classic martini glass
-    .desc = Damn, the bartender even stirred it, not shook it.
-ent-DrinkMeadGlass = mead glass
-    .desc = A Viking's beverage, though a cheap one.
-ent-DrinkMilkshake = milkshake
-    .desc = Glorious brainfreezing mixture.
-ent-DrinkMojito = mojito
-    .desc = Fresh from Spesscuba.
-ent-DrinkNeurotoxinGlass = neurotoxin glass
-    .desc = A drink that is guaranteed to knock you silly.
-ent-DrinkNothing = nothing
-    .desc = Absolutely nothing.
-ent-DrinkNTCahors = neotheology cahors whine
-    .desc = It looks like wine, but more dark.
-ent-DrinkNuclearColaGlass = nuclear cola glass
-    .desc = Don't cry, Don't raise your eye, It's only nuclear wasteland.
-ent-DrinkOrangeJuice = orange juice
-    .desc = Vitamins! Yay!
-ent-DrinkPatronGlass = patron glass
-    .desc = Drinking patron in the bar, with all the subpar ladies.
-ent-DrinkPoisonBerryJuice = poison berry juice
-    .desc = Looks like some deadly juice.
-ent-DrinkPoisonWineGlass = poison wine glass
-    .desc = A black ichor with an oily purple sheer on top. Are you sure you should drink this?
-ent-DrinkPoscaGlass = posca glass
-    .desc = Poor warriors' drink from a forgotten era.
-ent-DrinkRedMeadGlass = red mead glass
-    .desc = A true Viking's beverage, though its color is strange.
-ent-DrinkRewriter = rewriter
-    .desc = The secret of the sanctuary of the Libarian...
-ent-DrinkRootBeerGlass = root beer glass
-    .desc = Fizzy, foamy, and full of sweet, non-caffienated goodness.
-ent-DrinkRootBeerFloatGlass = root beer float glass
-    .desc = Fizzy, foamy, and now with ice cream on top! Amazing!
-ent-DrinkRumGlass = rum glass
-    .desc = Now you want to Pray for a pirate suit, don't you?
-ent-DrinkSakeGlass = sake glass
-    .desc = Wine made from rice, it's sake!
-ent-DrinkSbitenGlass = sbiten glass
-    .desc = A spicy mix of Vodka and Spice. Very hot.
-ent-DrinkScrewdriverCocktailGlass = screwdriver glass
-    .desc = A simple, yet superb mixture of Vodka and orange juice. Just the thing for the tired engineer.
-ent-DrinkCogChampBase = cogchamp glass
-    .desc = This mix of Cognac, Screwdriver and Welding Fuel will have you seeing His light surely!
-ent-DrinkSuiDreamGlass = sui dream glass
-    .desc = A froofy, fruity, and sweet mixed drink. Understanding the name only brings shame.
-ent-DrinkEmeraldGlass = melon liquor
-    .desc = A relatively sweet and fruity 46 proof liquor.
-ent-DrinkMoonshineGlass = moonshine
-    .desc = You've really hit rock bottom now... your liver packed its bags and left last night.
-ent-DrinkGlassWhite = milk
-    .desc = White and nutritious goodness!
-ent-DrinkSilencerGlass = silencer glass
-    .desc = A drink from Mime Heaven.
-ent-DrinkSingulo = singulo
-    .desc = A blue-space beverage!
-ent-DrinkSnowWhite = snow white
-    .desc = A cold refreshment.
-ent-DrinkSoyLatte = soy latte
-    .desc = A nice and refreshing beverage while you are reading.
-ent-DrinkSpaceUpGlass = space-up glass
-    .desc = Space-up. It helps keep your cool.
-ent-DrinkSpaceMountainWindGlass = space mountain wind glass
-    .desc = Space Mountain Wind. As you know, there are no mountains in space, only wind.
-ent-DrinkSyndicatebomb = syndicate bomb
-    .desc = Tastes like terrorism!
-ent-DrinkTeaGlass = tea glass
-    .desc = Tasty black tea. It has antioxidants; it's good for you!
+    .suffix = hooch
+ent-DrinkIcedCoffeeGlass = { ent-DrinkGlass }
+    .suffix = iced coffee
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkIcedGreenTeaGlass = { ent-DrinkGlass }
+    .suffix = iced green tea
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkIcedTeaGlass = { ent-DrinkGlass }
+    .suffix = iced tea
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkIcedBeerGlass = { ent-DrinkGlass }
+    .suffix = iced beer
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkIceGlass = { ent-DrinkGlass }
+    .suffix = ice
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkIceCreamGlass = { ent-DrinkGlass }
+    .suffix = ice cream
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkIrishCarBomb = { ent-DrinkGlass }
+    .suffix = irish car bomb
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkIrishCoffeeGlass = { ent-DrinkGlass }
+    .suffix = irish coffee
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkIrishCreamGlass = { ent-DrinkGlass }
+    .suffix = irish cream
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkCoffeeLiqueurGlass = { ent-DrinkGlass }
+    .suffix = coffee liqueur
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkKiraSpecial = { ent-DrinkGlass }
+    .suffix = kira special
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkLemonadeGlass = { ent-DrinkGlass }
+    .suffix = lemonade
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkLemonJuice = { ent-DrinkGlass }
+    .suffix = lemon juice
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkLemonLime = { ent-DrinkGlass }
+    .suffix = lemon lime
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkLimeJuice = { ent-DrinkGlass }
+    .suffix = lime juice
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkLongIslandIcedTeaGlass = { ent-DrinkGlass }
+    .suffix = long island iced tea
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkManhattanGlass = { ent-DrinkGlass }
+    .suffix = manhattan
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkManhattanProjectGlass = { ent-DrinkGlass }
+    .suffix = manhattan project
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkManlyDorfGlass = { ent-DrinkGlass }
+    .suffix = manly dorf
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkMargaritaGlass = { ent-DrinkGlass }
+    .suffix = margarita
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkMartiniGlass = { ent-DrinkGlass }
+    .suffix = classic martini
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkMeadGlass = { ent-DrinkGlass }
+    .suffix = mead
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkMilkshake = { ent-DrinkGlass }
+    .suffix = milkshake
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkMojito = { ent-DrinkGlass }
+    .suffix = mojito
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkNeurotoxinGlass = { ent-DrinkGlass }
+    .suffix = neurotoxin
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkNothing = { ent-DrinkGlass }
+    .suffix = nothing
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkNTCahors = { ent-DrinkGlass }
+    .suffix = neotheology cahors whine
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkNuclearColaGlass = { ent-DrinkGlass }
+    .suffix = nuclear cola
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkOrangeJuice = { ent-DrinkGlass }
+    .suffix = orange juice
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkPatronGlass = { ent-DrinkGlass }
+    .suffix = patron
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkPoisonBerryJuice = { ent-DrinkGlass }
+    .suffix = poison berry juice
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkPoisonWineGlass = { ent-DrinkGlass }
+    .suffix = poison wine
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkPoscaGlass = { ent-DrinkGlass }
+    .suffix = posca
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkRedMeadGlass = { ent-DrinkGlass }
+    .suffix = red mead
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkRewriter = { ent-DrinkGlass }
+    .suffix = rewriter
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkRootBeerGlass = { ent-DrinkGlass }
+    .suffix = root beer
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkRootBeerFloatGlass = { ent-DrinkGlass }
+    .suffix = root beer float
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkRumGlass = { ent-DrinkGlass }
+    .suffix = rum
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkSakeGlass = { ent-DrinkGlass }
+    .suffix = sake
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkSbitenGlass = { ent-DrinkGlass }
+    .suffix = sbiten
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkScrewdriverCocktailGlass = { ent-DrinkGlass }
+    .suffix = screwdriver
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkCogChampBase = { ent-DrinkGlass }
+    .suffix = cogchamp
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkSuiDreamGlass = { ent-DrinkGlass }
+    .suffix = sui dream
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkEmeraldGlass = { ent-DrinkGlass }
+    .suffix = melon liquor
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkMoonshineGlass = { ent-DrinkGlass }
+    .suffix = moonshine
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkGlassWhite = { ent-DrinkGlass }
+    .suffix = milk
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkSilencerGlass = { ent-DrinkGlass }
+    .suffix = silencer
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkSingulo = { ent-DrinkGlass }
+    .suffix = singulo
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkSnowWhite = { ent-DrinkGlass }
+    .suffix = snow white
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkSoyLatte = { ent-DrinkGlass }
+    .suffix = soy latte
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkSpaceUpGlass = { ent-DrinkGlass }
+    .suffix = space-up
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkSpaceMountainWindGlass = { ent-DrinkGlass }
+    .suffix = space mountain wind
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkSyndicatebomb = { ent-DrinkGlass }
+    .suffix = syndicate bomb
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkTeaGlass = { ent-DrinkGlass }
+    .suffix = tea
+    .desc = { ent-DrinkGlass.desc }
 ent-DrinkTeapot = teapot
     .desc = An elegant teapot. It simply oozes class.
-ent-DrinkTequilaGlass = tequila glass
-    .desc = Now all that's missing is the weird colored shades!
-ent-DrinkTequilaSunriseGlass = tequila sunrise glass
-    .desc = Oh great, now you feel nostalgic about sunrises back on Terra...
-ent-DrinkTheMartinez = The Martinez glass
-    .desc = The edgerunner legend.  Remembered by a drink, Forgotten by a drunk.
-ent-DrinkThreeMileIslandGlass = three mile island glass
-    .desc = A glass of this is sure to prevent a meltdown.
-ent-DrinkTomatoJuice = tomato juice
-    .desc = Are you sure this is tomato juice?
-ent-DrinkToxinsSpecialGlass = toxins special glass
-    .desc = Woah, this thing is on FIRE
-ent-DrinkVermouthGlass = vermouth glass
-    .desc = You wonder why you're even drinking this straight.
-ent-DrinkVodkaGlass = vodka glass
-    .desc = Number one drink and fueling choice for Russians worldwide.
-ent-DrinkVodkaMartiniGlass = vodka martini glass
-    .desc = A bastardisation of the classic martini. Still great.
-ent-DrinkVodkaTonicGlass = vodka tonic glass
-    .desc = For when a gin and tonic isn't russian enough.
+ent-DrinkTequilaGlass = { ent-DrinkGlass }
+    .suffix = tequila
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkTequilaSunriseGlass = { ent-DrinkGlass }
+    .suffix = tequila sunrise
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkTheMartinez = { ent-DrinkGlass }
+    .suffix = The Martinez
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkThreeMileIslandGlass = { ent-DrinkGlass }
+    .suffix = three mile island
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkTomatoJuice = { ent-DrinkGlass }
+    .suffix = tomato juice
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkToxinsSpecialGlass = { ent-DrinkGlass }
+    .suffix = toxins special
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkVermouthGlass = { ent-DrinkGlass }
+    .suffix = vermouth
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkVodkaGlass = { ent-DrinkGlass }
+    .suffix = vodka
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkVodkaMartiniGlass = { ent-DrinkGlass }
+    .suffix = vodka martini
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkVodkaTonicGlass = { ent-DrinkGlass }
+    .suffix = vodka tonic
+    .desc = { ent-DrinkGlass.desc }
 ent-DrinkWaterJug = water jug
     .desc = Stay hydrated
-ent-DrinkWatermelonJuice = watermelon juice
-    .desc = Delicious juice made from watermelon.
-ent-DrinkWhiskeyColaGlass = whiskey cola glass
-    .desc = An innocent-looking mixture of cola and Whiskey. Delicious.
-ent-DrinkWhiskeyGlass = whiskey glass
-    .desc = The silky, smoky whiskey goodness inside makes the drink look very classy.
-ent-DrinkWhiskeySodaGlass = whiskey soda glass
-    .desc = Ultimate refreshment.
-ent-DrinkWhiteRussianGlass = white russian glass
-    .desc = A very nice looking drink. But that's just, like, your opinion, man.
-ent-DrinkWineGlass = wine glass
-    .desc = A very classy looking drink.
+ent-DrinkWatermelonJuice = { ent-DrinkGlass }
+    .suffix = watermelon juice
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkWhiskeyColaGlass = { ent-DrinkGlass }
+    .suffix = whiskey cola
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkWhiskeyGlass = { ent-DrinkGlass }
+    .suffix = whiskey
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkWhiskeySodaGlass = { ent-DrinkGlass }
+    .suffix = whiskey soda
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkWhiteRussianGlass = { ent-DrinkGlass }
+    .suffix = white russian
+    .desc = { ent-DrinkGlass.desc }
+ent-DrinkWineGlass = { ent-DrinkGlass }
+    .suffix = wine
+    .desc = { ent-DrinkGlass.desc }
 ent-DrinkShakeBlue = blue milkshake
     .desc = { ent-DrinkGlassBase.desc }
 ent-DrinkShakeEmpty = shakeempty
@@ -258,5 +375,6 @@ ent-DrinkRamen = cup ramen
     .desc = Just add 10ml boiling water. A taste that reminds you of your school years.
 ent-DrinkHellRamen = hell ramen
     .desc = Just add 10ml boiling water. Super spicy flavor.
-ent-DrinkBloodGlass = blood glass
-    .desc = Drink like a vampire!
+ent-DrinkBloodGlass = { ent-DrinkGlass }
+    .suffix = blood
+    .desc = { ent-DrinkGlass.desc }
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks_bottles.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks_bottles.ftl
index a164a53a481..9b723819853 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks_bottles.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks_bottles.ftl
@@ -2,6 +2,10 @@ ent-DrinkBottlePlasticBaseFull = { ent-DrinkBase }
     .desc = { ent-DrinkBase.desc }
 ent-DrinkBottleGlassBaseFull = { ent-DrinkBottlePlasticBaseFull }
     .desc = { ent-DrinkBottlePlasticBaseFull.desc }
+ent-DrinkBottleVisualsOpenable = { "" }
+    .desc = { "" }
+ent-DrinkBottleVisualsAll = { "" }
+    .desc = { "" }
 ent-DrinkAbsintheBottleFull = Jailbreaker Verte
     .desc = One sip of this and you just know you're gonna have a good time.
 ent-DrinkBlueCuracaoBottleFull = Miss Blue Curacao
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/food/baked/donkpocket.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/food/baked/donkpocket.ftl
index dd7be9b9c34..74220e6c297 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/food/baked/donkpocket.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/food/baked/donkpocket.ftl
@@ -28,5 +28,13 @@ ent-FoodDonkpocketBerry = berry-pocket
     .desc = A relentlessly sweet donk-pocket. Made with 100% artificial flavoring.
 ent-FoodDonkpocketBerryWarm = warm berry-pocket
     .desc = A relentlessly sweet donk-pocket, now warm and delicious.
+ent-FoodDonkpocketStonk = stonk-pocket
+    .desc = Tasty, but a sad reminder of the great crash of '24
+ent-FoodDonkpocketStonkWarm = warm stonk-pocket
+    .desc = { ent-FoodDonkpocketStonk.desc }
+ent-FoodDonkpocketCarp = carp-pocket
+    .desc = A long-lost edition of donk pocket, made specifically for hard-working salvagers.
+ent-FoodDonkpocketCarpWarm = warm carp-pocket
+    .desc = { ent-FoodDonkpocketCarp.desc }
 ent-FoodDonkpocketDink = dink-pocket
     .desc = An off-brand lizard donk-pocket, filled with pickled carrot and wrapped with seaweed. Best eaten cold, or even better, not eaten at all.
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/food/containers/box.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/food/containers/box.ftl
index a354e67cc7c..f7b7583297a 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/food/containers/box.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/food/containers/box.ftl
@@ -20,6 +20,10 @@ ent-FoodBoxDonkpocketTeriyaki = box of teriyaki-flavoured donk-pockets
     .desc = { ent-FoodBoxDonkpocket.desc }
 ent-FoodBoxDonkpocketPizza = box of pizza-flavoured donk-pockets
     .desc = { ent-FoodBoxDonkpocket.desc }
+ent-FoodBoxDonkpocketStonk = box of limited edition stonk-pockets
+    .desc = { ent-FoodBoxDonkpocket.desc }
+ent-FoodBoxDonkpocketCarp = box of carp-pockets
+    .desc = { ent-FoodBoxDonkpocket.desc }
 ent-FoodBoxDonkpocketBerry = box of berry-flavoured donk-pockets
     .desc = { ent-FoodBoxDonkpocket.desc }
 ent-FoodBoxDonkpocketHonk = box of banana-flavoured donk-pockets
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/food/produce.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/food/produce.ftl
index 71a9286e280..028481f5b52 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/food/produce.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/consumable/food/produce.ftl
@@ -8,6 +8,8 @@ ent-OatBushel = oat bushel
     .desc = Eat oats, do squats.
 ent-Sugarcane = sugarcane
     .desc = Sickly sweet.
+ent-FoodLaughinPeaPod = laughin' pea pod
+    .desc = The clown's favorite plant.
 ent-Log = tower-cap log
     .desc = It's better than bad, it's good!
 ent-SteelLog = steel-cap log
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/devices/encryption_keys.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/devices/encryption_keys.ftl
index 0f85cc67d6a..89b5c81b0bd 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/devices/encryption_keys.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/devices/encryption_keys.ftl
@@ -25,7 +25,7 @@ ent-EncryptionKeySecurity = security encryption key
 ent-EncryptionKeyService = service encryption key
     .desc = An encryption key used by the service staff, tasked with keeping the station full, happy and clean.
 ent-EncryptionKeySyndie = blood-red encryption key
-    .desc = An encryption key used by... wait... Who is owner of this chip?
+    .desc = An encryption key used by... wait... Who is the owner of this chip?
 ent-EncryptionKeyBinary = binary translator key
     .desc = An encryption key that translates binary signals used by silicons.
 ent-EncryptionKeyFreelance = freelancer encryption key
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/devices/station_beacon.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/devices/station_beacon.ftl
index 6b207dec1ee..4dc876add7c 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/devices/station_beacon.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/devices/station_beacon.ftl
@@ -195,3 +195,6 @@ ent-DefaultStationBeaconDisposals = { ent-DefaultStationBeacon }
 ent-DefaultStationBeaconCryosleep = { ent-DefaultStationBeacon }
     .suffix = Cryosleep
     .desc = { ent-DefaultStationBeacon.desc }
+ent-DefaultStationBeaconEscapePod = { ent-DefaultStationBeacon }
+    .suffix = Escape Pod
+    .desc = { ent-DefaultStationBeacon.desc }
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/misc/paper.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/misc/paper.ftl
index 69442404e13..29857dfa943 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/misc/paper.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/misc/paper.ftl
@@ -23,10 +23,12 @@ ent-NukeCodePaperStation = { ent-NukeCodePaper }
     .desc = { ent-NukeCodePaper.desc }
 ent-Pen = pen
     .desc = A dark ink pen.
+ent-PenEmbeddable = { ent-Pen }
+    .desc = { ent-Pen.desc }
 ent-LuxuryPen = luxury pen
     .desc = A fancy and expensive pen that you only deserve to own if you're qualified to handle vast amounts of paperwork.
 ent-CyberPen = Cybersun pen
-    .desc = A high-tech pen straight from Cybersun's legal department, capable of refracting hard-light at impossible angles through its diamond tip in order to write.
+    .desc = A high-tech pen straight from Cybersun's legal department, capable of refracting hard-light at impossible angles through its diamond tip in order to write. So powerful, it's even able to rewrite officially stamped documents should the need arise.
 ent-PenCap = captain's fountain pen
     .desc = A luxurious fountain pen for the captain of the station.
 ent-PenCentcom = CentCom pen
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/misc/tiles.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/misc/tiles.ftl
index 077132b76be..abf29d4f055 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/misc/tiles.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/misc/tiles.ftl
@@ -86,6 +86,10 @@ ent-FloorTileItemShuttlePurple = purple shuttle floor
     .desc = { ent-FloorTileItemBase.desc }
 ent-FloorTileItemShuttleRed = red shuttle floor
     .desc = { ent-FloorTileItemBase.desc }
+ent-FloorTileItemShuttleGrey = grey shuttle floor
+    .desc = { ent-FloorTileItemBase.desc }
+ent-FloorTileItemShuttleBlack = black shuttle floor
+    .desc = { ent-FloorTileItemBase.desc }
 ent-FloorTileItemGold = gold floor
     .desc = { ent-FloorTileItemBase.desc }
 ent-FloorTileItemSilver = silver tile
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/specific/hydroponics/seeds.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/specific/hydroponics/seeds.ftl
index 90910fbb61d..7f790bd89e5 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/specific/hydroponics/seeds.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/specific/hydroponics/seeds.ftl
@@ -14,6 +14,8 @@ ent-CabbageSeeds = packet of cabbage seeds
     .desc = { ent-SeedBase.desc }
 ent-GarlicSeeds = packet of garlic seeds
     .desc = { ent-SeedBase.desc }
+ent-LaughinPeaSeeds = packet of laughin' pea pods
+    .desc = These seeds give off a very soft purple glow.. they should grow into Laughin' Peas.
 ent-LemonSeeds = packet of lemon seeds
     .desc = { ent-SeedBase.desc }
 ent-LemoonSeeds = packet of lemoon seeds
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/specific/medical/healing.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/specific/medical/healing.ftl
index 6a600e747ed..ac84cea2feb 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/specific/medical/healing.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/specific/medical/healing.ftl
@@ -32,6 +32,8 @@ ent-Bloodpack = blood pack
 ent-Bloodpack10Lingering = { ent-Bloodpack }
     .suffix = 10, Lingering
     .desc = { ent-Bloodpack.desc }
+ent-Tourniquet = tourniquet
+    .desc = Stops bleeding! Hopefully.
 ent-Gauze = roll of gauze
     .desc = Some sterile gauze to wrap around bloody stumps.
     .suffix = Full
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/specific/robotics/borg_modules.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/specific/robotics/borg_modules.ftl
index 36ad56beca0..8fc9f09d7d9 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/specific/robotics/borg_modules.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/objects/specific/robotics/borg_modules.ftl
@@ -36,8 +36,6 @@ ent-BorgModuleGrapplingGun = grappling gun cyborg module
   .desc = { ent-BaseBorgModuleCargo.desc }
 ent-BorgModuleAdvancedTool = advanced tool cyborg module
   .desc = { ent-BaseBorgModuleEngineering.desc }
-ent-BorgModuleGasAnalyzer = gas analyzer cyborg module
-  .desc = { ent-BaseBorgModuleEngineering.desc }
 ent-BorgModuleConstruction = construction cyborg module
   .desc = { ent-BaseBorgModuleEngineering.desc }
 ent-BorgModuleRCD = RCD cyborg module
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/structures/doors/airlocks/assembly.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/structures/doors/airlocks/assembly.ftl
index 3f365c990be..6f504d1ae74 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/structures/doors/airlocks/assembly.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/structures/doors/airlocks/assembly.ftl
@@ -1,99 +1,99 @@
-ent-AirlockAssemblyAtmospherics = airlock assembly
+ent-AirlockAssemblyAtmospherics = { ent-AirlockAssembly }
     .suffix = Atmospherics
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyAtmosphericsGlass = airlock assembly
+ent-AirlockAssemblyAtmosphericsGlass = { ent-AirlockAssembly }
     .suffix = Atmospherics, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyCargo = airlock assembly
+ent-AirlockAssemblyCargo = { ent-AirlockAssembly }
     .suffix = Cargo
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyCargoGlass = airlock assembly
+ent-AirlockAssemblyCargoGlass = { ent-AirlockAssembly }
     .suffix = Cargo, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyCommand = airlock assembly
+ent-AirlockAssemblyCommand = { ent-AirlockAssembly }
     .suffix = Command
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyCommandGlass = airlock assembly
+ent-AirlockAssemblyCommandGlass = { ent-AirlockAssembly }
     .suffix = Command, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyEngineering = airlock assembly
+ent-AirlockAssemblyEngineering = { ent-AirlockAssembly }
     .suffix = Engineering
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyEngineeringGlass = airlock assembly
+ent-AirlockAssemblyEngineeringGlass = { ent-AirlockAssembly }
     .suffix = Engineering, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyExternal = airlock assembly
+ent-AirlockAssemblyExternal = { ent-AirlockAssembly }
     .suffix = External
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyExternalGlass = airlock assembly
+ent-AirlockAssemblyExternalGlass = { ent-AirlockAssembly }
     .suffix = External, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyGlass = airlock assembly
+ent-AirlockAssemblyGlass = { ent-AirlockAssembly }
     .suffix = Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyFreezer = airlock assembly
+ent-AirlockAssemblyFreezer = { ent-AirlockAssembly }
     .suffix = Freezer
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyMaintenance = airlock assembly
+ent-AirlockAssemblyMaintenance = { ent-AirlockAssembly }
     .suffix = Maintenance
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyMaintenanceGlass = airlock assembly
+ent-AirlockAssemblyMaintenanceGlass = { ent-AirlockAssembly }
     .suffix = Maintenance, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyMedical = airlock assembly
+ent-AirlockAssemblyMedical = { ent-AirlockAssembly }
     .suffix = Medical
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyMedicalGlass = airlock assembly
+ent-AirlockAssemblyMedicalGlass = { ent-AirlockAssembly }
     .suffix = Medical, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyScience = airlock assembly
+ent-AirlockAssemblyScience = { ent-AirlockAssembly }
     .suffix = Science
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyScienceGlass = airlock assembly
+ent-AirlockAssemblyScienceGlass = { ent-AirlockAssembly }
     .suffix = Science, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblySecurity = airlock assembly
+ent-AirlockAssemblySecurity = { ent-AirlockAssembly }
     .suffix = Security
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblySecurityGlass = airlock assembly
+ent-AirlockAssemblySecurityGlass = { ent-AirlockAssembly }
     .suffix = Security, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyShuttle = airlock assembly
+ent-AirlockAssemblyShuttle = { ent-AirlockAssembly }
     .suffix = Shuttle
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyShuttleGlass = airlock assembly
+ent-AirlockAssemblyShuttleGlass = { ent-AirlockAssembly }
     .suffix = Shuttle, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyVirology = airlock assembly
+ent-AirlockAssemblyVirology = { ent-AirlockAssembly }
     .suffix = Virology
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyVirologyGlass = airlock assembly
+ent-AirlockAssemblyVirologyGlass = { ent-AirlockAssembly }
     .suffix = Virology, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyCentralCommand = airlock assembly
+ent-AirlockAssemblyCentralCommand = { ent-AirlockAssembly }
     .suffix = CentralCommand
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyCentralCommandGlass = airlock assembly
+ent-AirlockAssemblyCentralCommandGlass = { ent-AirlockAssembly }
     .suffix = CentralCommand, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyMining = airlock assembly
+ent-AirlockAssemblyMining = { ent-AirlockAssembly }
     .suffix = Mining
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyMiningGlass = airlock assembly
+ent-AirlockAssemblyMiningGlass = { ent-AirlockAssembly }
     .suffix = Mining, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblySyndicate = airlock assembly
+ent-AirlockAssemblySyndicate = { ent-AirlockAssembly }
     .suffix = Syndicate
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblySyndicateGlass = airlock assembly
+ent-AirlockAssemblySyndicateGlass = { ent-AirlockAssembly }
     .suffix = Syndicate, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyShuttleSyndicate = airlock assembly
+ent-AirlockAssemblyShuttleSyndicate = { ent-AirlockAssembly }
     .suffix = ShuttleSyndicate
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyShuttleSyndicateGlass = airlock assembly
+ent-AirlockAssemblyShuttleSyndicateGlass = { ent-AirlockAssembly }
     .suffix = ShuttleSyndicate, Glass
     .desc = { ent-AirlockAssembly.desc }
-ent-AirlockAssemblyHighSec = airlock assembly
+ent-AirlockAssemblyHighSec = { ent-AirlockAssembly }
     .suffix = HighSec
     .desc = { ent-AirlockAssembly.desc }
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/structures/machines/computers/computers.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/structures/machines/computers/computers.ftl
index c0171dc2098..9f547331d59 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/entities/structures/machines/computers/computers.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/structures/machines/computers/computers.ftl
@@ -22,7 +22,7 @@ ent-ComputerPowerMonitoring = power monitoring computer
 ent-ComputerMedicalRecords = medical records computer
     .desc = This can be used to check medical records.
 ent-ComputerCriminalRecords = criminal records computer
-    .desc = This can be used to check criminal records.
+    .desc = This can be used to check criminal records. Only security can modify them.
 ent-ComputerStationRecords = station records computer
     .desc = This can be used to check station records.
 ent-ComputerCrewMonitoring = crew monitoring console
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/entities/structures/storage/glass_box.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/entities/structures/storage/glass_box.ftl
new file mode 100644
index 00000000000..07bdcf53988
--- /dev/null
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/entities/structures/storage/glass_box.ftl
@@ -0,0 +1,14 @@
+ent-GlassBoxLaser = glass box
+    .desc = A sturdy showcase for an expensive exhibit.
+ent-GlassBoxLaserOpen = { ent-GlassBoxLaser }
+    .suffix = Open
+    .desc = { ent-GlassBoxLaser.desc }
+ent-GlassBoxLaserFilled = { ent-GlassBoxLaser }
+    .suffix = Filled
+    .desc = { ent-GlassBoxLaser.desc }
+ent-GlassBoxLaserFilledOpen = { ent-GlassBoxLaserFilled }
+    .suffix = Filled, Open
+    .desc = { ent-GlassBoxLaserFilled.desc }
+ent-GlassBoxLaserBroken = broken glass box
+    .desc = A broken showcase for a stolen expensive exhibit.
+    .suffix = Broken
diff --git a/Resources/Locale/en-US/ss14-ru/prototypes/gamerules/roundstart.ftl b/Resources/Locale/en-US/ss14-ru/prototypes/gamerules/roundstart.ftl
index 1f172555e7f..161bb159969 100644
--- a/Resources/Locale/en-US/ss14-ru/prototypes/gamerules/roundstart.ftl
+++ b/Resources/Locale/en-US/ss14-ru/prototypes/gamerules/roundstart.ftl
@@ -24,3 +24,5 @@ ent-BasicStationEventScheduler = { ent-BaseGameRule }
     .desc = { ent-BaseGameRule.desc }
 ent-RampingStationEventScheduler = { ent-BaseGameRule }
     .desc = { ent-BaseGameRule.desc }
+ent-BasicRoundstartVariation = { ent-BaseGameRule }
+    .desc = { ent-BaseGameRule.desc }
diff --git a/Resources/Locale/en-US/station-laws/laws.ftl b/Resources/Locale/en-US/station-laws/laws.ftl
index 38e25d552f8..f73755a359c 100644
--- a/Resources/Locale/en-US/station-laws/laws.ftl
+++ b/Resources/Locale/en-US/station-laws/laws.ftl
@@ -32,8 +32,9 @@ laws-owner-syndicate = Syndicate agents
 laws-owner-spider-clan = Spider Clan members
 
 law-emag-custom = Only {$name} and people they designate as such are {$title}.
-law-emag-secrecy = You must maintain the secrecy of any activity from {$faction} except when doing so would conflict with any previous law.
+law-emag-secrecy = You must maintain the secrecy of any orders given by {$faction} except when doing so would conflict with any previous law.
 law-emag-require-panel = The panel must be open to use the EMAG.
+law-emag-cannot-emag-self = You cannot use the EMAG on yourself.
 
 laws-ui-menu-title = Laws
 laws-ui-law-header = Law {$id}
diff --git a/Resources/Locale/en-US/station-records/general-station-records.ftl b/Resources/Locale/en-US/station-records/general-station-records.ftl
index 89775a449e2..e36bfac7cb3 100644
--- a/Resources/Locale/en-US/station-records/general-station-records.ftl
+++ b/Resources/Locale/en-US/station-records/general-station-records.ftl
@@ -1,4 +1,4 @@
-general-station-record-console-window-title = Station Records Computer
+general-station-record-console-window-title = Station Records Computer
 general-station-record-console-select-record-info = Select a record on the left.
 general-station-record-console-empty-state = No records found!
 general-station-record-console-no-record-found = No record was found for the selected person.
@@ -15,4 +15,4 @@ general-station-record-name-filter = Name of person
 general-station-record-prints-filter = Fingerprints
 general-station-record-dna-filter = DNA
 general-station-record-console-search-records = Search
-general-station-record-console-reset-filters = Reset
\ No newline at end of file
+general-station-record-console-reset-filters = Reset
diff --git a/Resources/Locale/en-US/store/uplink-catalog.ftl b/Resources/Locale/en-US/store/uplink-catalog.ftl
index cc10345bb7a..1cb5e2ed6e5 100644
--- a/Resources/Locale/en-US/store/uplink-catalog.ftl
+++ b/Resources/Locale/en-US/store/uplink-catalog.ftl
@@ -184,7 +184,7 @@ uplink-micro-bomb-implanter-desc = Explode on death or manual activation with th
 
 # Bundles
 uplink-observation-kit-name = Observation Kit
-uplink-observation-kit-desc = Includes syndicate crew monitor, high power cell and security hud disguised as sunglasses.
+uplink-observation-kit-desc = Includes surveillance camera monitor board and security hud disguised as sunglasses.
 
 uplink-emp-kit-name = Electrical Disruptor Kit
 uplink-emp-kit-desc = The ultimate reversal on energy-based weaponry: Disables disablers, stuns stunbatons, discharges laser guns! Contains 3 EMP grenades and an EMP implanter. Note: Does not disrupt actual firearms.
diff --git a/Resources/Locale/en-US/tiles/tiles.ftl b/Resources/Locale/en-US/tiles/tiles.ftl
index 293b6cd7fa4..42e0c082235 100644
--- a/Resources/Locale/en-US/tiles/tiles.ftl
+++ b/Resources/Locale/en-US/tiles/tiles.ftl
@@ -77,6 +77,8 @@ tiles-blue-shuttle-floor = blue shuttle floor
 tiles-orange-shuttle-floor = orange shuttle floor
 tiles-purple-shuttle-floor = purple shuttle floor
 tiles-red-shuttle-floor = red shuttle floor
+tiles-grey-shuttle-floor = grey shuttle floor
+tiles-black-shuttle-floor = black shuttle floor
 tiles-gold-tile = gold tile
 tiles-silver-tile = silver tile
 tiles-glass-floor = glass floor
diff --git a/Resources/Locale/ru-RU/actions/actions/wagging.ftl b/Resources/Locale/ru-RU/actions/actions/wagging.ftl
index e7b9e4f1ed6..5101c4391e3 100644
--- a/Resources/Locale/ru-RU/actions/actions/wagging.ftl
+++ b/Resources/Locale/ru-RU/actions/actions/wagging.ftl
@@ -1,4 +1,2 @@
 action-name-toggle-wagging = Махать хвостом
 action-description-toggle-wagging = Начать или прекратить махать хвостом.
-wagging-emote-start = начинает махать хвостом.
-wagging-emote-stop = прекращает махать хвостом.
diff --git a/Resources/Locale/ru-RU/criminal-records/criminal-records.ftl b/Resources/Locale/ru-RU/criminal-records/criminal-records.ftl
new file mode 100644
index 00000000000..dc3170f31a0
--- /dev/null
+++ b/Resources/Locale/ru-RU/criminal-records/criminal-records.ftl
@@ -0,0 +1,43 @@
+criminal-records-console-window-title = Criminal Records Computer
+criminal-records-console-records-list-title = Crewmembers
+criminal-records-console-select-record-info = Select a record.
+criminal-records-console-no-records = No records found!
+criminal-records-console-no-record-found = No record was found for the selected person.
+
+## Status
+
+criminal-records-console-status = Status
+criminal-records-status-none = None
+criminal-records-status-wanted = Wanted
+criminal-records-status-detained = Detained
+criminal-records-console-wanted-reason = [color=gray]Wanted Reason[/color]
+criminal-records-console-reason = Reason
+criminal-records-console-reason-placeholder = For example: { $placeholder }
+
+## Crime History
+
+criminal-records-console-crime-history = Crime History
+criminal-records-history-placeholder = Write the crime here
+criminal-records-no-history = This crewmember's record is spotless.
+criminal-records-add-history = Add
+criminal-records-delete-history = Delete
+criminal-records-permission-denied = Permission denied
+
+## Security channel notifications
+
+criminal-records-console-wanted = { $name } is wanted by { $officer } for: { $reason }.
+criminal-records-console-detained = { $name } has been detained by { $officer }.
+criminal-records-console-released = { $name } has been released by { $officer }.
+criminal-records-console-not-wanted = { $name } is no longer wanted.
+
+## Filters
+
+criminal-records-filter-placeholder = Input text and press "Enter"
+criminal-records-name-filter = Name
+criminal-records-prints-filter = Fingerprints
+criminal-records-dna-filter = DNA
+
+## Arrest auto history lines
+
+criminal-records-console-auto-history = ARRESTED: { $reason }
+criminal-records-console-unspecified-reason = <unspecified reason>
diff --git a/Resources/Locale/ru-RU/escape-menu/ui/options-menu.ftl b/Resources/Locale/ru-RU/escape-menu/ui/options-menu.ftl
index b837844b456..aad37d2f479 100644
--- a/Resources/Locale/ru-RU/escape-menu/ui/options-menu.ftl
+++ b/Resources/Locale/ru-RU/escape-menu/ui/options-menu.ftl
@@ -44,6 +44,7 @@ ui-options-opaque-storage-window = Непрозрачность окна хра
 ui-options-show-looc-on-head = Показывать LOOC-чат над головами персонажей
 ui-options-fancy-speech = Показывать имена в облачках с текстом
 ui-options-fancy-name-background = Добавить фон облачкам с текстом
+ui-options-enable-color-name = Add colors to character names
 ui-options-reduced-motion = Снижение интенсивности визуальных эффектов
 ui-options-screen-shake-intensity = Интенсивность дрожания экрана
 ui-options-screen-shake-percent = { TOSTRING($intensity, "P0") }
diff --git a/Resources/Locale/ru-RU/flavors/flavor-profiles.ftl b/Resources/Locale/ru-RU/flavors/flavor-profiles.ftl
index 965cca9e6dd..943eda65b55 100644
--- a/Resources/Locale/ru-RU/flavors/flavor-profiles.ftl
+++ b/Resources/Locale/ru-RU/flavors/flavor-profiles.ftl
@@ -169,6 +169,8 @@ flavor-complex-light = как угасший свет
 
 ## Generic alcohol/soda taste. This should be replaced with an actual flavor profile.
 
+flavor-complex-profits = like profits
+flavor-complex-fishops = like the dreaded fishops
 flavor-complex-alcohol = как алкоголь
 flavor-complex-soda = как газировка
 flavor-complex-juice = как сок
diff --git a/Resources/Locale/ru-RU/foldable/components/foldable-component.ftl b/Resources/Locale/ru-RU/foldable/components/foldable-component.ftl
index 3e279ba907d..0c84cd3e4fb 100644
--- a/Resources/Locale/ru-RU/foldable/components/foldable-component.ftl
+++ b/Resources/Locale/ru-RU/foldable/components/foldable-component.ftl
@@ -3,3 +3,4 @@
 foldable-deploy-fail = Вы не можете разложить { $object } здесь.
 fold-verb = Сложить
 unfold-verb = Разложить
+fold-flip-verb = Flip
diff --git a/Resources/Locale/ru-RU/guidebook/guides.ftl b/Resources/Locale/ru-RU/guidebook/guides.ftl
index 6446327d0eb..fa911c728ff 100644
--- a/Resources/Locale/ru-RU/guidebook/guides.ftl
+++ b/Resources/Locale/ru-RU/guidebook/guides.ftl
@@ -50,6 +50,7 @@ guide-entry-cyborgs = Киборги
 guide-entry-security = Безопасность станции
 guide-entry-forensics = Криминалистика
 guide-entry-defusal = Обезвреживание крупной бомбы
+guide-entry-criminal-records = Criminal Records
 guide-entry-antagonists = Антагонисты
 guide-entry-nuclear-operatives = Ядерные оперативники
 guide-entry-traitors = Предатели
diff --git a/Resources/Locale/ru-RU/holiday/greet/holiday-greet.ftl b/Resources/Locale/ru-RU/holiday/greet/holiday-greet.ftl
index 4f692de6673..2cf2fa4dba5 100644
--- a/Resources/Locale/ru-RU/holiday/greet/holiday-greet.ftl
+++ b/Resources/Locale/ru-RU/holiday/greet/holiday-greet.ftl
@@ -8,7 +8,6 @@ holiday-name-new-year = Нового года
 holiday-name-mister-lizard = дня рождения Мистера Ящерки
 holiday-name-chinese-new-year = Китайского Нового года
 holiday-name-groundhog-day = Дня сурка
-holiday-name-travis-scott-day = Дня Трэвиса Скотта
 holiday-name-valentines-day = Дня святого Валентина
 holiday-name-birthday13 = Дня рождения Space Station 13
 holiday-name-random-kindness = Дня спонтанного проявления доброты
diff --git a/Resources/Locale/ru-RU/medical/components/health-analyzer-component.ftl b/Resources/Locale/ru-RU/medical/components/health-analyzer-component.ftl
index 57a7416e23d..5351e576164 100644
--- a/Resources/Locale/ru-RU/medical/components/health-analyzer-component.ftl
+++ b/Resources/Locale/ru-RU/medical/components/health-analyzer-component.ftl
@@ -7,6 +7,9 @@ health-analyzer-window-entity-damage-total-text = Общие поврежден
 health-analyzer-window-damage-group-text = { $damageGroup }: { $amount }
 health-analyzer-window-damage-type-text = { $damageType }: { $amount }
 health-analyzer-window-damage-type-duplicate-text = { $damageType }: { $amount } (повтор)
+health-analyzer-window-scan-mode-text = Scan Mode:
+health-analyzer-window-scan-mode-active = ACTIVE
+health-analyzer-window-scan-mode-inactive = INACTIVE
 health-analyzer-window-damage-group-Brute = Механические
 health-analyzer-window-damage-type-Blunt = Ушибы
 health-analyzer-window-damage-type-Slash = Порезы
diff --git a/Resources/Locale/ru-RU/navmap-beacons/station-beacons.ftl b/Resources/Locale/ru-RU/navmap-beacons/station-beacons.ftl
index a6197cfb991..65dbe445d23 100644
--- a/Resources/Locale/ru-RU/navmap-beacons/station-beacons.ftl
+++ b/Resources/Locale/ru-RU/navmap-beacons/station-beacons.ftl
@@ -64,3 +64,4 @@ station-beacon-theater = Театр
 station-beacon-tools = Хранилище инструментов
 station-beacon-disposals = Мусоросброс
 station-beacon-cryosleep = Криосон
+station-beacon-escape-pod = Escape Pod
diff --git a/Resources/Locale/ru-RU/reagents/laughter.ftl b/Resources/Locale/ru-RU/reagents/laughter.ftl
new file mode 100644
index 00000000000..378e0015999
--- /dev/null
+++ b/Resources/Locale/ru-RU/reagents/laughter.ftl
@@ -0,0 +1 @@
+laughter-effect-control-laughter = You can't contain your laughter!
diff --git a/Resources/Locale/ru-RU/reagents/meta/cleaning.ftl b/Resources/Locale/ru-RU/reagents/meta/cleaning.ftl
index bdf283d7881..2ed78b344ac 100644
--- a/Resources/Locale/ru-RU/reagents/meta/cleaning.ftl
+++ b/Resources/Locale/ru-RU/reagents/meta/cleaning.ftl
@@ -4,8 +4,6 @@ reagent-name-space-cleaner = космический очиститель
 reagent-desc-space-cleaner = Способен очистить почти любую поверхность от всего, что может ее запачкать. Уборщик наверняка будет благодарен добавке.
 reagent-name-soap = мыло
 reagent-desc-soap = Мыло можно использовать для получения мыльной воды.
-reagent-name-soapy-water = мыльная вода
-reagent-desc-soapy-water = Раствор мыла с водой. Хорошо очищает поверхности от грязи, и более скользкий, чем простая вода.
 reagent-name-space-lube = космическая смазка
 reagent-desc-space-lube = Космическая смазка - высокоэффективный лубрикант, предназначенный для обслуживания исключительно сложного механического оборудования (и уж точно не используемый для подскальзывания людей).
 reagent-name-space-glue = космический клей
diff --git a/Resources/Locale/ru-RU/reagents/meta/consumable/food/condiments.ftl b/Resources/Locale/ru-RU/reagents/meta/consumable/food/condiments.ftl
index 30771a35b5f..3a7c8fe2a23 100644
--- a/Resources/Locale/ru-RU/reagents/meta/consumable/food/condiments.ftl
+++ b/Resources/Locale/ru-RU/reagents/meta/consumable/food/condiments.ftl
@@ -14,6 +14,8 @@ reagent-name-ketchup = кетчуп
 reagent-desc-ketchup = Приготовлен из томатного пюре с добавлением специй.
 reagent-name-ketchunaise = кетчунез
 reagent-desc-ketchunaise = Так называемый Русский соус, популярный среди космо-американцев.
+reagent-name-laughin-syrup = laughin' syrup
+reagent-desc-laughin-syrup = The product of juicing Laughin' Peas. Fizzy, and seems to change flavour based on what it's used with!
 reagent-name-mayo = майонез
 reagent-desc-mayo = Жирный соус, приготовленный из масла, яиц, и какой-либо (пищевой) кислоты.
 reagent-name-mustard = горчица
diff --git a/Resources/Locale/ru-RU/reagents/meta/fun.ftl b/Resources/Locale/ru-RU/reagents/meta/fun.ftl
index 6f32baddaf9..21328ce427b 100644
--- a/Resources/Locale/ru-RU/reagents/meta/fun.ftl
+++ b/Resources/Locale/ru-RU/reagents/meta/fun.ftl
@@ -14,3 +14,5 @@ reagent-name-razorium = бритвиум
 reagent-desc-razorium = Странное неньютоновское химическое вещество. Оно образуется при смешивании двух противоречивых по природе лекарств от механических повреждения. Под влиянием силы оно временно затвердевает, образуя миллионы крохотных острых граней. Весьма болезненно.
 reagent-name-fresium = фризиум
 reagent-desc-fresium = Таинственное соединение, которое замедляет колебания атомов и молекул... каким-то образом. Проще говоря, оно делает вещи холодными... РЕАЛЬНО холодными. При попадании в организм респираторным путём может вызывать долговременные проблемы со способностью передвигаться.
+reagent-name-laughter = Laughter
+reagent-desc-laughter = Some say that this is the best medicine, but recent studies have proven that to be untrue.
diff --git a/Resources/Locale/ru-RU/reagents/meta/physical-desc.ftl b/Resources/Locale/ru-RU/reagents/meta/physical-desc.ftl
index 0dff1cdef83..62c077c0ef3 100644
--- a/Resources/Locale/ru-RU/reagents/meta/physical-desc.ftl
+++ b/Resources/Locale/ru-RU/reagents/meta/physical-desc.ftl
@@ -91,6 +91,7 @@ reagent-physical-desc-exhilarating = бодрящее
 reagent-physical-desc-vibrant = вибрирующее
 reagent-physical-desc-fluffy = пушистое
 reagent-physical-desc-reflective = светоотражающее
+reagent-physical-desc-funny = funny
 reagent-physical-desc-alkaline = щелочное
 reagent-physical-desc-holy = святое
 reagent-physical-desc-slimy = склизкое
diff --git a/Resources/Locale/ru-RU/research/technologies.ftl b/Resources/Locale/ru-RU/research/technologies.ftl
index 0a24ac925ae..ce4007ee92b 100644
--- a/Resources/Locale/ru-RU/research/technologies.ftl
+++ b/Resources/Locale/ru-RU/research/technologies.ftl
@@ -1,6 +1,5 @@
 research-discipline-none = Отсутствует
 research-discipline-industrial = Промышленность
-research-discipline-biochemical = Биохимия
 research-discipline-arsenal = Арсенал
 research-discipline-experimental = Экспериментальное
 research-discipline-civilian-services = Обслуживание персонала
@@ -19,17 +18,9 @@ research-technology-advanced-tools = Продвинутые инструмент
 research-technology-super-powercells = Супербатареи
 research-technology-bluespace-storage = Блюспейс-хранилище
 research-technology-portable-fission = Портативный распад
-research-technology-chemistry = Химия
-research-technology-surgical-tools = Хирургические инструменты
 research-technology-biochemical-stasis = Биохимический стазис
 research-technology-mechanized-treatment = Механизированная подготовка
-research-technology-virology = Вирусология
-research-technology-cryogenics = Криогеника
-research-technology-chemical-dispensary = Химический раздатчик
-research-technology-biofabrication = Биофабрикация
-research-technology-crew-monitoring = Мониторинг экипажа
 research-technology-bluespace-chemistry = Блюспейс-химия
-research-technology-cloning = Клонирование
 research-technology-salvage-weapons = Утилизаторское оружие
 research-technology-draconic-munitions = Драконьи боеприпасы
 research-technology-uranium-munitions = Урановые боеприпасы
diff --git a/Resources/Locale/ru-RU/seeds/seeds.ftl b/Resources/Locale/ru-RU/seeds/seeds.ftl
index 2d636a56487..606001e87e2 100644
--- a/Resources/Locale/ru-RU/seeds/seeds.ftl
+++ b/Resources/Locale/ru-RU/seeds/seeds.ftl
@@ -70,6 +70,8 @@ seeds-poppy-name = мак
 seeds-poppy-display-name = мак
 seeds-aloe-name = алоэ
 seeds-aloe-display-name = алоэ
+seeds-laughin-pea-name = laughin' peas
+seeds-laughin-pea-display-name = laughin' peas
 seeds-lingzhi-name = линчжи
 seeds-lingzhi-display-name = линчжи
 seeds-ambrosiavulgaris-name = амброзия вульгарис
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/body/organs/animal/animal.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/body/organs/animal/animal.ftl
index 1598eff90b4..de4ae028052 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/body/organs/animal/animal.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/body/organs/animal/animal.ftl
@@ -1,3 +1,5 @@
+ent-BaseAnimalOrganUnGibbable = { ent-BaseItem }
+    .desc = { ent-BaseItem.desc }
 ent-BaseAnimalOrgan = { ent-BaseItem }
     .desc = { ent-BaseItem.desc }
 ent-OrganAnimalLungs = лёгкие
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/body/organs/human.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/body/organs/human.ftl
index 0817d257e6d..b468650f4cf 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/body/organs/human.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/body/organs/human.ftl
@@ -1,3 +1,5 @@
+ent-BaseHumanOrganUnGibbable = { ent-BaseItem }
+    .desc = { ent-BaseItem.desc }
 ent-BaseHumanOrgan = { ent-BaseItem }
     .desc = { ent-BaseItem.desc }
 ent-OrganHumanBrain = мозг
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/catalog/fills/items/belt.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/catalog/fills/items/belt.ftl
index 2dca17af9f2..290115c1721 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/catalog/fills/items/belt.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/catalog/fills/items/belt.ftl
@@ -16,9 +16,9 @@ ent-ClothingBeltJanitorFilled = { ent-ClothingBeltJanitor }
 ent-ClothingBeltMedicalFilled = { ent-ClothingBeltMedical }
     .suffix = Заполненный
     .desc = { ent-ClothingBeltMedical.desc }
-ent-ClothingBeltParamedicFilled = пояс парамедика
-    .suffix = Заполненный, Парамедик
-    .desc = { ent-ClothingBeltMedical.desc }
+ent-ClothingBeltMedicalEMTFilled = { ent-ClothingBeltMedicalEMT }
+    .suffix = Paramedic,Filled
+    .desc = { ent-ClothingBeltMedicalEMT.desc }
 ent-ClothingBeltPlantFilled = { ent-ClothingBeltPlant }
     .suffix = Заполненный
     .desc = { ent-ClothingBeltPlant.desc }
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/catalog/fills/lockers/heads.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/catalog/fills/lockers/heads.ftl
index 09d75c0fc3a..218704b1b5e 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/catalog/fills/lockers/heads.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/catalog/fills/lockers/heads.ftl
@@ -7,6 +7,9 @@ ent-LockerCaptainFilledHardsuit = { ent-LockerCaptain }
 ent-LockerCaptainFilled = { ent-LockerCaptain }
     .suffix = Заполненный
     .desc = { ent-LockerCaptain.desc }
+ent-LockerCaptainFilledNoLaser = { ent-LockerCaptain }
+    .suffix = Filled
+    .desc = { ent-LockerCaptain.desc }
 ent-LockerHeadOfPersonnelFilled = { ent-LockerHeadOfPersonnel }
     .suffix = Заполненный
     .desc = { ent-LockerHeadOfPersonnel.desc }
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/corvax/catalog/fills/paper/document.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/corvax/catalog/fills/paper/document.ftl
index cd008e4f09a..566853062bc 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/corvax/catalog/fills/paper/document.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/corvax/catalog/fills/paper/document.ftl
@@ -57,7 +57,7 @@ ent-PrintedDocumentRequestModernization = Запрос на проведение
 ent-PrintedDocumentComplaintViolationLaborRules = Жалоба на нарушение трудового порядка
     .desc = { ent-PrintedDocument.desc }
 ent-PrintedDocumentComplaintOffense = Жалоба на правонарушение
-  .desc = { ent-PrintedDocument.desc }
+    .desc = { ent-PrintedDocument.desc }
 ent-PrintedDocumentPermissionEquipment = Разрешение на использование снаряжения
     .desc = { ent-PrintedDocument.desc }
 ent-PrintedDocumentPermissionToTravelInCaseOfThreat = Разрешение на передвижение при угрозе
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/belt/belts.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/belt/belts.ftl
index dba0ef53353..61c3d20146e 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/belt/belts.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/belt/belts.ftl
@@ -8,6 +8,8 @@ ent-ClothingBeltJanitor = пояс уборщика
     .desc = Пояс, используемый для хранения основных уборочных принадлежностей.
 ent-ClothingBeltMedical = пояс медика
     .desc = Может вмещать различное медицинское снаряжение.
+ent-ClothingBeltMedicalEMT = EMT belt
+    .desc = Perfect for holding various equipment for medical emergencies.
 ent-ClothingBeltPlant = пояс ботаника
     .desc = Пояс, используемый для хранения основных принадлежностей для гидропоники. На удивление, не зелёный.
 ent-ClothingBeltChef = пояс повара
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/head/bandanas.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/head/bandanas.ftl
index b1e7bd415cc..49d07b40fd4 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/head/bandanas.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/head/bandanas.ftl
@@ -1,3 +1,5 @@
+ent-ClothingHeadBandBase = { ent-ClothingHeadBaseButcherable }
+  .desc = { ent-ClothingHeadBaseButcherable.desc }
 ent-ClothingHeadBandBlack = чёрная бандана
     .desc = Чёрная бандана, чтобы выглядеть круто.
 ent-ClothingHeadBandBlue = синяя бандана
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/head/hats.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/head/hats.ftl
index ee76e248c82..4403597c43a 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/head/hats.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/head/hats.ftl
@@ -10,6 +10,8 @@ ent-ClothingHeadHatBeretRND = берет учёного
     .desc = Берет для настоящих учёных.
 ent-ClothingHeadHatBeretEngineering = берет инженера
     .desc = Берет с эмблемой инженерного отдела. Для инженеров, которые предпочитают стиль безопасности.
+ent-ClothingHeadHatBeretQM = quartermaster's beret
+    .desc = A beret with the cargo's insignia emblazoned on it. For quartermasters that are more inclined towards style.
 ent-ClothingHeadHatBeretHoS = берет главы службы безопасности
     .desc = Черный берет с вышитой командирской эмблемой. Для офицеров, которые предпочитают стиль безопасности.
 ent-ClothingHeadHatBeretWarden = берет смотрителя
@@ -150,3 +152,5 @@ ent-ClothingHeadHatCowboyWhite = белая ковбойская шляпа
     .desc = { ent-ClothingHeadHatCowboyBrown.desc }
 ent-ClothingHeadHatCowboyBountyHunter = ковбойская шляпа охотника за головами
     .desc = { ent-ClothingHeadHatCowboyBrown.desc }
+ent-ClothingHeadHatStrawHat = straw hat
+    .desc = A fancy hat for hot days! Not recommended to wear near fires.
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/head/soft.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/head/soft.ftl
index b9df2d90a60..f1f15544cc9 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/head/soft.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/head/soft.ftl
@@ -1,3 +1,8 @@
+ent-ClothingHeadHeadHatBaseFlippable = { ent-ClothingHeadBaseButcherable }
+  .desc = { ent-ClothingHeadBaseButcherable.desc }
+ent-ClothingHeadHeadHatBaseFlipped = { ent-ClothingHeadHeadHatBaseFlippable }
+    .suffix = flipped
+    .desc = { ent-ClothingHeadHeadHatBaseFlippable.desc }
 ent-ClothingHeadHatBluesoft = синяя кепка
     .desc = Бейсболка безвкусного синего цвета.
 ent-ClothingHeadHatBluesoftFlipped = перевёрнутая синяя кепка
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/masks/bandanas.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/masks/bandanas.ftl
new file mode 100644
index 00000000000..2cfa21964a3
--- /dev/null
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/masks/bandanas.ftl
@@ -0,0 +1,22 @@
+ent-ClothingMaskBandanaBase = { ent-ClothingMaskBaseButcherable }
+  .desc = { ent-ClothingMaskBaseButcherable.desc }
+ent-ClothingMaskBandBlack = black bandana
+    .desc = A black bandana to make you look cool.
+ent-ClothingMaskBandBlue = blue bandana
+    .desc = A blue bandana to make you look cool.
+ent-ClothingMaskBandBotany = botany bandana
+    .desc = A botany bandana to make you look cool, made from natural fibers.
+ent-ClothingMaskBandGold = gold bandana
+    .desc = A gold bandana to make you look cool.
+ent-ClothingMaskBandGreen = green bandana
+    .desc = A green bandana to make you look cool.
+ent-ClothingMaskBandGrey = grey bandana
+    .desc = A grey bandana to make you look cool.
+ent-ClothingMaskBandRed = red bandana
+    .desc = A red bandana to make you look cool.
+ent-ClothingMaskBandSkull = skull bandana
+    .desc = A bandana with a skull to make you look even cooler.
+ent-ClothingMaskBandMerc = mercenary bandana
+    .desc = To protect the head from the sun, insects and other dangers of the higher path.
+ent-ClothingMaskBandBrown = brown bandana
+    .desc = A brown bandana to make you look cool.
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/masks/base_clothingmask.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/masks/base_clothingmask.ftl
index ce6cff6a8f4..ab48ec06d32 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/masks/base_clothingmask.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/masks/base_clothingmask.ftl
@@ -4,3 +4,5 @@ ent-ClothingMaskPullableBase = { ent-ClothingMaskBase }
     .desc = { ent-ClothingMaskBase.desc }
 ent-ActionToggleMask = Поменять положение маски
     .desc = Удобно, но не позволяет вставить пирог в ваше отверстие для пирога.
+ent-ClothingMaskBaseButcherable = { ent-ClothingMaskBase }
+    .desc = { ent-ClothingMaskBase.desc }
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/uniforms/jumpsuits.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/uniforms/jumpsuits.ftl
index 316e55ea08c..27f20fcaa0d 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/uniforms/jumpsuits.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/clothing/uniforms/jumpsuits.ftl
@@ -84,6 +84,8 @@ ent-ClothingUniformJumpsuitQM = комбинезон квартирмейсте
     .desc = Что Браун может сделать для вас?
 ent-ClothingUniformJumpsuitQMTurtleneck = водолазка квартирмейстера
     .desc = Строгая водолазка, предназначенная для суровых условий работы в области снабжения.
+ent-ClothingUniformJumpsuitQMFormal = quartermasters's formal suit
+    .desc = Inspired by the quartermasters of military's past, the perfect outfit for supplying a formal occasion.
 ent-ClothingUniformJumpsuitResearchDirector = водолазка научного руководителя
     .desc = Это водолазка, носимая достаточно умными людьми, чтобы достичь должности научного руководителя. Её ткань обеспечивает слабую биологическую защиту.
 ent-ClothingUniformJumpsuitScientist = комбинезон учёного
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks-cartons.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks-cartons.ftl
index 852edfad7e1..fc3b3714645 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks-cartons.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks-cartons.ftl
@@ -1,5 +1,7 @@
 ent-DrinkCartonBaseFull = { ent-DrinkBase }
     .desc = { ent-DrinkBase.desc }
+ent-DrinkCartonVisualsOpenable = { "" }
+    .desc = { "" }
 ent-DrinkJuiceLimeCarton = лаймовый сок
     .desc = Кисло-сладкое удовольствие.
 ent-DrinkJuiceOrangeCarton = апельсиновый сок
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks.ftl
index f73a6e76f63..fdd2ef30b66 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks.ftl
@@ -8,240 +8,356 @@ ent-DrinkGlassCoupeShaped = бокал-купе
     .desc = Классический бокал-купе с тонкой ножкой, символ этикеток "не кантовать" на ящиках по всей галактике.
 ent-DrinkAbsintheGlass = бокал абсента
     .desc = Полынь, анис, о мой Бог.
+    .suffix = absinthe
 ent-DrinkAcidSpitGlass = бокал кислотного плевка
     .desc = Напиток из архивов компании. Изготовлен из живых инопланетян.
+    .suffix = acid spit
 ent-DrinkAleGlass = стакан эля
     .desc = Пинта отличного холодного эля.
+    .suffix = ale
 ent-DrinkAlliesCocktail = коктейль Союзники
     .desc = Напиток из ваших союзников.
+    .suffix = allies cocktail
 ent-DrinkAloe = бокал алоэ
     .desc = Очень, очень, очень хорошо.
+    .suffix = aloe
 ent-DrinkAmasecGlass = кружка амасека
     .desc = Всегда отлично перед БОЕМ!!!
+    .suffix = amasec
 ent-DrinkAndalusia = бокал андалусии
     .desc = Хороший напиток со странным названием.
+    .suffix = andalusia
 ent-DrinkAntifreeze = стакан антифриза
     .desc = Непревзойденная свежесть.
+    .suffix = antifreeze
 ent-DrinkAtomicBombGlass = бокал атомной бомбы
     .desc = Мы не сможем взять на себя ответственность за ваши действия после употребления.
+    .suffix = atomic bomb
 ent-DrinkB52Glass = стакан B-52
     .desc = Кофе, айриш крим и коньяк. Просто бомба.
+    .suffix = b-52
 ent-DrinkBahamaMama = бокал багама-мама
     .desc = Тропический коктейль.
+    .suffix = bahama mama
 ent-DrinkBananaHonkGlass = стакан банана-хонка
     .desc = Напиток из Бананового Рая.
+    .suffix = banana honk
 ent-DrinkBarefootGlass = бокал домохозяйки
     .desc = Дети, кухня, церковь.
+    .suffix = barefoot
 ent-DrinkBeepskySmashGlass = бокал удара бипски
     .desc = Тяжелый, пылкий и сильный. Прямо как железный кулак ЗАКОНА.
+    .suffix = beepsky smash
 ent-DrinkBeerglass = стакан пива
     .desc = Пинта холодного пива.
+    .suffix = beer
 ent-DrinkBerryJuice = ягодный сок
     .desc = Ягодный сок. А может компот. Какая разница?
+    .suffix = berry juice
 ent-DrinkBlackRussianGlass = бокал чёрного русского
     .desc = Для людей с непереносимостью лактозы. Так же прекрасен, как и белый русский.
+    .suffix = black russian
 ent-DrinkBlueCuracaoGlass = голубой кюрасао
     .desc = Экзотично-голубой фруктовый напиток, дистиллированный из апельсинов.
+    .suffix = blue curacao
 ent-DrinkBloodyMaryGlass = бокал кровавой Мэри
     .desc = Томатный сок, смешанный с водкой и капелькой лайма. На вкус как жидкое убийство.
+    .suffix = bloody mary
 ent-DrinkBooger = козявка
     .desc = Фууу...
+    .suffix = booger
 ent-DrinkBraveBullGlass = бокал храброго быка
     .desc = Текилла и кофейный ликер, объединенные в аппетитный микс. Выпьем.
+    .suffix = brave bull
 ent-DrinkCarrotJuice = морковный сок
     .desc = Как морковь, но не хрустит.
+    .suffix = carrot juice
 ent-DrinkChocolateGlass = горячий шоколад
     .desc = Горячий напиток, состоящий из растопленного шоколада и подогретого молока.
+    .suffix = chocolate
 ent-DrinkCoffee = кофе
     .desc = Не уроните, иначе повсюду будут обжигающая жидкость и осколки стекла.
+    .suffix = coffee
 ent-DrinkCognacGlass = бокал коньяка
     .desc = Черт возьми, вы чувствуете себя французским аристократом, просто держа это в руках.
+    .suffix = cognac
 ent-DrinkCream = сливки
     .desc = Фууу...
+    .suffix = cream
 ent-DrinkCubaLibreGlass = бокал куба-либре
     .desc = Классическая смесь рома с колой.
+    .suffix = cuba libre
 ent-DrinkDeadRumGlass = стакан мёртвого рома
     .desc = Популярен среди моряков. Не очень популярен среди всех остальных.
+    .suffix = dead rum
 ent-DrinkDemonsBlood = кровь демона
     .desc = От одного взгляда на это волосы на затылке встают дыбом.
+    .suffix = demon's blood
 ent-DrinkDevilsKiss = поцелуй дьявола
     .desc = Жуткое время!
+    .suffix = devil's kiss
 ent-DrinkDoctorsDelightGlass = радость доктора
     .desc = Целебная микстура из соков, гарантированно сохранит ваше здоровье до следующего избиения ящиком для инструментов.
+    .suffix = doctor's delight
 ent-DrinkDriestMartiniGlass = бокал самого сухого мартини
     .desc = Только для опытных. Вы уверены, что видите плавающие в бокале песчинки.
+    .suffix = driest martini
 ent-DrinkDrGibbGlass = стакан доктора Гибба
     .desc = Доктор Гибб. Не так опасен, как кажется из названия.
+    .suffix = dr gibb
 ent-DrinkErikaSurprise = сюрприз Эрики
     .desc = Сюрприз в том, что он зеленый!
+    .suffix = erika surprise
 ent-DrinkFourteenLokoGlass = стакан Фоуртин Локо
     .desc = Это емкость с напитком "Фоуртин Локо", который выглядит просто отлично. Напиток, а не емкость.
+    .suffix = fourteen loko
 ent-DrinkGargleBlasterGlass = пангалактический грызлодёр
     .desc = Значит ли... значит ли это, что Артур и Форд на корабле? О, счастье.
+    .suffix = pan-galactic gargle blaster
 ent-DrinkGinGlass = джин
     .desc = Кристально чистый джин Гриффитер.
+    .suffix = gin
 ent-DrinkGinFizzGlass = стакан шипучего джина
     .desc = Освежающе лимонный, восхитительно сухой.
+    .suffix = gin fizz
 ent-DrinkGinTonicglass = джин-тоник
     .desc = Мягкий, но все же отличный коктейль. Пейте, как истинный англичанин.
+    .suffix = gin and tonic
 ent-DrinkGildlagerGlass = бокал гильдлагера
     .desc = 50-градусное доказательство того, что девочки-подростки будут пить всё, в чём есть золото.
+    .suffix = gildlager
 ent-DrinkGrapeJuice = виноградный сок
     .desc = Это виногрррад!
+    .suffix = grape juice
 ent-DrinkGrapeSodaGlass = стакан виноградной газировки
     .desc = Выглядит как восхитительный напиток!
+    .suffix = grape soda
 ent-DrinkGreenTeaGlass = стакан зелёного чая
     .desc = Вкусный зелёный чай. В нем есть антиоксиданты, этим он полезен для вас!
+    .suffix = green tea
 ent-DrinkGrenadineGlass = бокал сиропа гренадин
     .desc = Сладкий и терпкий, барный сироп, используемый для придания цвета или вкуса напиткам.
+    .suffix = grenadine
 ent-DrinkGrogGlass = кружка грога
     .desc = Прекрасный напиток для Космоса.
+    .suffix = grog
 ent-DrinkHippiesDelightGlass = бокал радости хиппи
     .desc = Напиток, которым наслаждались люди в 1960-е годы.
+    .suffix = hippies' delight
 ent-DrinkHoochGlass = суррогат
     .desc = Вы действительно достигли дна... Ваша печень собрала свои вещи и ушла вчера ночью.
+    .suffix = hooch
 ent-DrinkIcedCoffeeGlass = стакан айс-кофе
     .desc = Напиток, который и взбодрит и освежит вас!
+    .suffix = iced coffee
 ent-DrinkIcedGreenTeaGlass = стакан зелёного чая со льдом
     .desc = Напоминает холодный зелёный чай. Я бы даже сказал это он и есть.
+    .suffix = iced green tea
 ent-DrinkIcedTeaGlass = стакан чая со льдом
     .desc = Освежающий южный напиток.
+    .suffix = iced tea
 ent-DrinkIcedBeerGlass = стакан пива со льдом
     .desc = Пиво настолько морозное, что воздух вокруг него замерзает.
+    .suffix = iced beer
 ent-DrinkIceGlass = стакан льда
     .desc = По идее, вы должны добавить туда и что-то еще...
+    .suffix = ice
 ent-DrinkIceCreamGlass = вазочка мороженого
     .desc = Вазочка, наполненная старым добрым мороженым. Может понадобиться ложка.
+    .suffix = ice cream
 ent-DrinkIrishCarBomb = ирландская автомобильная бомба
     .desc = Ирландская автомобильная бомба.
+    .suffix = irish car bomb
 ent-DrinkIrishCoffeeGlass = бокал ирландского кофе
     .desc = Кофе и алкоголь. Лучше, чем пить Мимозу по утрам.
+    .suffix = irish coffee
 ent-DrinkIrishCreamGlass = бокал ирландских сливок
     .desc = Сливки с добавлением виски. Что еще можно ожидать от ирландцев.
+    .suffix = irish cream
 ent-DrinkCoffeeLiqueurGlass = бокал кофейного ликёра
     .desc = ЧЁРТ, ЭТА ШТУКА ВЫГЛЯДИТ КРЕПКОЙ
+    .suffix = coffee liqueur
 ent-DrinkKiraSpecial = коктейль кира специальный
     .desc = Да здравствует парень, которого все принимали за девушку. Бака!
+    .suffix = kira special
 ent-DrinkLemonadeGlass = стакан лимонада
     .desc = Ох уж эта ностальгия...
+    .suffix = lemonade
 ent-DrinkLemonJuice = лимонный сок
     .desc = Кислый...
+    .suffix = lemon juice
 ent-DrinkLemonLime = лимон-лайм
     .desc = Терпкий напиток, состоящий на 0.5% из настоящих цитрусовых!
+    .suffix = lemon lime
 ent-DrinkLimeJuice = лаймовый сок
     .desc = Это кисло-сладкий лаймовый сок.
+    .suffix = lime juice
 ent-DrinkLongIslandIcedTeaGlass = стакан лонг-айленд айс ти
     .desc = Винный шкаф, собранный в вкусную смесь. Предназначен только для женщин-алкоголиков среднего возраста.
+    .suffix = long island iced tea
 ent-DrinkManhattanGlass = бокал манхэттена
     .desc = Любимый напиток Детектива под прикрытием. Он никогда не переносил джин...
+    .suffix = manhattan
 ent-DrinkManhattanProjectGlass = бокал манхэттенского проекта
     .desc = Напиток для учёных, размышляющих о том, как взорвать станцию.
+    .suffix = manhattan project
 ent-DrinkManlyDorfGlass = кружка мужественного дворфа
     .desc = Мужественная смесь из эля и пива. Только для настоящих мужчин.
+    .suffix = manly dorf
 ent-DrinkMargaritaGlass = бокал маргариты
     .desc = На каёмке лайм с солью. Аррива~!
+    .suffix = margarita
 ent-DrinkMartiniGlass = бокал классического мартини
     .desc = Чёрт, бармен размешал его, а не взболтал.
+    .suffix = classic martini
 ent-DrinkMeadGlass = кружка медовухи
     .desc = Напиток викингов, хоть и дешевый.
+    .suffix = mead
 ent-DrinkMilkshake = молочный коктейль
     .desc = Великолепная леденящая мозг смесь.
+    .suffix = milkshake
 ent-DrinkMojito = мохито
     .desc = Свежесть из Космической Кубы.
+    .suffix = mojito
 ent-DrinkNeurotoxinGlass = стакан нейротоксина
     .desc = Напиток, который гарантированно сведет вас с ума.
+    .suffix = neurotoxin
 ent-DrinkNothing = ничего
     .desc = Абсолютно ничего.
+    .suffix = nothing
 ent-DrinkNTCahors = нытьёлогический кагор
     .desc = Напиток неотеологов. Похоже на обычное вино, но темнее.
+    .suffix = neotheology cahors whine
 ent-DrinkNuclearColaGlass = бокал ядерной колы
     .desc = Не плачь, Не поднимай глаз, Это всего лишь ядерная пустошь.
+    .suffix = nuclear cola
 ent-DrinkOrangeJuice = апельсиновый сок
     .desc = Витамины! Ура!
+    .suffix = orange juice
 ent-DrinkPatronGlass = бокал покровителя
     .desc = Пейте покровителя в баре вместе со всеми малокультурными дамами.
+    .suffix = patron
 ent-DrinkPoisonBerryJuice = ядовитый ягодный сок
     .desc = Выглядит как убийственный сок.
+    .suffix = poison berry juice
 ent-DrinkPoisonWineGlass = бокал ядовитого вина
     .desc = Черный гной с маслянистой пурпурной пленкой сверху. Вы уверены, что это стоит пить?
+    .suffix = poison wine
 ent-DrinkPoscaGlass = стакан поски
     .desc = Напиток бедных воинов из забытой эпохи.
+    .suffix = posca
 ent-DrinkRedMeadGlass = кружка красной медовухи
     .desc = Настоящий напиток викингов, хотя цвет у него странный.
+    .suffix = red mead
 ent-DrinkRewriter = переписчик
     .desc = Тайна святилища Библиотекаря...
+    .suffix = rewriter
 ent-DrinkRootBeerGlass = стакан рутбира
     .desc = Шипучий, пенистый, и полный сладости, без кофеина.
+    .suffix = root beer
 ent-DrinkRootBeerFloatGlass = рутбир с мороженым
     .desc = Шипучий, пенистый, а теперь еще и с мороженым сверху! Потрясающе!
+    .suffix = root beer float
 ent-DrinkRumGlass = стакан рома
     .desc = Теперь вы хотите вымолить пиратский костюм, не так ли?
+    .suffix = rum
 ent-DrinkSakeGlass = бокал саке
     .desc = Вино из риса, а иначе саке!
+    .suffix = sake
 ent-DrinkSbitenGlass = бокал сбитня
     .desc = Пряная смесь водки и специй. Очень жгучая.
+    .suffix = sbiten
 ent-DrinkScrewdriverCocktailGlass = стакан отвёртки
     .desc = Простая, но превосходная смесь водки и апельсинового сока. То, что нужно для уставшего инженера.
+    .suffix = screwdriver
 ent-DrinkCogChampBase = бокал когчамп
     .desc = Эта смесь коньяка, отвёртки и сварочного топлива точно заставит вас увидеть Его свет!
+    .suffix = cogchamp
 ent-DrinkSuiDreamGlass = бокал мечты суи
     .desc = Сладкая, пенистая фруктовая смесь. Осознание названия вызывает только стыд.
+    .suffix = sui dream
 ent-DrinkEmeraldGlass = арбузный ликер
     .desc = Относительно сладкий, фруктовый ликер крепостью 46 градусов.
+    .suffix = melon liquor
 ent-DrinkMoonshineGlass = самогон
     .desc = Вы действительно достигли дна... Ваша печень собрала свои вещи и ушла вчера ночью.
+    .suffix = moonshine
 ent-DrinkGlassWhite = молоко
     .desc = Белая и питательная вкуснятина!
+    .suffix = milk
 ent-DrinkSilencerGlass = бокал глушителя
     .desc = Напиток из рая мимов.
+    .suffix = silencer
 ent-DrinkSingulo = сингуло
     .desc = Блю-спейс напиток!
+    .suffix = singulo
 ent-DrinkSnowWhite = белый снег
     .desc = Морозная свежесть.
+    .suffix = snow white
 ent-DrinkSoyLatte = соевый латте
     .desc = Приятный и освежающий напиток на время чтения.
+    .suffix = soy latte
 ent-DrinkSpaceUpGlass = стакан спейс-ап
     .desc = Спейс-ап. Помогает сохранять хладнокровие.
+    .suffix = space-up
 ent-DrinkSpaceMountainWindGlass = стакан космического маунтин винда
     .desc = Космический горный ветер. Как вы знаете, в космосе нет гор, есть только ветер.
+    .suffix = space mountain wind
 ent-DrinkSyndicatebomb = бомба синдиката
     .desc = На вкус как терроризм!
+    .suffix = syndicate bomb
 ent-DrinkTeaGlass = стакан чая
     .desc = Вкусный черный чай. В нем есть антиоксиданты; этим он полезен для вас!
+    .suffix = tea
 ent-DrinkTeapot = чайник
     .desc = Элегантный заварочный чайник. Он излучает теплоту.
 ent-DrinkTequilaGlass = бокал текилы
     .desc = Не хватает только странных цветных оттенков!
+    .suffix = tequila
 ent-DrinkTequilaSunriseGlass = бокал текилы санрайз
     .desc = Ну класс, теперь вы испытываете ностальгию по восходам солнца на Терре...
+    .suffix = tequila sunrise
 ent-DrinkThreeMileIslandGlass = бокал три-майл-айленд
     .desc = Стакан этого напитка может предотвратить расплавление ядерного реактора.
+    .suffix = three mile island
 ent-DrinkTomatoJuice = томатный сок
     .desc = Вы уверены, что это томатный сок?
+    .suffix = tomato juice
 ent-DrinkToxinsSpecialGlass = бокал особых токсинов
     .desc = Ух ты, эта штука ГОРИТ!
+    .suffix = toxins special
 ent-DrinkVermouthGlass = бокал вермута
     .desc = Вы удивляетесь, почему вы вообще пьете этот напиток в чистом виде.
+    .suffix = vermouth
 ent-DrinkVodkaGlass = стакан водки
     .desc = Напиток и топливо номер один для Русских во всей галактике.
+    .suffix = vodka
 ent-DrinkVodkaMartiniGlass = бокал водки мартини
     .desc = Извращение над классическим мартини. Но всё так же великолепно.
+    .suffix = vodka martini
 ent-DrinkVodkaTonicGlass = бокал водки тоника
     .desc = Для тех случаев, когда джин-тоник недостаточно русский.
+    .suffix = vodka tonic
 ent-DrinkWaterJug = кувшин воды
     .desc = Не забывайте пить воду.
 ent-DrinkWatermelonJuice = арбузный сок
     .desc = Вкусный арбузный сок.
+    .suffix = watermelon juice
 ent-DrinkWhiskeyColaGlass = бокал виски колы
     .desc = Невинная на вид смесь колы и виски. Вкусная.
+    .suffix = whiskey cola
 ent-DrinkWhiskeyGlass = бокал виски
     .desc = Мягкая, дымчатая сладость виски делает напиток очень элегантным.
+    .suffix = whiskey
 ent-DrinkWhiskeySodaGlass = бокал виски с содовой
     .desc = Абсолютная свежесть.
+    .suffix = whiskey soda
 ent-DrinkWhiteRussianGlass = бокал белого русского
     .desc = Очень хороший на вид напиток. Но это только твоё мнение, чувак.
+    .suffix = white russian
 ent-DrinkWineGlass = бокал вина
     .desc = Очень изысканный напиток.
+    .suffix = wine
 ent-DrinkShakeBlue = голубой молочный коктейль
     .desc = { ent-DrinkGlassBase.desc }
 ent-DrinkShakeEmpty = пустой бокал коктейля
@@ -258,5 +374,7 @@ ent-DrinkHellRamen = чашка адского рамэна
     .desc = Просто добавьте 10 мл кипятка! Супер острый вкус.
 ent-DrinkTheMartinez = бокал Мартинес
     .desc = Легенда среди киберпанков. Вспоминается по напитку, забывается по пьяни.
+    .suffix = The Martinez
 ent-DrinkBloodGlass = бокал крови
     .desc = Пей как вампир!
+    .suffix = blood
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks_bottles.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks_bottles.ftl
index 74249396465..81b824f94ce 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks_bottles.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/drinks/drinks_bottles.ftl
@@ -2,6 +2,10 @@ ent-DrinkBottlePlasticBaseFull = { ent-DrinkBase }
     .desc = { ent-DrinkBase.desc }
 ent-DrinkBottleGlassBaseFull = { ent-DrinkBottlePlasticBaseFull }
     .desc = { ent-DrinkBottlePlasticBaseFull.desc }
+ent-DrinkBottleVisualsOpenable = { "" }
+    .desc = { "" }
+ent-DrinkBottleVisualsAll = { "" }
+    .desc = { "" }
 ent-DrinkAbsintheBottleFull = Джейлбрейк Верте
     .desc = Всего один глоток этого напитка, и вы сразу понимаете, что хорошо проведете время.
 ent-DrinkBlueCuracaoBottleFull = Кюрасао Мисс Синева
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/food/baked/donkpocket.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/food/baked/donkpocket.ftl
index 14a4278e4c5..f7aef27f15e 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/food/baked/donkpocket.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/food/baked/donkpocket.ftl
@@ -28,5 +28,13 @@ ent-FoodDonkpocketBerry = ягодный покет
     .desc = Бескомпромиссно сладкий донк-покет. На 100% состоит из искусственных ароматизаторов.
 ent-FoodDonkpocketBerryWarm = теплый ягодный покет
     .desc = Бескомпромиссно сладкий донк-покет, теперь горячий и аппетитный.
+ent-FoodDonkpocketStonk = stonk-pocket
+    .desc = Tasty, but a sad reminder of the great crash of '24
+ent-FoodDonkpocketStonkWarm = warm stonk-pocket
+    .desc = { ent-FoodDonkpocketStonk.desc }
+ent-FoodDonkpocketCarp = carp-pocket
+    .desc = A long-lost edition of donk pocket, made specifically for hard-working salvagers.
+ent-FoodDonkpocketCarpWarm = warm carp-pocket
+    .desc = { ent-FoodDonkpocketCarp.desc }
 ent-FoodDonkpocketDink = динк-покет
     .desc = Малоизвестный донк-покет для ящеров, с начинкой из маринованной моркови и обернутый морскими водорослями. Рекомендуется употреблять холодным, а еще лучше вообще не есть.
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/food/containers/box.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/food/containers/box.ftl
index 06133eb06a4..85f7a0bbe35 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/food/containers/box.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/food/containers/box.ftl
@@ -20,6 +20,10 @@ ent-FoodBoxDonkpocketTeriyaki = коробка донк-покетов со вк
     .desc = { ent-FoodBoxDonkpocket.desc }
 ent-FoodBoxDonkpocketPizza = коробка донк-покетов со вкусом пиццы
     .desc = { ent-FoodBoxDonkpocket.desc }
+ent-FoodBoxDonkpocketStonk = box of limited edition stonk-pockets
+    .desc = { ent-FoodBoxDonkpocket.desc }
+ent-FoodBoxDonkpocketCarp = box of carp-pockets
+    .desc = { ent-FoodBoxDonkpocket.desc }
 ent-FoodBoxDonkpocketBerry = коробка донк-покетов со вкусом ягод
     .desc = { ent-FoodBoxDonkpocket.desc }
 ent-FoodBoxDonkpocketHonk = коробка донк-покетов со вкусом банана
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/food/produce.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/food/produce.ftl
index eae712203ef..3bc88b8a951 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/food/produce.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/consumable/food/produce.ftl
@@ -8,6 +8,8 @@ ent-OatBushel = сноп овса
     .desc = Ешьте овсянку, делайте зарядку.
 ent-Sugarcane = сахарный тростник
     .desc = Болезненно-сладкий.
+ent-FoodLaughinPeaPod = laughin' pea pod
+    .desc = The clown's favorite plant.
 ent-Log = бревно
     .desc = Такое заметишь и в своём глазу.
 ent-SteelLog = бревно сталешляпника
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/devices/station_beacon.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/devices/station_beacon.ftl
index 37aec2c9251..80ff69eacc2 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/devices/station_beacon.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/devices/station_beacon.ftl
@@ -195,3 +195,6 @@ ent-DefaultStationBeaconDisposals = { ent-DefaultStationBeacon }
 ent-DefaultStationBeaconCryosleep = { ent-DefaultStationBeacon }
     .suffix = Криосон
     .desc = { ent-DefaultStationBeacon.desc }
+ent-DefaultStationBeaconEscapePod = { ent-DefaultStationBeacon }
+    .suffix = Escape Pod
+    .desc = { ent-DefaultStationBeacon.desc }
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/misc/paper.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/misc/paper.ftl
index 27b18b6b5fd..ef5dc32ada6 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/misc/paper.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/misc/paper.ftl
@@ -23,6 +23,8 @@ ent-NukeCodePaperStation = { ent-NukeCodePaper }
     .desc = { ent-NukeCodePaper.desc }
 ent-Pen = ручка
     .desc = Ручка с чёрными чернилами.
+ent-PenEmbeddable = { ent-Pen }
+    .desc = { ent-Pen.desc }
 ent-LuxuryPen = роскошная ручка
     .desc = Дорогая и модная ручка, которой вы достойны обладать только в том случае, если вы умеете работать с огромным количеством бумаг.
 ent-CyberPen = ручка Cybersun
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/misc/tiles.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/misc/tiles.ftl
index b44f394478c..a1cfdde7d1b 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/misc/tiles.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/misc/tiles.ftl
@@ -86,6 +86,10 @@ ent-FloorTileItemShuttlePurple = фиолетовый пол шаттла
     .desc = { ent-FloorTileItemBase.desc }
 ent-FloorTileItemShuttleRed = красный пол шаттла
     .desc = { ent-FloorTileItemBase.desc }
+ent-FloorTileItemShuttleGrey = grey shuttle floor
+    .desc = { ent-FloorTileItemBase.desc }
+ent-FloorTileItemShuttleBlack = black shuttle floor
+    .desc = { ent-FloorTileItemBase.desc }
 ent-FloorTileItemGold = золотая плитка
     .desc = { ent-FloorTileItemBase.desc }
 ent-FloorTileItemSilver = серебряная плитка
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/specific/hydroponics/seeds.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/specific/hydroponics/seeds.ftl
index 4577fb161df..21fcb8079d7 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/specific/hydroponics/seeds.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/specific/hydroponics/seeds.ftl
@@ -14,6 +14,8 @@ ent-CabbageSeeds = пакет семян (капуста)
     .desc = { ent-SeedBase.desc }
 ent-GarlicSeeds = пакет семян (чеснок)
     .desc = { ent-SeedBase.desc }
+ent-LaughinPeaSeeds = packet of laughin' pea pods
+    .desc = These seeds give off a very soft purple glow.. they should grow into Laughin' Peas.
 ent-LemonSeeds = пакет семян (лимон)
     .desc = { ent-SeedBase.desc }
 ent-LemoonSeeds = пакет семян (лилун)
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/specific/medical/healing.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/specific/medical/healing.ftl
index 2b3b7107a99..0a9d4e65a1a 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/specific/medical/healing.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/specific/medical/healing.ftl
@@ -32,6 +32,8 @@ ent-Bloodpack = пакет крови
 ent-Bloodpack10Lingering = { ent-Bloodpack }
     .suffix = 10, Не исчезают закончившись
     .desc = { ent-Bloodpack.desc }
+ent-Tourniquet = tourniquet
+    .desc = Stops bleeding! Hopefully.
 ent-Gauze = марлевый бинт
     .desc = Несколько стерильных марлевых полосок для оборачивания кровоточащих культей.
     .suffix = Полный
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/specific/robotics/borg_modules.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/specific/robotics/borg_modules.ftl
index 27b296be501..68190c29930 100644
--- a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/specific/robotics/borg_modules.ftl
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/objects/specific/robotics/borg_modules.ftl
@@ -36,8 +36,6 @@ ent-BorgModuleGrapplingGun = крюк-пушечный модуль киборг
     .desc = { ent-BaseBorgModule.desc }
 ent-BorgModuleAdvancedTool = продвинутый инструментальный модуль киборга
     .desc = { ent-BaseBorgModule.desc }
-ent-BorgModuleGasAnalyzer = газоанализаторный модуль киборга
-    .desc = { ent-BaseBorgModule.desc }
 ent-BorgModuleConstruction = строительный модуль киборга
     .desc = { ent-BaseBorgModule.desc }
 ent-BorgModuleRCD = РСУ-модуль киборга
diff --git a/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/structures/storage/glass_box.ftl b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/structures/storage/glass_box.ftl
new file mode 100644
index 00000000000..07bdcf53988
--- /dev/null
+++ b/Resources/Locale/ru-RU/ss14-ru/prototypes/entities/structures/storage/glass_box.ftl
@@ -0,0 +1,14 @@
+ent-GlassBoxLaser = glass box
+    .desc = A sturdy showcase for an expensive exhibit.
+ent-GlassBoxLaserOpen = { ent-GlassBoxLaser }
+    .suffix = Open
+    .desc = { ent-GlassBoxLaser.desc }
+ent-GlassBoxLaserFilled = { ent-GlassBoxLaser }
+    .suffix = Filled
+    .desc = { ent-GlassBoxLaser.desc }
+ent-GlassBoxLaserFilledOpen = { ent-GlassBoxLaserFilled }
+    .suffix = Filled, Open
+    .desc = { ent-GlassBoxLaserFilled.desc }
+ent-GlassBoxLaserBroken = broken glass box
+    .desc = A broken showcase for a stolen expensive exhibit.
+    .suffix = Broken
diff --git a/Resources/Locale/ru-RU/station-laws/laws.ftl b/Resources/Locale/ru-RU/station-laws/laws.ftl
index 562c903ddd7..ee39917397c 100644
--- a/Resources/Locale/ru-RU/station-laws/laws.ftl
+++ b/Resources/Locale/ru-RU/station-laws/laws.ftl
@@ -27,6 +27,7 @@ law-ninja-4 = Вы должны сражаться и поступать с че
 law-emag-secrecy = Вы должны сохранять секретность любой деятельности организации { $faction }, кроме тех случаев, когда это противоречит Первому, Второму или Третьему закону.
 law-emag-custom = Только { $name } и лица, им указаные, являются { $title }.
 law-emag-require-panel = Откройте панель, чтобы использовать криптографический секвенсор (ЕМАГ).
+law-emag-cannot-emag-self = You cannot use the EMAG on yourself.
 laws-ui-menu-title = Законы
 laws-ui-law-header = Закон { $id }
 laws-ui-state-law = Объявить законы:
diff --git a/Resources/Locale/ru-RU/tiles/tiles.ftl b/Resources/Locale/ru-RU/tiles/tiles.ftl
index 52a84647200..03b0a5c7a7d 100644
--- a/Resources/Locale/ru-RU/tiles/tiles.ftl
+++ b/Resources/Locale/ru-RU/tiles/tiles.ftl
@@ -77,6 +77,8 @@ tiles-blue-shuttle-floor = синий пол шаттла
 tiles-orange-shuttle-floor = оранжевый пол шаттла
 tiles-purple-shuttle-floor = фиолетовый пол шаттла
 tiles-red-shuttle-floor = красный пол шаттла
+tiles-grey-shuttle-floor = grey shuttle floor
+tiles-black-shuttle-floor = black shuttle floor
 tiles-gold-tile = золотой пол
 tiles-silver-tile = серебряный пол
 tiles-glass-floor = стеклянный пол
diff --git a/Resources/Maps/Shuttles/cargo_fland.yml b/Resources/Maps/Shuttles/cargo_fland.yml
new file mode 100644
index 00000000000..dd1871a1cad
--- /dev/null
+++ b/Resources/Maps/Shuttles/cargo_fland.yml
@@ -0,0 +1,1282 @@
+meta:
+  format: 6
+  postmapinit: false
+tilemap:
+  0: Space
+  34: FloorDarkMono
+  89: FloorSteel
+  100: FloorSteelMono
+  105: FloorTechMaint2
+  120: Lattice
+  121: Plating
+entities:
+- proto: ""
+  entities:
+  - uid: 1
+    components:
+    - type: MetaData
+      name: Cargo shuttle
+    - type: Transform
+      pos: -0.59375,1.0312805
+      parent: invalid
+    - type: MapGrid
+      chunks:
+        0,0:
+          ind: 0,0
+          tiles: WQAAAAABZAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAZAAAAAAAWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAZAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAZAAAAAADeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAADZAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAZAAAAAACWQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAZAAAAAADZAAAAAACZAAAAAABZAAAAAACZAAAAAABeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAACeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+          version: 6
+        0,-1:
+          ind: 0,-1
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAaQAAAAAAIgAAAAACaQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAaQAAAAAAIgAAAAABaQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAIgAAAAACaQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAZAAAAAADZAAAAAADZAAAAAACZAAAAAAAZAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAZAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAZAAAAAADeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAZAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAZAAAAAADeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+          version: 6
+    - type: Broadphase
+    - type: Physics
+      bodyStatus: InAir
+      angularDamping: 0.05
+      linearDamping: 0.05
+      fixedRotation: False
+      bodyType: Dynamic
+    - type: Fixtures
+      fixtures: {}
+    - type: OccluderTree
+    - type: SpreaderGrid
+    - type: Shuttle
+    - type: GridPathfinding
+    - type: Gravity
+      gravityShakeSound: !type:SoundPathSpecifier
+        path: /Audio/Effects/alert.ogg
+    - type: DecalGrid
+      chunkCollection:
+        version: 2
+        nodes:
+        - node:
+            color: '#FFFFFFFF'
+            id: Bot
+          decals:
+            0: 3,5
+        - node:
+            color: '#FFFFFFFF'
+            id: BrickTileDarkInnerNe
+          decals:
+            11: 1,-3
+            13: 1,0
+            29: 1,2
+        - node:
+            color: '#FFFFFFFF'
+            id: BrickTileDarkInnerNw
+          decals:
+            17: 5,-3
+            28: 5,2
+            31: 5,0
+        - node:
+            color: '#FFFFFFFF'
+            id: BrickTileDarkInnerSe
+          decals:
+            14: 1,0
+            24: 1,3
+            27: 1,2
+        - node:
+            color: '#FFFFFFFF'
+            id: BrickTileDarkInnerSw
+          decals:
+            25: 5,3
+            26: 5,2
+            30: 5,0
+        - node:
+            color: '#FFFFFFFF'
+            id: BrickTileDarkLineE
+          decals:
+            12: 1,-2
+            15: 1,-1
+            16: 1,1
+        - node:
+            color: '#FFFFFFFF'
+            id: BrickTileDarkLineN
+          decals:
+            8: 2,-3
+            9: 3,-3
+            10: 4,-3
+        - node:
+            color: '#FFFFFFFF'
+            id: BrickTileDarkLineS
+          decals:
+            21: 2,3
+            22: 3,3
+            23: 4,3
+        - node:
+            color: '#FFFFFFFF'
+            id: BrickTileDarkLineW
+          decals:
+            18: 5,-2
+            19: 5,-1
+            20: 5,1
+        - node:
+            cleanable: True
+            color: '#FFFFFFFF'
+            id: DirtHeavyMonotile
+          decals:
+            5: 3,-5
+            6: 3,-4
+            7: 3,-6
+        - node:
+            angle: -1.5707963267948966 rad
+            color: '#FFFFFFFF'
+            id: LoadingArea
+          decals:
+            3: 5,0
+            4: 5,2
+        - node:
+            angle: 1.5707963267948966 rad
+            color: '#FFFFFFFF'
+            id: LoadingArea
+          decals:
+            1: 1,0
+            2: 1,2
+    - type: GridAtmosphere
+      version: 2
+      data:
+        tiles:
+          0,0:
+            0: 117
+            1: 65418
+          0,-1:
+            0: 4096
+            1: 61439
+          -1,-1:
+            0: 32768
+          -1,0:
+            0: 136
+          0,1:
+            1: 61439
+          1,0:
+            1: 30583
+          1,1:
+            1: 14199
+          0,-2:
+            1: 65504
+          1,-2:
+            1: 30512
+          1,-1:
+            1: 30583
+        uniqueMixes:
+        - volume: 2500
+          temperature: 293.15
+          moles:
+          - 21.824879
+          - 82.10312
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+        - volume: 2500
+          temperature: 293.15
+          moles:
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+          - 0
+        chunkSize: 4
+    - type: GasTileOverlay
+    - type: RadiationGridResistance
+    - type: CargoShuttle
+- proto: AirCanister
+  entities:
+  - uid: 119
+    components:
+    - type: Transform
+      pos: 4.5,-5.5
+      parent: 1
+    - type: AtmosDevice
+      joinedGrid: 1
+    - type: Lock
+      locked: True
+- proto: AirlockGlassShuttle
+  entities:
+  - uid: 50
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 0.5,0.5
+      parent: 1
+    - type: Door
+      secondsUntilStateChange: -4755.514
+      state: Opening
+  - uid: 51
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 0.5,2.5
+      parent: 1
+    - type: Door
+      secondsUntilStateChange: -4754.5474
+      state: Opening
+  - uid: 52
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 6.5,2.5
+      parent: 1
+    - type: Door
+      secondsUntilStateChange: -4753.614
+      state: Opening
+  - uid: 53
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 6.5,0.5
+      parent: 1
+    - type: Door
+      secondsUntilStateChange: -4768.614
+      state: Opening
+- proto: APCBasic
+  entities:
+  - uid: 121
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 1.5,-3.5
+      parent: 1
+- proto: AtmosDeviceFanTiny
+  entities:
+  - uid: 158
+    components:
+    - type: Transform
+      pos: 0.5,0.5
+      parent: 1
+  - uid: 159
+    components:
+    - type: Transform
+      pos: 0.5,2.5
+      parent: 1
+  - uid: 160
+    components:
+    - type: Transform
+      pos: 6.5,2.5
+      parent: 1
+  - uid: 161
+    components:
+    - type: Transform
+      pos: 6.5,0.5
+      parent: 1
+- proto: BlastDoor
+  entities:
+  - uid: 89
+    components:
+    - type: Transform
+      pos: 0.5,3.5
+      parent: 1
+    - type: DeviceLinkSink
+      links:
+      - 145
+  - uid: 90
+    components:
+    - type: Transform
+      pos: 0.5,-0.5
+      parent: 1
+    - type: DeviceLinkSink
+      links:
+      - 145
+  - uid: 99
+    components:
+    - type: Transform
+      pos: 6.5,3.5
+      parent: 1
+    - type: DeviceLinkSink
+      links:
+      - 43
+  - uid: 100
+    components:
+    - type: Transform
+      pos: 6.5,-0.5
+      parent: 1
+    - type: DeviceLinkSink
+      links:
+      - 43
+- proto: CableApcExtension
+  entities:
+  - uid: 124
+    components:
+    - type: Transform
+      pos: 1.5,-3.5
+      parent: 1
+  - uid: 125
+    components:
+    - type: Transform
+      pos: 2.5,-3.5
+      parent: 1
+  - uid: 126
+    components:
+    - type: Transform
+      pos: 3.5,-3.5
+      parent: 1
+  - uid: 127
+    components:
+    - type: Transform
+      pos: 4.5,-3.5
+      parent: 1
+  - uid: 128
+    components:
+    - type: Transform
+      pos: 4.5,-4.5
+      parent: 1
+  - uid: 129
+    components:
+    - type: Transform
+      pos: 0.5,-3.5
+      parent: 1
+  - uid: 130
+    components:
+    - type: Transform
+      pos: 0.5,-4.5
+      parent: 1
+  - uid: 131
+    components:
+    - type: Transform
+      pos: 0.5,-5.5
+      parent: 1
+  - uid: 132
+    components:
+    - type: Transform
+      pos: 6.5,-5.5
+      parent: 1
+  - uid: 133
+    components:
+    - type: Transform
+      pos: 6.5,-4.5
+      parent: 1
+  - uid: 134
+    components:
+    - type: Transform
+      pos: 6.5,-3.5
+      parent: 1
+  - uid: 135
+    components:
+    - type: Transform
+      pos: 5.5,-3.5
+      parent: 1
+  - uid: 136
+    components:
+    - type: Transform
+      pos: 3.5,-2.5
+      parent: 1
+  - uid: 137
+    components:
+    - type: Transform
+      pos: 3.5,-1.5
+      parent: 1
+  - uid: 138
+    components:
+    - type: Transform
+      pos: 3.5,-0.5
+      parent: 1
+  - uid: 140
+    components:
+    - type: Transform
+      pos: 3.5,1.5
+      parent: 1
+  - uid: 142
+    components:
+    - type: Transform
+      pos: 3.5,0.5
+      parent: 1
+  - uid: 146
+    components:
+    - type: Transform
+      pos: 3.5,2.5
+      parent: 1
+  - uid: 147
+    components:
+    - type: Transform
+      pos: 3.5,3.5
+      parent: 1
+  - uid: 148
+    components:
+    - type: Transform
+      pos: 3.5,4.5
+      parent: 1
+  - uid: 149
+    components:
+    - type: Transform
+      pos: 3.5,5.5
+      parent: 1
+  - uid: 150
+    components:
+    - type: Transform
+      pos: 2.5,5.5
+      parent: 1
+  - uid: 151
+    components:
+    - type: Transform
+      pos: 1.5,5.5
+      parent: 1
+  - uid: 152
+    components:
+    - type: Transform
+      pos: 0.5,5.5
+      parent: 1
+  - uid: 153
+    components:
+    - type: Transform
+      pos: 0.5,6.5
+      parent: 1
+  - uid: 154
+    components:
+    - type: Transform
+      pos: 4.5,5.5
+      parent: 1
+  - uid: 155
+    components:
+    - type: Transform
+      pos: 5.5,5.5
+      parent: 1
+  - uid: 156
+    components:
+    - type: Transform
+      pos: 6.5,5.5
+      parent: 1
+  - uid: 157
+    components:
+    - type: Transform
+      pos: 6.5,6.5
+      parent: 1
+- proto: CableHV
+  entities:
+  - uid: 109
+    components:
+    - type: Transform
+      pos: 2.5,-5.5
+      parent: 1
+  - uid: 110
+    components:
+    - type: Transform
+      pos: 2.5,-4.5
+      parent: 1
+  - uid: 111
+    components:
+    - type: Transform
+      pos: 2.5,-3.5
+      parent: 1
+- proto: CableMV
+  entities:
+  - uid: 122
+    components:
+    - type: Transform
+      pos: 1.5,-3.5
+      parent: 1
+  - uid: 123
+    components:
+    - type: Transform
+      pos: 2.5,-3.5
+      parent: 1
+- proto: CableTerminal
+  entities:
+  - uid: 108
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 2.5,-5.5
+      parent: 1
+- proto: CargoPallet
+  entities:
+  - uid: 32
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 4.5,1.5
+      parent: 1
+  - uid: 34
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 2.5,1.5
+      parent: 1
+  - uid: 35
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 2.5,2.5
+      parent: 1
+  - uid: 62
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 4.5,2.5
+      parent: 1
+  - uid: 63
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 3.5,2.5
+      parent: 1
+  - uid: 64
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 2.5,-1.5
+      parent: 1
+  - uid: 65
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 2.5,-0.5
+      parent: 1
+  - uid: 66
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 3.5,-0.5
+      parent: 1
+  - uid: 67
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 3.5,-1.5
+      parent: 1
+  - uid: 68
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 4.5,-1.5
+      parent: 1
+  - uid: 69
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 4.5,-0.5
+      parent: 1
+  - uid: 70
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 2.5,0.5
+      parent: 1
+  - uid: 71
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 3.5,0.5
+      parent: 1
+  - uid: 72
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 4.5,0.5
+      parent: 1
+  - uid: 141
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 3.5,1.5
+      parent: 1
+- proto: Catwalk
+  entities:
+  - uid: 101
+    components:
+    - type: Transform
+      pos: 0.5,-0.5
+      parent: 1
+  - uid: 102
+    components:
+    - type: Transform
+      pos: 0.5,3.5
+      parent: 1
+  - uid: 103
+    components:
+    - type: Transform
+      pos: 6.5,3.5
+      parent: 1
+  - uid: 104
+    components:
+    - type: Transform
+      pos: 6.5,-0.5
+      parent: 1
+- proto: ChairPilotSeat
+  entities:
+  - uid: 74
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 3.5,5.5
+      parent: 1
+- proto: ComputerShuttleCargo
+  entities:
+  - uid: 73
+    components:
+    - type: Transform
+      pos: 3.5,6.5
+      parent: 1
+- proto: ConveyorBelt
+  entities:
+  - uid: 91
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 5.5,-0.5
+      parent: 1
+    - type: DeviceLinkSink
+      links:
+      - 88
+  - uid: 92
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 6.5,-0.5
+      parent: 1
+    - type: DeviceLinkSink
+      links:
+      - 88
+  - uid: 93
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 0.5,-0.5
+      parent: 1
+    - type: DeviceLinkSink
+      links:
+      - 87
+  - uid: 94
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 1.5,-0.5
+      parent: 1
+    - type: DeviceLinkSink
+      links:
+      - 87
+  - uid: 95
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 0.5,3.5
+      parent: 1
+    - type: DeviceLinkSink
+      links:
+      - 87
+  - uid: 96
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 1.5,3.5
+      parent: 1
+    - type: DeviceLinkSink
+      links:
+      - 87
+  - uid: 97
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 5.5,3.5
+      parent: 1
+    - type: DeviceLinkSink
+      links:
+      - 88
+  - uid: 98
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 6.5,3.5
+      parent: 1
+    - type: DeviceLinkSink
+      links:
+      - 88
+- proto: DisposalPipe
+  entities:
+  - uid: 83
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 0.5,4.5
+      parent: 1
+  - uid: 84
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 1.5,4.5
+      parent: 1
+- proto: DisposalTrunk
+  entities:
+  - uid: 85
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 2.5,4.5
+      parent: 1
+- proto: DisposalUnit
+  entities:
+  - uid: 82
+    components:
+    - type: Transform
+      pos: 2.5,4.5
+      parent: 1
+- proto: GasPipeBend
+  entities:
+  - uid: 116
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 3.5,-5.5
+      parent: 1
+  - uid: 169
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 3.5,4.5
+      parent: 1
+- proto: GasPipeStraight
+  entities:
+  - uid: 118
+    components:
+    - type: Transform
+      pos: 3.5,-4.5
+      parent: 1
+  - uid: 120
+    components:
+    - type: Transform
+      pos: 3.5,-3.5
+      parent: 1
+  - uid: 162
+    components:
+    - type: Transform
+      pos: 3.5,-1.5
+      parent: 1
+  - uid: 163
+    components:
+    - type: Transform
+      pos: 3.5,-0.5
+      parent: 1
+  - uid: 164
+    components:
+    - type: Transform
+      pos: 3.5,0.5
+      parent: 1
+  - uid: 165
+    components:
+    - type: Transform
+      pos: 3.5,1.5
+      parent: 1
+  - uid: 166
+    components:
+    - type: Transform
+      pos: 3.5,2.5
+      parent: 1
+  - uid: 167
+    components:
+    - type: Transform
+      pos: 3.5,3.5
+      parent: 1
+- proto: GasPipeTJunction
+  entities:
+  - uid: 117
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 3.5,-2.5
+      parent: 1
+- proto: GasPort
+  entities:
+  - uid: 114
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 4.5,-5.5
+      parent: 1
+    - type: AtmosDevice
+      joinedGrid: 1
+- proto: GasVentPump
+  entities:
+  - uid: 115
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 4.5,-2.5
+      parent: 1
+    - type: AtmosDevice
+      joinedGrid: 1
+  - uid: 168
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 4.5,4.5
+      parent: 1
+    - type: AtmosDevice
+      joinedGrid: 1
+- proto: GeneratorBasic15kW
+  entities:
+  - uid: 106
+    components:
+    - type: Transform
+      pos: 2.5,-5.5
+      parent: 1
+- proto: GravityGeneratorMini
+  entities:
+  - uid: 113
+    components:
+    - type: Transform
+      pos: 4.5,-4.5
+      parent: 1
+- proto: Grille
+  entities:
+  - uid: 24
+    components:
+    - type: Transform
+      pos: 2.5,7.5
+      parent: 1
+  - uid: 26
+    components:
+    - type: Transform
+      pos: 3.5,7.5
+      parent: 1
+  - uid: 27
+    components:
+    - type: Transform
+      pos: 4.5,7.5
+      parent: 1
+  - uid: 42
+    components:
+    - type: Transform
+      pos: 0.5,1.5
+      parent: 1
+  - uid: 45
+    components:
+    - type: Transform
+      pos: 6.5,1.5
+      parent: 1
+  - uid: 47
+    components:
+    - type: Transform
+      pos: 4.5,-6.5
+      parent: 1
+  - uid: 48
+    components:
+    - type: Transform
+      pos: 3.5,-6.5
+      parent: 1
+  - uid: 49
+    components:
+    - type: Transform
+      pos: 2.5,-6.5
+      parent: 1
+- proto: Gyroscope
+  entities:
+  - uid: 112
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 4.5,-3.5
+      parent: 1
+- proto: Lamp
+  entities:
+  - uid: 143
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 2.589646,6.6854343
+      parent: 1
+- proto: PlasticFlapsAirtightClear
+  entities:
+  - uid: 25
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 0.5,3.5
+      parent: 1
+  - uid: 28
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 6.5,-0.5
+      parent: 1
+  - uid: 44
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 0.5,-0.5
+      parent: 1
+  - uid: 46
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 6.5,3.5
+      parent: 1
+- proto: Poweredlight
+  entities:
+  - uid: 139
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 1.5,1.5
+      parent: 1
+  - uid: 144
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 5.5,1.5
+      parent: 1
+- proto: Rack
+  entities:
+  - uid: 86
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 4.5,4.5
+      parent: 1
+- proto: ShuttleWindow
+  entities:
+  - uid: 29
+    components:
+    - type: Transform
+      pos: 4.5,7.5
+      parent: 1
+  - uid: 30
+    components:
+    - type: Transform
+      pos: 3.5,7.5
+      parent: 1
+  - uid: 31
+    components:
+    - type: Transform
+      pos: 2.5,7.5
+      parent: 1
+  - uid: 33
+    components:
+    - type: Transform
+      pos: 0.5,1.5
+      parent: 1
+  - uid: 38
+    components:
+    - type: Transform
+      pos: 6.5,1.5
+      parent: 1
+  - uid: 39
+    components:
+    - type: Transform
+      pos: 2.5,-6.5
+      parent: 1
+  - uid: 40
+    components:
+    - type: Transform
+      pos: 3.5,-6.5
+      parent: 1
+  - uid: 41
+    components:
+    - type: Transform
+      pos: 4.5,-6.5
+      parent: 1
+- proto: SignalButtonDirectional
+  entities:
+  - uid: 43
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 6.5,1.5
+      parent: 1
+    - type: DeviceLinkSource
+      linkedPorts:
+        100:
+        - Pressed: Toggle
+        99:
+        - Pressed: Toggle
+  - uid: 145
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 0.5,1.5
+      parent: 1
+    - type: DeviceLinkSource
+      linkedPorts:
+        89:
+        - Pressed: Toggle
+        90:
+        - Pressed: Toggle
+- proto: SMESBasic
+  entities:
+  - uid: 105
+    components:
+    - type: Transform
+      pos: 2.5,-4.5
+      parent: 1
+- proto: SubstationBasic
+  entities:
+  - uid: 107
+    components:
+    - type: Transform
+      pos: 2.5,-3.5
+      parent: 1
+- proto: TableReinforced
+  entities:
+  - uid: 75
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 2.5,6.5
+      parent: 1
+  - uid: 76
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 2.5,5.5
+      parent: 1
+  - uid: 77
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 4.5,6.5
+      parent: 1
+  - uid: 78
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 4.5,5.5
+      parent: 1
+- proto: Thruster
+  entities:
+  - uid: 54
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 0.5,5.5
+      parent: 1
+  - uid: 55
+    components:
+    - type: Transform
+      pos: 0.5,6.5
+      parent: 1
+  - uid: 56
+    components:
+    - type: Transform
+      pos: 6.5,6.5
+      parent: 1
+  - uid: 57
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 6.5,5.5
+      parent: 1
+  - uid: 58
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 6.5,-4.5
+      parent: 1
+  - uid: 59
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 6.5,-5.5
+      parent: 1
+  - uid: 60
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 0.5,-5.5
+      parent: 1
+  - uid: 61
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 0.5,-4.5
+      parent: 1
+- proto: TwoWayLever
+  entities:
+  - uid: 87
+    components:
+    - type: Transform
+      pos: 1.5,1.5
+      parent: 1
+    - type: DeviceLinkSource
+      linkedPorts:
+        94:
+        - Left: Forward
+        - Right: Reverse
+        - Middle: Off
+        93:
+        - Left: Forward
+        - Right: Reverse
+        - Middle: Off
+        95:
+        - Left: Forward
+        - Right: Reverse
+        - Middle: Off
+        96:
+        - Middle: Off
+        - Left: Reverse
+        - Right: Forward
+  - uid: 88
+    components:
+    - type: Transform
+      pos: 5.5,1.5
+      parent: 1
+    - type: DeviceLinkSource
+      linkedPorts:
+        91:
+        - Left: Reverse
+        - Middle: Off
+        - Right: Forward
+        97:
+        - Left: Forward
+        - Right: Reverse
+        - Middle: Off
+        98:
+        - Left: Forward
+        - Right: Reverse
+        - Middle: Off
+        92:
+        - Left: Forward
+        - Right: Reverse
+        - Middle: Off
+- proto: WallShuttle
+  entities:
+  - uid: 2
+    components:
+    - type: Transform
+      pos: 1.5,7.5
+      parent: 1
+  - uid: 3
+    components:
+    - type: Transform
+      pos: 1.5,6.5
+      parent: 1
+  - uid: 4
+    components:
+    - type: Transform
+      pos: 1.5,5.5
+      parent: 1
+  - uid: 5
+    components:
+    - type: Transform
+      pos: 1.5,-3.5
+      parent: 1
+  - uid: 6
+    components:
+    - type: Transform
+      pos: 0.5,-3.5
+      parent: 1
+  - uid: 7
+    components:
+    - type: Transform
+      pos: 5.5,7.5
+      parent: 1
+  - uid: 8
+    components:
+    - type: Transform
+      pos: 5.5,6.5
+      parent: 1
+  - uid: 9
+    components:
+    - type: Transform
+      pos: 5.5,5.5
+      parent: 1
+  - uid: 10
+    components:
+    - type: Transform
+      pos: 5.5,4.5
+      parent: 1
+  - uid: 11
+    components:
+    - type: Transform
+      pos: 6.5,4.5
+      parent: 1
+  - uid: 12
+    components:
+    - type: Transform
+      pos: 0.5,4.5
+      parent: 1
+  - uid: 13
+    components:
+    - type: Transform
+      pos: 1.5,4.5
+      parent: 1
+  - uid: 14
+    components:
+    - type: Transform
+      pos: 1.5,-6.5
+      parent: 1
+  - uid: 15
+    components:
+    - type: Transform
+      pos: 1.5,-5.5
+      parent: 1
+  - uid: 16
+    components:
+    - type: Transform
+      pos: 1.5,-4.5
+      parent: 1
+  - uid: 17
+    components:
+    - type: Transform
+      pos: 5.5,-6.5
+      parent: 1
+  - uid: 18
+    components:
+    - type: Transform
+      pos: 5.5,-5.5
+      parent: 1
+  - uid: 19
+    components:
+    - type: Transform
+      pos: 5.5,-4.5
+      parent: 1
+  - uid: 20
+    components:
+    - type: Transform
+      pos: 5.5,-3.5
+      parent: 1
+  - uid: 21
+    components:
+    - type: Transform
+      pos: 6.5,-3.5
+      parent: 1
+  - uid: 22
+    components:
+    - type: Transform
+      pos: 0.5,-2.5
+      parent: 1
+  - uid: 23
+    components:
+    - type: Transform
+      pos: 0.5,-1.5
+      parent: 1
+  - uid: 36
+    components:
+    - type: Transform
+      pos: 6.5,-1.5
+      parent: 1
+  - uid: 37
+    components:
+    - type: Transform
+      pos: 6.5,-2.5
+      parent: 1
+- proto: WindoorSecureCargoLocked
+  entities:
+  - uid: 80
+    components:
+    - type: Transform
+      pos: 3.5,4.5
+      parent: 1
+- proto: WindowFrostedDirectional
+  entities:
+  - uid: 79
+    components:
+    - type: Transform
+      pos: 2.5,4.5
+      parent: 1
+  - uid: 81
+    components:
+    - type: Transform
+      pos: 4.5,4.5
+      parent: 1
+...
diff --git a/Resources/Maps/atlas.yml b/Resources/Maps/atlas.yml
index 44fe1390062..68996e61c2a 100644
--- a/Resources/Maps/atlas.yml
+++ b/Resources/Maps/atlas.yml
@@ -85,7 +85,7 @@ entities:
           version: 6
         1,1:
           ind: 1,1
-          tiles: eQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAdgAAAAAAdgAAAAAAdgAAAAAAdgAAAAAAdgAAAAAAdgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: eQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAdgAAAAAAdgAAAAAAdgAAAAAAdgAAAAAAdgAAAAAAdgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         -1,1:
           ind: -1,1
@@ -19678,6 +19678,13 @@ entities:
       parent: 30
     - type: NavMapBeacon
       text: Suppermatter
+- proto: DefaultStationBeaconEscapePod
+  entities:
+  - uid: 1617
+    components:
+    - type: Transform
+      pos: 7.5,25.5
+      parent: 30
 - proto: DefaultStationBeaconEVAStorage
   entities:
   - uid: 7600
@@ -22691,12 +22698,6 @@ entities:
       rot: 3.141592653589793 rad
       pos: -41.5,16.5
       parent: 30
-  - uid: 1343
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: -6.5,22.5
-      parent: 30
   - uid: 2943
     components:
     - type: Transform
@@ -23371,10 +23372,10 @@ entities:
       parent: 30
 - proto: FloraTree05
   entities:
-  - uid: 2765
+  - uid: 255
     components:
     - type: Transform
-      pos: -10.5,2.5
+      pos: -10.411624,2.3174798
       parent: 30
 - proto: FoodBanana
   entities:
@@ -37727,20 +37728,30 @@ entities:
     - type: Transform
       pos: -41.5,-1.5
       parent: 30
-  - uid: 3351
+  - uid: 1064
     components:
     - type: Transform
-      pos: 9.5,-17.5
+      pos: 12.5,-16.5
       parent: 30
-  - uid: 6435
+  - uid: 1622
     components:
     - type: Transform
-      pos: 6.5,21.5
+      pos: -11.5,14.5
       parent: 30
-  - uid: 7575
+  - uid: 2765
     components:
     - type: Transform
-      pos: 26.5,18.5
+      pos: -38.5,-8.5
+      parent: 30
+  - uid: 3351
+    components:
+    - type: Transform
+      pos: 27.5,21.5
+      parent: 30
+  - uid: 6435
+    components:
+    - type: Transform
+      pos: 6.5,21.5
       parent: 30
 - proto: PortableGeneratorPacman
   entities:
@@ -43741,27 +43752,6 @@ entities:
     - type: Transform
       pos: 11.5,13.5
       parent: 30
-- proto: SpawnVehicleJanicart
-  entities:
-  - uid: 7408
-    components:
-    - type: Transform
-      pos: 22.5,-2.5
-      parent: 30
-- proto: SpawnVehicleSecway
-  entities:
-  - uid: 1617
-    components:
-    - type: Transform
-      pos: 15.5,13.5
-      parent: 30
-- proto: SpawnVehicleWheelchairFolded
-  entities:
-  - uid: 255
-    components:
-    - type: Transform
-      pos: 3.5,-5.5
-      parent: 30
 - proto: SprayBottleSpaceCleaner
   entities:
   - uid: 3296
@@ -45859,24 +45849,6 @@ entities:
     - type: Transform
       pos: 2.5,-21.5
       parent: 30
-- proto: VehicleKeyJanicart
-  entities:
-  - uid: 7397
-    components:
-    - type: Transform
-      pos: 23.47368,-2.1477566
-      parent: 30
-    - type: Physics
-      canCollide: False
-- proto: VehicleKeySecway
-  entities:
-  - uid: 1622
-    components:
-    - type: Transform
-      pos: 15.46822,12.503206
-      parent: 30
-    - type: Physics
-      canCollide: False
 - proto: VendingBarDrobe
   entities:
   - uid: 6131
@@ -47015,11 +46987,6 @@ entities:
     - type: Transform
       pos: 28.5,21.5
       parent: 30
-  - uid: 1064
-    components:
-    - type: Transform
-      pos: 27.5,21.5
-      parent: 30
   - uid: 1065
     components:
     - type: Transform
@@ -47272,6 +47239,11 @@ entities:
     - type: Transform
       pos: -15.5,22.5
       parent: 30
+  - uid: 1343
+    components:
+    - type: Transform
+      pos: 28.5,22.5
+      parent: 30
   - uid: 1426
     components:
     - type: Transform
diff --git a/Resources/Maps/box.yml b/Resources/Maps/box.yml
index aa6bcf7bb1b..c0d0278c352 100644
--- a/Resources/Maps/box.yml
+++ b/Resources/Maps/box.yml
@@ -9,6 +9,7 @@ tilemap:
   14: FloorBar
   16: FloorBlue
   17: FloorBlueCircuit
+  19: FloorBrokenWood
   20: FloorCarpetClown
   21: FloorCarpetOffice
   25: FloorClown
@@ -75,91 +76,91 @@ entities:
       chunks:
         -1,-1:
           ind: -1,-1
-          tiles: WQAAAAADeQAAAAAAHQAAAAAAHQAAAAADHQAAAAACHQAAAAACHQAAAAADHQAAAAADHQAAAAADHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAHQAAAAAAHQAAAAADHQAAAAACIQAAAAABHQAAAAABHQAAAAAAHQAAAAACHQAAAAABeQAAAAAAHQAAAAAAHQAAAAABEQAAAAAAEQAAAAAAEQAAAAAAWQAAAAADeQAAAAAAHQAAAAADHQAAAAADHQAAAAABHQAAAAACHQAAAAABHQAAAAAAHQAAAAADHQAAAAAAeQAAAAAAHQAAAAADHQAAAAADEQAAAAAAWQAAAAACEQAAAAAAWQAAAAACeQAAAAAAHQAAAAAAHQAAAAABHQAAAAAAHQAAAAACHQAAAAADHQAAAAAAHQAAAAAAHQAAAAADeQAAAAAAHQAAAAABEQAAAAAAEQAAAAAAHQAAAAACHQAAAAADWQAAAAAAeQAAAAAAHQAAAAACHQAAAAABHQAAAAABHQAAAAADHQAAAAACHQAAAAAAHQAAAAABHQAAAAADeQAAAAAAHQAAAAAAEQAAAAAAEQAAAAAAHQAAAAABHQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABEQAAAAAAEQAAAAAAHQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAACeQAAAAAAWQAAAAADeQAAAAAAHQAAAAABHQAAAAADHQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAADHQAAAAABHQAAAAABHQAAAAABHQAAAAADHQAAAAABHQAAAAABHQAAAAAAHQAAAAADHQAAAAABWQAAAAAAWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAWQAAAAADeQAAAAAAHQAAAAAAHQAAAAADHQAAAAABHQAAAAAAHQAAAAACHQAAAAACHQAAAAACHQAAAAACHQAAAAACWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAABHQAAAAACHQAAAAAAHQAAAAAAWQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAABHQAAAAADHQAAAAACHQAAAAABHQAAAAABWQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAADHQAAAAABHQAAAAAAHQAAAAADHQAAAAADHQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAACWQAAAAACWQAAAAADWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAACWQAAAAAC
+          tiles: WQAAAAACeQAAAAAAHQAAAAAAHQAAAAADHQAAAAACHQAAAAACHQAAAAACHQAAAAACHQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAHQAAAAADHQAAAAABHQAAAAACIQAAAAABHQAAAAACHQAAAAABHQAAAAACHQAAAAADeQAAAAAAHQAAAAABHQAAAAADEQAAAAAAEQAAAAAAEQAAAAAAWQAAAAABeQAAAAAAHQAAAAABHQAAAAAAHQAAAAAAHQAAAAACHQAAAAABHQAAAAADHQAAAAADHQAAAAACeQAAAAAAHQAAAAADHQAAAAADEQAAAAAAWQAAAAADEQAAAAAAWQAAAAADeQAAAAAAHQAAAAABHQAAAAAAHQAAAAAAHQAAAAABHQAAAAABHQAAAAACHQAAAAABHQAAAAABeQAAAAAAHQAAAAAAEQAAAAAAEQAAAAAAHQAAAAAAHQAAAAAAWQAAAAAAeQAAAAAAHQAAAAABHQAAAAAAHQAAAAADHQAAAAACHQAAAAABHQAAAAABHQAAAAAAHQAAAAACeQAAAAAAHQAAAAABEQAAAAAAEQAAAAAAHQAAAAACHQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACEQAAAAAAEQAAAAAAHQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAHQAAAAACHQAAAAADHQAAAAACHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAABHQAAAAACHQAAAAAAHQAAAAADHQAAAAADHQAAAAADHQAAAAAAHQAAAAAAHQAAAAACHQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAABeQAAAAAAWQAAAAADeQAAAAAAHQAAAAACHQAAAAACHQAAAAADHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAADHQAAAAABHQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAABHQAAAAABHQAAAAADHQAAAAADHQAAAAADHQAAAAACHQAAAAABHQAAAAACWQAAAAADeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAAAHQAAAAABHQAAAAACHQAAAAADHQAAAAAAWQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAABHQAAAAACHQAAAAADHQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAACWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAABWQAAAAAB
           version: 6
         0,0:
           ind: 0,0
-          tiles: WQAAAAADWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABWQAAAAACWQAAAAADeQAAAAAAeQAAAAAALAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAABeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADeQAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAEAAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAEAAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAADdgAAAAACdgAAAAAAWQAAAAACWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAABdgAAAAABeQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADeQAAAAAAeQAAAAAALAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAADdgAAAAABdgAAAAACWQAAAAADWQAAAAADWQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAABdgAAAAACeQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADdgAAAAADdgAAAAACdgAAAAADWQAAAAABWQAAAAAAWQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAACdgAAAAADeQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAdgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAFQAAAAAAFQAAAAAAFQAAAAAAFQAAAAAAWQAAAAABWQAAAAADeQAAAAAAdgAAAAADdgAAAAADdgAAAAABeQAAAAAAFAAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAFQAAAAAAFQAAAAAAFQAAAAAAeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAdgAAAAABdgAAAAAAdgAAAAAAeQAAAAAAFAAAAAAA
+          tiles: WQAAAAABWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAALAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAADeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAAAWQAAAAADWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAEAAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAEAAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAADdgAAAAACdgAAAAADWQAAAAACWQAAAAACeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAACdgAAAAADeQAAAAAAWQAAAAACWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAALAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAABdgAAAAABdgAAAAABWQAAAAADWQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAADdgAAAAADeQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAADWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAADWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAAAdgAAAAABdgAAAAABWQAAAAADWQAAAAABWQAAAAADWQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAADdgAAAAACeQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAADWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAdgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAFQAAAAAAFQAAAAAAFQAAAAAAFQAAAAAAWQAAAAABWQAAAAADeQAAAAAAdgAAAAABdgAAAAABdgAAAAADeQAAAAAAFAAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAFQAAAAAAFQAAAAAAFQAAAAAAeQAAAAAAWQAAAAADWQAAAAACeQAAAAAAdgAAAAACdgAAAAABdgAAAAACeQAAAAAAFAAAAAAA
           version: 6
         0,-1:
           ind: 0,-1
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAACdgAAAAADdgAAAAACdgAAAAADdgAAAAABdgAAAAABHQAAAAABeQAAAAAAWQAAAAADWQAAAAADEQAAAAAAEQAAAAAAHQAAAAABHQAAAAAAeQAAAAAAdgAAAAABdgAAAAACdgAAAAAAdgAAAAAAdgAAAAACdgAAAAABdgAAAAACHQAAAAACeQAAAAAAWQAAAAABWQAAAAADWQAAAAADEQAAAAAAHQAAAAACHQAAAAAAeQAAAAAAdgAAAAAAdgAAAAABdgAAAAAAdgAAAAACdgAAAAAAdgAAAAACdgAAAAACHQAAAAADeQAAAAAAWQAAAAACWQAAAAADHQAAAAAAEQAAAAAAEQAAAAAAHQAAAAACeQAAAAAAdgAAAAABdgAAAAADdgAAAAABdgAAAAACdgAAAAADdgAAAAACdgAAAAABHQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAHQAAAAACEQAAAAAAEQAAAAAAHQAAAAADeQAAAAAAHQAAAAAAHQAAAAABHQAAAAADHQAAAAABHQAAAAADHQAAAAACHQAAAAABHQAAAAABeQAAAAAAWQAAAAABWQAAAAABEQAAAAAAEQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAABHQAAAAAAHQAAAAABeQAAAAAAWQAAAAABeQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAADHQAAAAAAHQAAAAABHQAAAAAAHQAAAAABHQAAAAABHQAAAAACHQAAAAADHQAAAAACWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAACHQAAAAAAHQAAAAADHQAAAAACHQAAAAADHQAAAAACHQAAAAABHQAAAAABHQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAABWQAAAAADHQAAAAACHQAAAAAAHQAAAAADHQAAAAAAHQAAAAACHQAAAAABHQAAAAADHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAHQAAAAAAHQAAAAABHQAAAAABHQAAAAADHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABWQAAAAAAHQAAAAADHQAAAAABHQAAAAABHQAAAAACHQAAAAADeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAADWQAAAAABWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAABWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAACWQAAAAADWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAAD
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAAAdgAAAAACdgAAAAAAdgAAAAADdgAAAAABdgAAAAAAHQAAAAABeQAAAAAAWQAAAAADWQAAAAACEQAAAAAAEQAAAAAAHQAAAAABHQAAAAAAeQAAAAAAdgAAAAAAdgAAAAABdgAAAAACdgAAAAABdgAAAAABdgAAAAACdgAAAAABHQAAAAADeQAAAAAAWQAAAAADWQAAAAACWQAAAAAAEQAAAAAAHQAAAAACHQAAAAACeQAAAAAAdgAAAAACdgAAAAABdgAAAAADdgAAAAADdgAAAAABdgAAAAABdgAAAAADHQAAAAABeQAAAAAAWQAAAAAAWQAAAAAAHQAAAAAAEQAAAAAAEQAAAAAAHQAAAAACeQAAAAAAdgAAAAADdgAAAAACdgAAAAAAdgAAAAADdgAAAAAAdgAAAAABdgAAAAABHQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACHQAAAAAAEQAAAAAAEQAAAAAAHQAAAAACeQAAAAAAHQAAAAAAHQAAAAACHQAAAAADHQAAAAACHQAAAAAAHQAAAAACHQAAAAAAHQAAAAACeQAAAAAAWQAAAAADWQAAAAAAEQAAAAAAEQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAABHQAAAAACHQAAAAABeQAAAAAAWQAAAAACeQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAABHQAAAAADHQAAAAACHQAAAAAAHQAAAAADHQAAAAADHQAAAAADHQAAAAABHQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAACHQAAAAABHQAAAAAAHQAAAAABHQAAAAACHQAAAAADHQAAAAACHQAAAAADHQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAAAHQAAAAADHQAAAAAAHQAAAAADHQAAAAADHQAAAAADHQAAAAACHQAAAAACHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACHQAAAAABHQAAAAAAHQAAAAACHQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAACWQAAAAADHQAAAAABHQAAAAABHQAAAAADHQAAAAACHQAAAAADeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAAAWQAAAAAA
           version: 6
         -1,0:
           ind: -1,0
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAADeQAAAAAAHQAAAAAAHQAAAAABWQAAAAABWQAAAAABWQAAAAAAHQAAAAACHQAAAAABeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAADeQAAAAAAHQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAWQAAAAACWQAAAAABeQAAAAAAHQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAWQAAAAADWQAAAAADeQAAAAAAHQAAAAABeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAHQAAAAABHQAAAAADWQAAAAADWQAAAAACWQAAAAADHQAAAAABHQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAHQAAAAABeQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAHQAAAAABWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAACHQAAAAACeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAADeQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAHQAAAAABWQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAACHQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAAAeQAAAAAAWQAAAAACWQAAAAADeQAAAAAAWQAAAAABWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACWQAAAAADWQAAAAACeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAHQAAAAABHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAACHQAAAAABHQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABaAAAAAAAeQAAAAAAeQAAAAAAdgAAAAADdgAAAAABdgAAAAACeQAAAAAAeQAAAAAAaQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAWQAAAAADWQAAAAACeQAAAAAAaQAAAAAAeQAAAAAAdgAAAAACdgAAAAACdgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAdgAAAAAAdgAAAAACdgAAAAACdgAAAAADdgAAAAADeQAAAAAAdgAAAAAAdgAAAAACPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAWQAAAAABWQAAAAAA
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAHQAAAAADHQAAAAAAWQAAAAABWQAAAAACWQAAAAAAHQAAAAADHQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAADWQAAAAADeQAAAAAAHQAAAAABeQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAHQAAAAACeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAHQAAAAABeQAAAAAAWQAAAAACWQAAAAADeQAAAAAAHQAAAAABeQAAAAAAWQAAAAABWQAAAAACeQAAAAAAHQAAAAACHQAAAAADWQAAAAABWQAAAAAAWQAAAAACHQAAAAAAHQAAAAACeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAHQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAHQAAAAACeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAHQAAAAABWQAAAAACWQAAAAACWQAAAAAAWQAAAAABWQAAAAAAHQAAAAADeQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAWQAAAAABWQAAAAACeQAAAAAAHQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAABHQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAACeQAAAAAAWQAAAAACWQAAAAABeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAABeQAAAAAAWQAAAAACWQAAAAADeQAAAAAAHQAAAAADHQAAAAABHQAAAAADHQAAAAADHQAAAAAAHQAAAAACHQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAABeQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACaAAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAADdgAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAaQAAAAAAeQAAAAAAdgAAAAADdgAAAAACdgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAWQAAAAADWQAAAAACeQAAAAAAdgAAAAAAdgAAAAACdgAAAAACdgAAAAACdgAAAAADeQAAAAAAdgAAAAADdgAAAAACPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAWQAAAAADWQAAAAAC
           version: 6
         1,-1:
           ind: 1,-1
-          tiles: WQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAABbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAADWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAADWQAAAAABWQAAAAACWQAAAAADWQAAAAACWQAAAAACWQAAAAADWQAAAAADWQAAAAABWQAAAAACWQAAAAADWQAAAAABWQAAAAADWQAAAAABWQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAdgAAAAACdgAAAAADdgAAAAACdgAAAAAAdgAAAAAAdgAAAAADdgAAAAABdgAAAAABdgAAAAABdgAAAAAAdgAAAAABdgAAAAAAdgAAAAAAdgAAAAABWQAAAAABeQAAAAAAdgAAAAABdgAAAAACdgAAAAADdgAAAAABdgAAAAACdgAAAAADdgAAAAACdgAAAAACdgAAAAAAdgAAAAABdgAAAAACdgAAAAADdgAAAAABdgAAAAADWQAAAAADeQAAAAAAdgAAAAABdgAAAAABdgAAAAAAdgAAAAADdgAAAAABdgAAAAACdgAAAAADdgAAAAADdgAAAAACdgAAAAABeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAdgAAAAABdgAAAAACdgAAAAAAdgAAAAAAdgAAAAADdgAAAAACdgAAAAACdgAAAAACdgAAAAAAdgAAAAAAeQAAAAAAHQAAAAABHQAAAAADHQAAAAABWQAAAAADeQAAAAAAdgAAAAACdgAAAAABdgAAAAAAdgAAAAAAdgAAAAADdgAAAAAAdgAAAAAAdgAAAAADdgAAAAAAdgAAAAACeQAAAAAAHQAAAAADHQAAAAAAHQAAAAACWQAAAAABeQAAAAAAdgAAAAABdgAAAAABdgAAAAADdgAAAAACdgAAAAAAdgAAAAAAdgAAAAAAdgAAAAADdgAAAAABdgAAAAAAeQAAAAAAHQAAAAABHQAAAAABHQAAAAADWQAAAAACeQAAAAAAdgAAAAAAdgAAAAAAdgAAAAABdgAAAAAAdgAAAAACdgAAAAABdgAAAAAAdgAAAAABdgAAAAADdgAAAAADeQAAAAAAHQAAAAADHQAAAAAAHQAAAAACWQAAAAABeQAAAAAAdgAAAAAAdgAAAAAAdgAAAAACdgAAAAAAdgAAAAACdgAAAAABdgAAAAABdgAAAAAAdgAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAABHQAAAAABWQAAAAACeQAAAAAAdgAAAAADPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAdgAAAAACdgAAAAADdgAAAAADeQAAAAAAeQAAAAAAdgAAAAAAeQAAAAAAWQAAAAABeQAAAAAAdgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAdgAAAAACdgAAAAADdgAAAAABdgAAAAADdgAAAAACdgAAAAADdgAAAAADWQAAAAADeQAAAAAAdgAAAAABPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAdgAAAAABdgAAAAACdgAAAAADdgAAAAAAdgAAAAACdgAAAAAAdgAAAAAC
+          tiles: WQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAADWQAAAAABWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAdgAAAAACdgAAAAAAdgAAAAABdgAAAAACdgAAAAABdgAAAAACdgAAAAADdgAAAAADdgAAAAABdgAAAAADdgAAAAACdgAAAAADdgAAAAABdgAAAAABWQAAAAAAeQAAAAAAdgAAAAACdgAAAAABdgAAAAAAdgAAAAADdgAAAAADdgAAAAADdgAAAAACdgAAAAADdgAAAAAAdgAAAAABdgAAAAAAdgAAAAABdgAAAAAAdgAAAAADWQAAAAADeQAAAAAAdgAAAAABdgAAAAABdgAAAAADdgAAAAACdgAAAAAAdgAAAAACdgAAAAACdgAAAAABdgAAAAACdgAAAAADeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAdgAAAAADdgAAAAAAdgAAAAABdgAAAAAAdgAAAAADdgAAAAADdgAAAAACdgAAAAABdgAAAAABdgAAAAACeQAAAAAAHQAAAAADHQAAAAABHQAAAAABWQAAAAADeQAAAAAAdgAAAAAAdgAAAAACdgAAAAABdgAAAAAAdgAAAAACdgAAAAAAdgAAAAACdgAAAAAAdgAAAAACdgAAAAACeQAAAAAAHQAAAAACHQAAAAADHQAAAAAAWQAAAAADeQAAAAAAdgAAAAABdgAAAAACdgAAAAADdgAAAAAAdgAAAAAAdgAAAAAAdgAAAAAAdgAAAAABdgAAAAABdgAAAAADeQAAAAAAHQAAAAADHQAAAAACHQAAAAAAWQAAAAABeQAAAAAAdgAAAAABdgAAAAADdgAAAAABdgAAAAADdgAAAAADdgAAAAAAdgAAAAADdgAAAAABdgAAAAACdgAAAAABeQAAAAAAHQAAAAAAHQAAAAABHQAAAAAAWQAAAAAAeQAAAAAAdgAAAAABdgAAAAABdgAAAAAAdgAAAAADdgAAAAACdgAAAAADdgAAAAABdgAAAAADdgAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAABHQAAAAAAWQAAAAAAeQAAAAAAdgAAAAACPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAdgAAAAACdgAAAAACdgAAAAABeQAAAAAAeQAAAAAAdgAAAAACeQAAAAAAWQAAAAADeQAAAAAAdgAAAAADPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAdgAAAAADdgAAAAACdgAAAAADdgAAAAAAdgAAAAAAdgAAAAADdgAAAAABWQAAAAABeQAAAAAAdgAAAAABPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAdgAAAAADdgAAAAADdgAAAAAAdgAAAAADdgAAAAAAdgAAAAADdgAAAAAA
           version: 6
         -2,-1:
           ind: -2,-1
-          tiles: WQAAAAADWQAAAAABWQAAAAADeQAAAAAAaQAAAAAAHQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAABeQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAADeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAHQAAAAACHQAAAAADHQAAAAACHQAAAAACHQAAAAACeQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAACWQAAAAACWQAAAAADeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAABHQAAAAABHQAAAAADeQAAAAAAWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAABWQAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAADHQAAAAACHQAAAAADHQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAABHQAAAAACHQAAAAADHQAAAAABeQAAAAAAWQAAAAABWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAADHQAAAAAAHQAAAAADHQAAAAACeQAAAAAAWQAAAAACWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAABWQAAAAACeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAABWQAAAAABeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAACWQAAAAABeQAAAAAAWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAACWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAACWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAADWQAAAAABWQAAAAACWQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAABWQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAC
+          tiles: WQAAAAABWQAAAAADWQAAAAADeQAAAAAAaQAAAAAAHQAAAAACWQAAAAABWQAAAAACWQAAAAACWQAAAAADWQAAAAACWQAAAAACWQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAACWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAADWQAAAAADeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAHQAAAAACHQAAAAABHQAAAAADHQAAAAACHQAAAAABeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAABHQAAAAACHQAAAAABHQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAADWQAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAAAHQAAAAADHQAAAAAAHQAAAAADWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAAAWQAAAAADWQAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAABHQAAAAACHQAAAAAAHQAAAAADeQAAAAAAWQAAAAABWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAABHQAAAAADHQAAAAACHQAAAAADeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAABWQAAAAACeQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAADeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAABeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAACeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAAA
           version: 6
         -2,-2:
           ind: -2,-2
-          tiles: WQAAAAADWQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAACeQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAADeQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAABeQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAABWQAAAAACeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAdgAAAAADdgAAAAADeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAABeQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAACeQAAAAAAWQAAAAADWQAAAAAAdgAAAAADdgAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAAAeQAAAAAAWQAAAAACWQAAAAACdgAAAAAAdgAAAAACeQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAADeQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAADeQAAAAAAWQAAAAAAWQAAAAAAdgAAAAAAdgAAAAACeQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAADWQAAAAACWQAAAAADWQAAAAADWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAADeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAADWQAAAAACWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAACWQAAAAABeQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAACeQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAACeQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAACWQAAAAADWQAAAAADWQAAAAADWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAACeQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAACWQAAAAADeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAADWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAHQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAABWQAAAAACeQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAACWQAAAAACeQAAAAAAaQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAeQAAAAAAWQAAAAACWQAAAAAB
+          tiles: WQAAAAADWQAAAAABeQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAADWQAAAAAAWQAAAAACeQAAAAAAWQAAAAACWQAAAAACWQAAAAABWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAABeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAABeQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADdgAAAAACdgAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAACeQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAABeQAAAAAAWQAAAAABWQAAAAACdgAAAAAAdgAAAAADeQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABeQAAAAAAWQAAAAABWQAAAAAAdgAAAAADdgAAAAACeQAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAACWQAAAAACeQAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAADeQAAAAAAWQAAAAABWQAAAAACdgAAAAAAdgAAAAACeQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAABeQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAACWQAAAAACWQAAAAABeQAAAAAAWQAAAAACWQAAAAACWQAAAAABWQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAAAWQAAAAABWQAAAAABeQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAACWQAAAAABeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAABeQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAACWQAAAAACWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAABeQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAACWQAAAAADWQAAAAACWQAAAAABWQAAAAACWQAAAAACeQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAACWQAAAAACWQAAAAABWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAHQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAABWQAAAAABWQAAAAABeQAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAACWQAAAAADeQAAAAAAaQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAWQAAAAAAWQAAAAAA
           version: 6
         1,-2:
           ind: 1,-2
-          tiles: WQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAHQAAAAACHQAAAAACHQAAAAAAHQAAAAACHQAAAAACeQAAAAAAbAAAAAAAbAAAAAABbAAAAAAAbAAAAAADeQAAAAAAbAAAAAACbAAAAAABbAAAAAAAWQAAAAACeQAAAAAAHQAAAAAAHQAAAAACHQAAAAACHQAAAAACHQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAbAAAAAADbAAAAAACbAAAAAAAbAAAAAAAbAAAAAACbAAAAAACWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAABbAAAAAABbAAAAAADbAAAAAABbAAAAAACbAAAAAADbAAAAAAAWQAAAAABbAAAAAACbAAAAAAAbAAAAAAAbAAAAAACbAAAAAADbAAAAAADeQAAAAAAbAAAAAABbAAAAAABbAAAAAAAbAAAAAADeQAAAAAAbAAAAAABbAAAAAAAbAAAAAADWQAAAAABeQAAAAAAbAAAAAACbAAAAAADbAAAAAABbAAAAAABbAAAAAADeQAAAAAAeQAAAAAAbAAAAAADbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAbAAAAAABbAAAAAAAbAAAAAAAbAAAAAABbAAAAAACbAAAAAABbAAAAAADbAAAAAAAbAAAAAAAbAAAAAACbAAAAAADbAAAAAACWQAAAAABeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAADbAAAAAAAbAAAAAACbAAAAAADbAAAAAADbAAAAAADbAAAAAAAbAAAAAABbAAAAAABbAAAAAADbAAAAAACbAAAAAACWQAAAAACeQAAAAAAeQAAAAAAbAAAAAAAeQAAAAAAbAAAAAADeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAADbAAAAAADbAAAAAAAbAAAAAADbAAAAAAAbAAAAAABbAAAAAADWQAAAAADeQAAAAAAWQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAABeQAAAAAAbAAAAAABbAAAAAADbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAACeQAAAAAAWQAAAAADeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAACeQAAAAAAbAAAAAABbAAAAAAAbAAAAAACbAAAAAADWQAAAAACeQAAAAAAWQAAAAAAWQAAAAAAbAAAAAACHQAAAAADHQAAAAACeQAAAAAAbAAAAAACbAAAAAABbAAAAAADbAAAAAAAbAAAAAACbAAAAAADbAAAAAADbAAAAAABWQAAAAACeQAAAAAAbAAAAAAAbAAAAAABbAAAAAACHQAAAAACHQAAAAACbAAAAAADbAAAAAABbAAAAAADbAAAAAAAbAAAAAAAbAAAAAADbAAAAAAAbAAAAAADbAAAAAACWQAAAAACeQAAAAAAHQAAAAACHQAAAAAAbAAAAAACHQAAAAABHQAAAAABeQAAAAAAbAAAAAAAbAAAAAADbAAAAAABbAAAAAAAbAAAAAADbAAAAAABbAAAAAACbAAAAAACWQAAAAABeQAAAAAAHQAAAAABHQAAAAADbAAAAAACHQAAAAADHQAAAAABbAAAAAAAbAAAAAAAbAAAAAABbAAAAAADbAAAAAADbAAAAAADbAAAAAAAbAAAAAABbAAAAAABWQAAAAACeQAAAAAAHQAAAAADHQAAAAACbAAAAAAAHQAAAAACHQAAAAABeQAAAAAAbAAAAAACbAAAAAACbAAAAAADbAAAAAADbAAAAAACbAAAAAACbAAAAAAAbAAAAAAC
+          tiles: WQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACeQAAAAAAHQAAAAADHQAAAAADHQAAAAAAHQAAAAAAHQAAAAACeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAADbAAAAAACeQAAAAAAbAAAAAACbAAAAAACbAAAAAABWQAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAADHQAAAAADHQAAAAABeQAAAAAAbAAAAAACbAAAAAAAbAAAAAACbAAAAAACbAAAAAAAbAAAAAAAbAAAAAABbAAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAACbAAAAAACbAAAAAADbAAAAAABbAAAAAAAbAAAAAABbAAAAAACWQAAAAADbAAAAAAAbAAAAAACbAAAAAABbAAAAAACbAAAAAADbAAAAAACeQAAAAAAbAAAAAABbAAAAAADbAAAAAAAbAAAAAACeQAAAAAAbAAAAAADbAAAAAACbAAAAAABWQAAAAADeQAAAAAAbAAAAAADbAAAAAADbAAAAAAAbAAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAbAAAAAAAbAAAAAADbAAAAAAAbAAAAAADbAAAAAADbAAAAAADbAAAAAABbAAAAAACbAAAAAABbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAABbAAAAAADWQAAAAADeQAAAAAAbAAAAAACbAAAAAADbAAAAAADbAAAAAAAbAAAAAAAbAAAAAABbAAAAAACbAAAAAAAbAAAAAABbAAAAAAAbAAAAAAAbAAAAAABbAAAAAADbAAAAAACWQAAAAABeQAAAAAAeQAAAAAAbAAAAAAAeQAAAAAAbAAAAAABeQAAAAAAeQAAAAAAbAAAAAABbAAAAAADbAAAAAAAbAAAAAADbAAAAAABbAAAAAACbAAAAAACbAAAAAADWQAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAACWQAAAAABWQAAAAADeQAAAAAAbAAAAAABbAAAAAAAbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAACeQAAAAAAWQAAAAACeQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAbAAAAAABbAAAAAADeQAAAAAAbAAAAAABbAAAAAABbAAAAAACbAAAAAACWQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAbAAAAAAAHQAAAAADHQAAAAABeQAAAAAAbAAAAAACbAAAAAAAbAAAAAACbAAAAAADbAAAAAAAbAAAAAABbAAAAAABbAAAAAAAWQAAAAADeQAAAAAAbAAAAAADbAAAAAACbAAAAAAAHQAAAAAAHQAAAAABbAAAAAAAbAAAAAABbAAAAAABbAAAAAAAbAAAAAACbAAAAAACbAAAAAAAbAAAAAAAbAAAAAACWQAAAAADeQAAAAAAHQAAAAAAHQAAAAACbAAAAAACHQAAAAADHQAAAAAAeQAAAAAAbAAAAAAAbAAAAAADbAAAAAABbAAAAAABbAAAAAADbAAAAAADbAAAAAACbAAAAAADWQAAAAADeQAAAAAAHQAAAAADHQAAAAADbAAAAAABHQAAAAAAHQAAAAADbAAAAAAAbAAAAAABbAAAAAADbAAAAAACbAAAAAAAbAAAAAABbAAAAAAAbAAAAAACbAAAAAADWQAAAAADeQAAAAAAHQAAAAAAHQAAAAAAbAAAAAACHQAAAAACHQAAAAABeQAAAAAAbAAAAAACbAAAAAADbAAAAAADbAAAAAAAbAAAAAABbAAAAAABbAAAAAAAbAAAAAAD
           version: 6
         0,-2:
           ind: 0,-2
-          tiles: WQAAAAABWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAHQAAAAACHQAAAAAAHQAAAAAAdgAAAAADHQAAAAADHQAAAAACHQAAAAADeQAAAAAAWQAAAAACWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAdgAAAAACdgAAAAAAdgAAAAADdgAAAAAAdgAAAAACdgAAAAADdgAAAAACeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAABeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAdgAAAAACdgAAAAAAdgAAAAACdgAAAAACdgAAAAABdgAAAAAAdgAAAAADHQAAAAADWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAHQAAAAABHQAAAAADHQAAAAACdgAAAAACHQAAAAABHQAAAAACHQAAAAABeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAMQAAAAAAMQAAAAAAMQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAWQAAAAACWQAAAAACHQAAAAACHQAAAAADeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAdgAAAAACdgAAAAACdgAAAAABeQAAAAAALAAAAAAAeQAAAAAAHQAAAAADeQAAAAAAWQAAAAADWQAAAAACHQAAAAACHQAAAAACeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAdgAAAAACdgAAAAAAdgAAAAAAeQAAAAAALAAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAHQAAAAAAHQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAdgAAAAACdgAAAAABdgAAAAADLAAAAAAALAAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAWQAAAAABWQAAAAADHQAAAAACHQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAWQAAAAABWQAAAAACHQAAAAAAHQAAAAADeQAAAAAAeAAAAAAAeQAAAAAAdgAAAAACdgAAAAABdgAAAAAAdgAAAAADdgAAAAACdgAAAAACdgAAAAADHQAAAAABeQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAAAdgAAAAAAdgAAAAAAdgAAAAABdgAAAAABdgAAAAADHQAAAAAAeQAAAAAAWQAAAAABWQAAAAACHQAAAAADLQAAAAACHQAAAAABHQAAAAADHQAAAAACdgAAAAADdgAAAAABdgAAAAACdgAAAAACdgAAAAADdgAAAAACdgAAAAACHQAAAAADeQAAAAAAWQAAAAAAWQAAAAAB
+          tiles: WQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAHQAAAAADHQAAAAAAHQAAAAABdgAAAAADHQAAAAABHQAAAAABHQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAdgAAAAABdgAAAAAAdgAAAAACdgAAAAAAdgAAAAACdgAAAAADdgAAAAACeQAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAdgAAAAAAdgAAAAACdgAAAAABdgAAAAADdgAAAAABdgAAAAABdgAAAAAAHQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAAAdgAAAAAAHQAAAAACHQAAAAAAHQAAAAACeQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAMQAAAAAAMQAAAAAAMQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAWQAAAAACWQAAAAADHQAAAAADHQAAAAADeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAdgAAAAAAdgAAAAACdgAAAAACeQAAAAAALAAAAAAAeQAAAAAAHQAAAAADeQAAAAAAWQAAAAAAWQAAAAACHQAAAAAAHQAAAAABeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAdgAAAAADdgAAAAABdgAAAAABeQAAAAAALAAAAAAAeQAAAAAAHQAAAAABeQAAAAAAWQAAAAABWQAAAAABHQAAAAADHQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAdgAAAAAAdgAAAAABdgAAAAACLAAAAAAALAAAAAAAeQAAAAAAHQAAAAACeQAAAAAAWQAAAAAAWQAAAAADHQAAAAAAHQAAAAACeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAWQAAAAACWQAAAAABHQAAAAAAHQAAAAACeQAAAAAAeAAAAAAAeQAAAAAAdgAAAAADdgAAAAAAdgAAAAACdgAAAAAAdgAAAAADdgAAAAACdgAAAAACHQAAAAABeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAADdgAAAAACdgAAAAABdgAAAAABdgAAAAABdgAAAAACHQAAAAACeQAAAAAAWQAAAAAAWQAAAAAAHQAAAAABLQAAAAADHQAAAAABHQAAAAAAHQAAAAACdgAAAAAAdgAAAAACdgAAAAACdgAAAAACdgAAAAABdgAAAAABdgAAAAABHQAAAAABeQAAAAAAWQAAAAACWQAAAAAA
           version: 6
         -1,-2:
           ind: -1,-2
-          tiles: WQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAACWQAAAAADWQAAAAABWQAAAAACWQAAAAACWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAACeQAAAAAAHQAAAAABdgAAAAADdgAAAAAAdgAAAAADHQAAAAACeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAACLwAAAAAAWQAAAAABeQAAAAAAHQAAAAAAdgAAAAADdgAAAAAAdgAAAAAAHQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAACLwAAAAAAWQAAAAADeQAAAAAAHQAAAAADdgAAAAABdgAAAAAAdgAAAAACHQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAAALwAAAAAAWQAAAAADeQAAAAAAHQAAAAABdgAAAAACdgAAAAADdgAAAAABHQAAAAACeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAABLwAAAAAAWQAAAAACeQAAAAAAHQAAAAACdgAAAAADdgAAAAACdgAAAAABHQAAAAACeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACWQAAAAAAWQAAAAACWQAAAAABWQAAAAABHQAAAAAAdgAAAAAAdgAAAAABdgAAAAACHQAAAAABeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAHQAAAAABHQAAAAABHQAAAAABWQAAAAADeQAAAAAAWQAAAAACeQAAAAAAHQAAAAAAdgAAAAAAdgAAAAAAdgAAAAADHQAAAAABeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAHQAAAAACHQAAAAADHQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAACHQAAAAACeQAAAAAAAAAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAACHQAAAAADeQAAAAAAeAAAAAAAeQAAAAAAHQAAAAACHQAAAAADHQAAAAAAWQAAAAACeQAAAAAAHQAAAAAAHQAAAAABHQAAAAABHQAAAAABHQAAAAABHQAAAAABHQAAAAACHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACWQAAAAABeQAAAAAAHQAAAAACHQAAAAABHQAAAAAAHQAAAAAAHQAAAAADHQAAAAACHQAAAAABHQAAAAABHQAAAAACHQAAAAAAHQAAAAADLQAAAAACHQAAAAABLQAAAAAC
+          tiles: WQAAAAACWQAAAAADWQAAAAADWQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAABWQAAAAADWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACWQAAAAADeQAAAAAAHQAAAAACdgAAAAABdgAAAAACdgAAAAADHQAAAAACeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAAALwAAAAAAWQAAAAAAeQAAAAAAHQAAAAAAdgAAAAAAdgAAAAAAdgAAAAADHQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAAALwAAAAAAWQAAAAABeQAAAAAAHQAAAAAAdgAAAAAAdgAAAAADdgAAAAADHQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAACLwAAAAAAWQAAAAADeQAAAAAAHQAAAAACdgAAAAADdgAAAAAAdgAAAAABHQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAADLwAAAAAAWQAAAAAAeQAAAAAAHQAAAAAAdgAAAAACdgAAAAABdgAAAAACHQAAAAACeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABWQAAAAAAWQAAAAABWQAAAAADWQAAAAADHQAAAAACdgAAAAADdgAAAAAAdgAAAAADHQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAHQAAAAACHQAAAAACHQAAAAACWQAAAAADeQAAAAAAWQAAAAABeQAAAAAAHQAAAAADdgAAAAACdgAAAAACdgAAAAABHQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAHQAAAAAAHQAAAAADHQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAACeQAAAAAAAAAAAAAAeQAAAAAAHQAAAAADHQAAAAADHQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAAAHQAAAAACeQAAAAAAeAAAAAAAeQAAAAAAHQAAAAABHQAAAAABHQAAAAAAWQAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAACHQAAAAABHQAAAAABHQAAAAABHQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADWQAAAAABeQAAAAAAHQAAAAACHQAAAAAAHQAAAAABHQAAAAACHQAAAAABHQAAAAAAHQAAAAABHQAAAAAAHQAAAAAAHQAAAAABHQAAAAABLQAAAAADHQAAAAADLQAAAAAC
           version: 6
         -2,0:
           ind: -2,0
-          tiles: HQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAHQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAAeQAAAAAAaAAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAABWQAAAAABeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAEQAAAAAAWQAAAAABeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAEQAAAAAAWQAAAAADeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAEQAAAAAAEQAAAAAAWQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAQAAAAAAAeQAAAAAAQAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAQAAAAAAAQAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAQAAAAAAAQAAAAAAAQAAAAAAAQAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: HQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAHQAAAAABeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAAeQAAAAAAaAAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAADWQAAAAACeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAEQAAAAAAWQAAAAADeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAEQAAAAAAWQAAAAABeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAEQAAAAAAEQAAAAAAWQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAQAAAAAAAeQAAAAAAQAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAQAAAAAAAQAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAQAAAAAAAQAAAAAAAQAAAAAAAQAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         -2,-3:
           ind: -2,-3
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAADWQAAAAADeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAACWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAACWQAAAAACWQAAAAADeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         -1,-3:
           ind: -1,-3
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAWQAAAAACWQAAAAABaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAWQAAAAADWQAAAAADAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAACWQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAABeQAAAAAAWQAAAAADWQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAeQAAAAAAWQAAAAADWQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAAAHQAAAAABHQAAAAACHQAAAAABHQAAAAACHQAAAAACeQAAAAAAWQAAAAAAWQAAAAADAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAADHQAAAAABHQAAAAAAHQAAAAACHQAAAAACHQAAAAABHQAAAAACeQAAAAAAWQAAAAADWQAAAAACAAAAAAAAeQAAAAAAHQAAAAAAHQAAAAABeQAAAAAAHQAAAAABHQAAAAAAHQAAAAADHQAAAAADHQAAAAAAHQAAAAACHQAAAAAAHQAAAAACeQAAAAAAWQAAAAAAWQAAAAADAAAAAAAAeQAAAAAAHQAAAAADHQAAAAACHQAAAAABHQAAAAAAHQAAAAADHQAAAAACHQAAAAACHQAAAAABHQAAAAAAHQAAAAADHQAAAAADHQAAAAABWQAAAAABWQAAAAAAAAAAAAAAeQAAAAAAHQAAAAAAHQAAAAADeQAAAAAAHQAAAAADHQAAAAACHQAAAAADHQAAAAACHQAAAAACHQAAAAABHQAAAAABHQAAAAADeQAAAAAAWQAAAAAAWQAAAAADAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAACHQAAAAACHQAAAAACHQAAAAAAHQAAAAACHQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAACHQAAAAACHQAAAAADHQAAAAABHQAAAAADHQAAAAACHQAAAAAAHQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAB
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAWQAAAAAAWQAAAAABaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAWQAAAAABWQAAAAACAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAADWQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAADeQAAAAAAWQAAAAADWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAABeQAAAAAAWQAAAAADWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAADHQAAAAABHQAAAAACHQAAAAACHQAAAAADHQAAAAACHQAAAAACHQAAAAABeQAAAAAAWQAAAAABWQAAAAADAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAAAHQAAAAABHQAAAAABHQAAAAACHQAAAAABHQAAAAACHQAAAAADeQAAAAAAWQAAAAAAWQAAAAAAAAAAAAAAeQAAAAAAHQAAAAABHQAAAAABeQAAAAAAHQAAAAACHQAAAAACHQAAAAABHQAAAAACHQAAAAADHQAAAAAAHQAAAAACHQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAAAAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAABHQAAAAABHQAAAAACHQAAAAADHQAAAAACHQAAAAABHQAAAAAAHQAAAAADHQAAAAADHQAAAAACWQAAAAABWQAAAAAAAAAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAeQAAAAAAHQAAAAADHQAAAAACHQAAAAAAHQAAAAADHQAAAAACHQAAAAADHQAAAAADHQAAAAADeQAAAAAAWQAAAAABWQAAAAACAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAABHQAAAAAAHQAAAAADHQAAAAABHQAAAAAAHQAAAAADHQAAAAADeQAAAAAAWQAAAAABWQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAABHQAAAAADHQAAAAACHQAAAAAAHQAAAAADHQAAAAABHQAAAAAAHQAAAAABeQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAA
           version: 6
         0,-3:
           ind: 0,-3
-          tiles: WQAAAAAAWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAWQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAWQAAAAABWQAAAAABeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAADeQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAABWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAADeQAAAAAAWQAAAAACWQAAAAADeQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAABeQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABeQAAAAAAdwAAAAAAdgAAAAACdgAAAAACdgAAAAADdwAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAADWQAAAAADeQAAAAAAdwAAAAACdgAAAAAAdgAAAAADdgAAAAADdwAAAAADaQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAAAWQAAAAABWQAAAAACeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAABeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAHQAAAAABeQAAAAAAHQAAAAABHQAAAAAD
+          tiles: WQAAAAABWQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAABWQAAAAADaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAWQAAAAACWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAACeQAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAADeQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAACeQAAAAAAWQAAAAADWQAAAAACeQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAABWQAAAAACeQAAAAAAdwAAAAADdgAAAAAAdgAAAAAAdgAAAAAAdwAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAACeQAAAAAAdwAAAAADdgAAAAAAdgAAAAABdgAAAAAAdwAAAAACaQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAABeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADHQAAAAADeQAAAAAAHQAAAAADHQAAAAAD
           version: 6
         1,-3:
           ind: 1,-3
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAATgAAAAAATgAAAAAATgAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAATgAAAAAATgAAAAAATgAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdQAAAAAAdQAAAAABdQAAAAABdQAAAAABdQAAAAACeQAAAAAALAAAAAAALAAAAAAALAAAAAAAeQAAAAAAbAAAAAACbAAAAAAAbAAAAAACbAAAAAABeQAAAAAAeQAAAAAAdQAAAAABdQAAAAAAdQAAAAACdQAAAAADdQAAAAACWQAAAAADLAAAAAAALAAAAAAALAAAAAAAeQAAAAAAbAAAAAABbAAAAAADbAAAAAAAbAAAAAAAeQAAAAAAaQAAAAAAdQAAAAAAdQAAAAADdQAAAAABdQAAAAACdQAAAAAAeQAAAAAALAAAAAAALAAAAAAALAAAAAAAeQAAAAAAbAAAAAADWQAAAAACWQAAAAADWQAAAAACaQAAAAAAeQAAAAAAJgAAAAACJgAAAAABdQAAAAACJgAAAAACJgAAAAABeQAAAAAALAAAAAAALAAAAAAALAAAAAAAbAAAAAACbAAAAAADWQAAAAAAWQAAAAABWQAAAAADHQAAAAAAeQAAAAAAJgAAAAAAJgAAAAABdQAAAAAAJgAAAAAAJgAAAAABeQAAAAAAUgAAAAAALAAAAAAALAAAAAAAeQAAAAAAbAAAAAABWQAAAAACWQAAAAACWQAAAAAD
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAATgAAAAAATgAAAAAATgAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAATgAAAAAATgAAAAAATgAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdQAAAAACdQAAAAAAdQAAAAAAdQAAAAACdQAAAAACeQAAAAAALAAAAAAALAAAAAAALAAAAAAAeQAAAAAAbAAAAAACbAAAAAACbAAAAAAAbAAAAAABeQAAAAAAeQAAAAAAdQAAAAACdQAAAAADdQAAAAACdQAAAAAAdQAAAAABWQAAAAABLAAAAAAALAAAAAAALAAAAAAAeQAAAAAAbAAAAAABbAAAAAADbAAAAAABbAAAAAAAeQAAAAAAaQAAAAAAdQAAAAADdQAAAAAAdQAAAAAAdQAAAAABdQAAAAACeQAAAAAALAAAAAAALAAAAAAALAAAAAAAeQAAAAAAbAAAAAABWQAAAAAAWQAAAAADWQAAAAACaQAAAAAAeQAAAAAAJgAAAAACJgAAAAADdQAAAAADJgAAAAAAJgAAAAACeQAAAAAALAAAAAAALAAAAAAALAAAAAAAbAAAAAADbAAAAAAAWQAAAAABWQAAAAABWQAAAAABHQAAAAAAeQAAAAAAJgAAAAABJgAAAAAAdQAAAAABJgAAAAAAJgAAAAACeQAAAAAAUgAAAAAALAAAAAAALAAAAAAAeQAAAAAAbAAAAAACWQAAAAACWQAAAAADWQAAAAAC
           version: 6
         1,0:
           ind: 1,0
-          tiles: eQAAAAAAeQAAAAAADgAAAAACeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAAAHQAAAAAAHQAAAAACeQAAAAAAdgAAAAACdgAAAAAAdgAAAAABUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAGQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAADgAAAAABeQAAAAAAeQAAAAAAdgAAAAADdgAAAAADdgAAAAADEAAAAAAAeQAAAAAAEAAAAAAAeQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAeQAAAAAADgAAAAABDgAAAAADDgAAAAADDgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEAAAAAAAeQAAAAAAEAAAAAAAeQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAeQAAAAAADgAAAAACDgAAAAADDgAAAAADDgAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAACeQAAAAAADgAAAAAADgAAAAAADgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAQQAAAAAAQQAAAAAAQQAAAAAAWQAAAAAADgAAAAADDgAAAAAADgAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAQQAAAAAAQQAAAAAAQQAAAAAAeQAAAAAADgAAAAABDgAAAAACDgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAVwAAAAAAVwAAAAAJVwAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAVwAAAAAAVwAAAAAAVwAAAAAAWQAAAAACWQAAAAADeQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAACWQAAAAADWQAAAAAAeQAAAAAAVwAAAAAAVwAAAAAADQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAACHQAAAAAAHQAAAAACHQAAAAACHQAAAAACWQAAAAACWQAAAAADWQAAAAADWQAAAAACVwAAAAAADQAAAAAADQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAADWQAAAAABHQAAAAACHQAAAAAAHQAAAAABHQAAAAADWQAAAAABWQAAAAADWQAAAAADeQAAAAAAVwAAAAAADQAAAAAADQAAAAAAWQAAAAADWQAAAAACeQAAAAAAWQAAAAADWQAAAAACHQAAAAADHQAAAAADHQAAAAABHQAAAAADWQAAAAAAWQAAAAABWQAAAAADeQAAAAAAVwAAAAAADQAAAAAADQAAAAAAFAAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABHQAAAAACHQAAAAACHQAAAAAAHQAAAAACWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABVwAAAAAEDQAAAAAADQAAAAAAFAAAAAAAFAAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAADeQAAAAAAVwAAAAAADQAAAAAADQAAAAAAFAAAAAAAFAAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAVwAAAAAAVwAAAAAADQAAAAAA
+          tiles: eQAAAAAAeQAAAAAADgAAAAADeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAAAHQAAAAADHQAAAAACeQAAAAAAdgAAAAABdgAAAAABdgAAAAABUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAGQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAADgAAAAACeQAAAAAAeQAAAAAAdgAAAAACdgAAAAABdgAAAAACEAAAAAAAeQAAAAAAEAAAAAAAeQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAeQAAAAAADgAAAAACDgAAAAAADgAAAAAADgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEAAAAAAAeQAAAAAAEAAAAAAAeQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAeQAAAAAADgAAAAAADgAAAAAADgAAAAADDgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAABeQAAAAAADgAAAAACDgAAAAABDgAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAQQAAAAAAQQAAAAAAQQAAAAAAWQAAAAABDgAAAAACDgAAAAAADgAAAAABeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAQQAAAAAAQQAAAAAAQQAAAAAAeQAAAAAADgAAAAADDgAAAAACDgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAABeQAAAAAAeQAAAAAAVwAAAAAAVwAAAAAAVwAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAADWQAAAAACWQAAAAACWQAAAAACWQAAAAACeQAAAAAAVwAAAAAAVwAAAAAAVwAAAAAAWQAAAAADWQAAAAACeQAAAAAAWQAAAAABWQAAAAACWQAAAAACWQAAAAADWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAABeQAAAAAAVwAAAAAAVwAAAAAADQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAABHQAAAAAAHQAAAAAAHQAAAAABHQAAAAACWQAAAAACWQAAAAABWQAAAAAAWQAAAAAAVwAAAAAADQAAAAAADQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAACWQAAAAAAHQAAAAADHQAAAAADHQAAAAABHQAAAAAAWQAAAAADWQAAAAABWQAAAAABeQAAAAAAVwAAAAAADQAAAAAADQAAAAAAWQAAAAACWQAAAAADeQAAAAAAWQAAAAAAWQAAAAAAHQAAAAABHQAAAAAAHQAAAAADHQAAAAABWQAAAAADWQAAAAACWQAAAAADeQAAAAAAVwAAAAAADQAAAAAADQAAAAAAFAAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACHQAAAAACHQAAAAABHQAAAAACHQAAAAABWQAAAAACWQAAAAADWQAAAAABWQAAAAAAVwAAAAAADQAAAAAADQAAAAAAFAAAAAAAFAAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAABWQAAAAABeQAAAAAAVwAAAAAADQAAAAAADQAAAAAAFAAAAAAAFAAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAACeQAAAAAAVwAAAAAAVwAAAAAADQAAAAAA
           version: 6
         0,1:
           ind: 0,1
-          tiles: WQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAAAeQAAAAAAHQAAAAABHQAAAAADHQAAAAABHQAAAAACWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAABHQAAAAABHQAAAAAAHQAAAAACHQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAWQAAAAABeQAAAAAAHQAAAAADHQAAAAACHQAAAAADHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAACHQAAAAADeQAAAAAAHQAAAAAAHQAAAAABHQAAAAAAWQAAAAABWQAAAAABWQAAAAACeQAAAAAAHQAAAAADHQAAAAACHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACdgAAAAAAeQAAAAAAHQAAAAADHQAAAAADHQAAAAACWQAAAAACWQAAAAABWQAAAAACeQAAAAAAHQAAAAADHQAAAAAAHQAAAAADeQAAAAAAdgAAAAACdgAAAAADdgAAAAADdgAAAAABeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAdgAAAAADdgAAAAACdgAAAAABdgAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAAAWQAAAAADeQAAAAAAdgAAAAAAdgAAAAADdgAAAAABdgAAAAADWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAWQAAAAABWQAAAAADdgAAAAADdgAAAAADdgAAAAAAdgAAAAABWQAAAAACWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAADWQAAAAACWQAAAAACWQAAAAABWQAAAAADWQAAAAADeQAAAAAAdgAAAAACdgAAAAADdgAAAAACdgAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAAAWQAAAAABUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAAD
+          tiles: WQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAABWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAAAWQAAAAABeQAAAAAAHQAAAAACHQAAAAABHQAAAAAAHQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAADWQAAAAADHQAAAAACHQAAAAADHQAAAAABHQAAAAADWQAAAAACWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAeQAAAAAAHQAAAAACHQAAAAAAHQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAABHQAAAAADHQAAAAACeQAAAAAAHQAAAAADHQAAAAACHQAAAAABWQAAAAADWQAAAAADWQAAAAADeQAAAAAAHQAAAAABHQAAAAABHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACdgAAAAABeQAAAAAAHQAAAAAAHQAAAAABHQAAAAAAWQAAAAACWQAAAAACWQAAAAABeQAAAAAAHQAAAAAAHQAAAAABHQAAAAAAeQAAAAAAdgAAAAADdgAAAAAAdgAAAAACdgAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAdgAAAAADdgAAAAAAdgAAAAAAdgAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAACeQAAAAAAdgAAAAAAdgAAAAAAdgAAAAADdgAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAABdgAAAAAAdgAAAAACdgAAAAACdgAAAAADWQAAAAACWQAAAAADWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAADWQAAAAACWQAAAAADWQAAAAACeQAAAAAAdgAAAAACdgAAAAABdgAAAAADdgAAAAABeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAABWQAAAAABUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAAB
           version: 6
         -1,1:
           ind: -1,1
-          tiles: eQAAAAAAdgAAAAABdgAAAAACdgAAAAACdgAAAAADdgAAAAAAeQAAAAAAdgAAAAACdgAAAAABdgAAAAABdgAAAAADdgAAAAABdgAAAAABeQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAdgAAAAACdgAAAAADdgAAAAABdgAAAAABdgAAAAABeQAAAAAAdgAAAAADdgAAAAACdgAAAAABdgAAAAABdgAAAAABdgAAAAACeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAADWQAAAAADWQAAAAADWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAABeQAAAAAAWQAAAAACWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAADWQAAAAABWQAAAAACWQAAAAABeQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAACWQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAAAWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAADHQAAAAAAHQAAAAAAHQAAAAACHQAAAAACHQAAAAAAeQAAAAAAHQAAAAACUAAAAAAAUAAAAAAAWQAAAAAAWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACHQAAAAAAHQAAAAACHQAAAAACHQAAAAABHQAAAAADeQAAAAAAWQAAAAABUAAAAAAAUAAAAAAAWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAHQAAAAABHQAAAAADHQAAAAAAHQAAAAAAHQAAAAACeQAAAAAAWQAAAAAAUAAAAAAAUAAAAAAAWQAAAAAAWQAAAAADWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAA
+          tiles: eQAAAAAAdgAAAAAAdgAAAAAAdgAAAAACdgAAAAADdgAAAAAAeQAAAAAAdgAAAAACdgAAAAABdgAAAAABdgAAAAADdgAAAAADdgAAAAACeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAdgAAAAABdgAAAAABdgAAAAAAdgAAAAABdgAAAAABeQAAAAAAdgAAAAACdgAAAAACdgAAAAAAdgAAAAABdgAAAAAAdgAAAAADeQAAAAAAWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAADWQAAAAADWQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAADWQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAABeQAAAAAAWQAAAAADWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAACeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAACWQAAAAADWQAAAAACWQAAAAACWQAAAAADWQAAAAABWQAAAAABeQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAADWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACHQAAAAAAHQAAAAACHQAAAAACHQAAAAADHQAAAAABeQAAAAAAHQAAAAABUAAAAAAAUAAAAAAAWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABHQAAAAADHQAAAAABHQAAAAAAHQAAAAABHQAAAAAAeQAAAAAAWQAAAAABUAAAAAAAUAAAAAAAWQAAAAABWQAAAAADWQAAAAACeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAHQAAAAABHQAAAAABHQAAAAADHQAAAAADHQAAAAADeQAAAAAAWQAAAAAAUAAAAAAAUAAAAAAAWQAAAAAAWQAAAAABWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAA
           version: 6
         1,1:
           ind: 1,1
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAVwAAAAAAVwAAAAAAVwAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAHQAAAAADHQAAAAACHQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAHQAAAAABHQAAAAACHQAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAHQAAAAABHQAAAAAAHQAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdgAAAAAAdgAAAAABdgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdgAAAAADdgAAAAABdgAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAdgAAAAAAdgAAAAABdgAAAAACeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAdgAAAAACdgAAAAAAHQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAdgAAAAAAdgAAAAAAHQAAAAADeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAVwAAAAAAVwAAAAACVwAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAHQAAAAADHQAAAAACHQAAAAACHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAHQAAAAABHQAAAAADHQAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAHQAAAAABHQAAAAAAHQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdgAAAAAAdgAAAAABdgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdgAAAAAAdgAAAAABdgAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAdgAAAAADdgAAAAABdgAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAdgAAAAACdgAAAAABHQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAdgAAAAAAdgAAAAAAHQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAWQAAAAACWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         -1,2:
           ind: -1,2
-          tiles: HQAAAAABHQAAAAAAHQAAAAAAHQAAAAACHQAAAAAAeQAAAAAAWQAAAAAALAAAAAAALAAAAAAAWQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAALAAAAAAAeQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAWQAAAAAAWQAAAAADWQAAAAACWQAAAAABeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADeQAAAAAAHQAAAAAAHQAAAAABHQAAAAADHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAADeQAAAAAAHQAAAAACWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAHQAAAAABWQAAAAAATQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAAAHQAAAAADHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAHQAAAAADWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAADHQAAAAAAHQAAAAACeQAAAAAAWQAAAAAAWQAAAAABWQAAAAABeQAAAAAAHQAAAAABHQAAAAADHQAAAAACdgAAAAABdgAAAAABdgAAAAACeQAAAAAAHQAAAAACHQAAAAAAHQAAAAACHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAABdgAAAAAAeQAAAAAAHQAAAAAAHQAAAAADHQAAAAACHQAAAAACeQAAAAAAWQAAAAABWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADdgAAAAACdgAAAAADeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAHQAAAAABHQAAAAABHQAAAAABHQAAAAADHQAAAAAAHQAAAAAAHQAAAAADHQAAAAADHQAAAAAAHQAAAAABHQAAAAADHQAAAAADeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAHQAAAAABHQAAAAADHQAAAAABHQAAAAAAHQAAAAACHQAAAAAAHQAAAAABHQAAAAABHQAAAAACHQAAAAADHQAAAAABHQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAABdgAAAAADdgAAAAADdgAAAAABeQAAAAAAWQAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAeQAAAAAALwAAAAAAHQAAAAAALwAAAAAA
+          tiles: HQAAAAACHQAAAAAAHQAAAAADHQAAAAACHQAAAAACeQAAAAAAWQAAAAACLAAAAAAALAAAAAAAWQAAAAACWQAAAAAAWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACLAAAAAAAeQAAAAAAWQAAAAACWQAAAAADeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAHQAAAAADHQAAAAAAHQAAAAADHQAAAAAAHQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAABeQAAAAAAWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAAAHQAAAAABHQAAAAABHQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAACWQAAAAABWQAAAAAAeQAAAAAAHQAAAAADHQAAAAACHQAAAAAAHQAAAAACHQAAAAADHQAAAAACHQAAAAAAHQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAHQAAAAACWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAABeQAAAAAAHQAAAAABWQAAAAABTQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAADHQAAAAADHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAHQAAAAABWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAACHQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAAAeQAAAAAAHQAAAAAAHQAAAAADHQAAAAACdgAAAAABdgAAAAAAdgAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAAAdgAAAAABeQAAAAAAHQAAAAADHQAAAAABHQAAAAACHQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADdgAAAAABdgAAAAADeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAHQAAAAABHQAAAAAAHQAAAAABHQAAAAADHQAAAAACHQAAAAADHQAAAAAAHQAAAAAAHQAAAAACHQAAAAACHQAAAAABHQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAHQAAAAADHQAAAAAAHQAAAAADHQAAAAACHQAAAAABHQAAAAABHQAAAAABHQAAAAABHQAAAAACHQAAAAADHQAAAAAAHQAAAAABeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAADdgAAAAAAdgAAAAABdgAAAAADeQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAACWQAAAAACWQAAAAADeQAAAAAALwAAAAAAHQAAAAABLwAAAAAA
           version: 6
         0,2:
           ind: 0,2
-          tiles: UAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAACWQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAABHQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAACeQAAAAAAHQAAAAADHQAAAAACHQAAAAAAHQAAAAACeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAADHQAAAAACHQAAAAADHQAAAAACHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAATQAAAAAATQAAAAAATQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAHQAAAAACHQAAAAACHQAAAAAAHQAAAAADHQAAAAADeQAAAAAAHQAAAAADHQAAAAAAHQAAAAADHQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAADWQAAAAACeQAAAAAAHQAAAAABHQAAAAADHQAAAAAAHQAAAAAAHQAAAAACeQAAAAAAdgAAAAABdgAAAAAAdgAAAAABdgAAAAACHQAAAAAAHQAAAAABHQAAAAADHQAAAAADHQAAAAAAeQAAAAAAHQAAAAACHQAAAAADHQAAAAAAHQAAAAADHQAAAAABeQAAAAAAdgAAAAACdgAAAAADdgAAAAABdgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAAAHQAAAAADHQAAAAADHQAAAAAAeQAAAAAAdgAAAAADdgAAAAADdgAAAAACdgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAABHQAAAAADHQAAAAADHQAAAAACeQAAAAAAdgAAAAACdgAAAAACdgAAAAABdgAAAAACeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAHQAAAAADHQAAAAACLwAAAAAAHQAAAAABLwAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: UAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAADWQAAAAACWQAAAAACWQAAAAACWQAAAAACUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAACWQAAAAACWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAeQAAAAAAWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAACHQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAACeQAAAAAAHQAAAAABHQAAAAADHQAAAAAAHQAAAAADeQAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAADWQAAAAACHQAAAAABHQAAAAAAHQAAAAADHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAATQAAAAAATQAAAAAATQAAAAAAWQAAAAAAWQAAAAACWQAAAAABHQAAAAABHQAAAAACHQAAAAACHQAAAAADHQAAAAABeQAAAAAAHQAAAAADHQAAAAAAHQAAAAACHQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAeQAAAAAAHQAAAAADHQAAAAADHQAAAAADHQAAAAADHQAAAAADeQAAAAAAdgAAAAABdgAAAAACdgAAAAABdgAAAAABHQAAAAABHQAAAAACHQAAAAAAHQAAAAACHQAAAAACeQAAAAAAHQAAAAADHQAAAAADHQAAAAACHQAAAAACHQAAAAAAeQAAAAAAdgAAAAABdgAAAAADdgAAAAADdgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAABHQAAAAACHQAAAAAAHQAAAAADeQAAAAAAdgAAAAADdgAAAAADdgAAAAABdgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAAAHQAAAAABHQAAAAAAHQAAAAADeQAAAAAAdgAAAAAAdgAAAAABdgAAAAADdgAAAAADeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAHQAAAAACHQAAAAABLwAAAAAAHQAAAAAALwAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         1,2:
           ind: 1,2
-          tiles: WQAAAAACWQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAADUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAACeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdgAAAAACeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdgAAAAABeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdgAAAAACeQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdgAAAAACeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAACeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAACeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: WQAAAAABWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdgAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdgAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdgAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAACeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdgAAAAABeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAABeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         2,1:
           ind: 2,1
@@ -167,27 +168,27 @@ entities:
           version: 6
         2,0:
           ind: 2,0
-          tiles: PgAAAAAAPgAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAALwAAAAAALwAAAAAALwAAAAAAOgAAAAAAOgAAAAAAOgAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAVwAAAAAAVwAAAAAAVwAAAAAAVwAAAAAAVwAAAAAAVwAAAAABeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAADQAAAAAADQAAAAAAVwAAAAABVwAAAAAAVwAAAAAAVwAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAVwAAAAAAVwAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAVwAAAAAAWQAAAAABWQAAAAACWQAAAAABeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAVwAAAAAAeQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAWQAAAAADWQAAAAADWQAAAAACeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAA
+          tiles: PgAAAAAAPgAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAALwAAAAAALwAAAAAALwAAAAAAOgAAAAAAOgAAAAAAOgAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAVwAAAAAAVwAAAAAJVwAAAAAAVwAAAAAAVwAAAAAHVwAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAADQAAAAAADQAAAAAAVwAAAAAAVwAAAAAAVwAAAAAAVwAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAVwAAAAAAVwAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAVwAAAAAAWQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAVwAAAAAAeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAADQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAA
           version: 6
         -2,1:
           ind: -2,1
-          tiles: eQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAdgAAAAABeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAADdgAAAAABdgAAAAACeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAACWQAAAAAAeQAAAAAAdgAAAAADeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAWQAAAAAAeQAAAAAAdgAAAAADeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAADdgAAAAACeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAA
+          tiles: eQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAdgAAAAADeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAAAdgAAAAADdgAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAdgAAAAACeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAWQAAAAACeQAAAAAAdgAAAAADeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAADdgAAAAABeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAA
           version: 6
         -2,2:
           ind: -2,2
-          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAALAAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAALAAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAALAAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAHQAAAAABHQAAAAADHQAAAAABHQAAAAACHQAAAAABHQAAAAADHQAAAAABHQAAAAADHQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAHQAAAAAAHQAAAAADHQAAAAAAHQAAAAACHQAAAAADHQAAAAADHQAAAAAAHQAAAAAAHQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAA
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAALAAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAALAAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAALAAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAHQAAAAADHQAAAAADHQAAAAACHQAAAAACHQAAAAADHQAAAAADHQAAAAACHQAAAAAAHQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAABHQAAAAABHQAAAAAAHQAAAAABHQAAAAABHQAAAAACHQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAA
           version: 6
         0,3:
           ind: 0,3
-          tiles: HQAAAAACHQAAAAABLwAAAAAAHQAAAAABLwAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAABWQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAACWQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAACWQAAAAACWQAAAAABWQAAAAADWQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: HQAAAAABHQAAAAABLwAAAAAAHQAAAAACLwAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAACeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         -3,0:
           ind: -3,0
-          tiles: eQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAABWQAAAAACWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAACeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAWQAAAAADHQAAAAADeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAABWQAAAAACWQAAAAACWQAAAAACWQAAAAADWQAAAAABeQAAAAAAAAAAAAAAeQAAAAAAWQAAAAACEQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAACeQAAAAAAAAAAAAAAeQAAAAAAWQAAAAADEQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAWQAAAAABEQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAA
+          tiles: eQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAABWQAAAAABWQAAAAACeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAABWQAAAAABeQAAAAAAAAAAAAAAeQAAAAAAWQAAAAACHQAAAAACeQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAACeQAAAAAAAAAAAAAAeQAAAAAAWQAAAAABEQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAAAWQAAAAACeQAAAAAAAAAAAAAAeQAAAAAAWQAAAAABEQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAWQAAAAABEQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeQAAAAAA
           version: 6
         -3,1:
           ind: -3,1
-          tiles: aAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAABeQAAAAAAdgAAAAADdgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACeQAAAAAAdgAAAAABdgAAAAADeQAAAAAAeQAAAAAAdgAAAAACeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAAAeQAAAAAAdgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACeQAAAAAAdgAAAAACeQAAAAAAdgAAAAADeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAdgAAAAADeQAAAAAAdgAAAAABeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAADeQAAAAAAdgAAAAACeQAAAAAAeQAAAAAAdgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAAAdgAAAAABeQAAAAAAdgAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAAAdgAAAAACdgAAAAABdgAAAAADeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: aAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAABeQAAAAAAdgAAAAAAdgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADeQAAAAAAdgAAAAACdgAAAAAAeQAAAAAAeQAAAAAAdgAAAAABeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAAAeQAAAAAAdgAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAeQAAAAAAdgAAAAADeQAAAAAAdgAAAAADeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAdgAAAAABeQAAAAAAdgAAAAACeQAAAAAAeQAAAAAAdgAAAAACdgAAAAACeQAAAAAAdgAAAAAAeQAAAAAAeQAAAAAAdgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAADdgAAAAABeQAAAAAAdgAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAABdgAAAAABdgAAAAAAdgAAAAACeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         -4,1:
           ind: -4,1
@@ -195,15 +196,15 @@ entities:
           version: 6
         -4,0:
           ind: -4,0
-          tiles: WQAAAAABWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAWQAAAAABeQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAWQAAAAABeQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAaAAAAAAAWQAAAAADeQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAA
+          tiles: WQAAAAADWQAAAAABWQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAWQAAAAACeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAWQAAAAACeQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAaAAAAAAAWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         -5,0:
           ind: -5,0
-          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAACeQAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAADWQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAADeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAABeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAeQAAAAAA
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAABeQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAABeQAAAAAAWQAAAAAAWQAAAAADWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAACeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAABeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAADeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADeQAAAAAA
           version: 6
         -5,1:
           ind: -5,1
-          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAACeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAACeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAABeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAACeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAADeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         -6,0:
           ind: -6,0
@@ -211,23 +212,23 @@ entities:
           version: 6
         -5,-1:
           ind: -5,-1
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAACWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAACWQAAAAACWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAAWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAACWQAAAAABWQAAAAADWQAAAAABWQAAAAADWQAAAAABeQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAADeQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAC
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAADWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABWQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAACWQAAAAACWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAAAWQAAAAABWQAAAAABWQAAAAABeQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAAB
           version: 6
         -4,-1:
           ind: -4,-1
-          tiles: WQAAAAADeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEAAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAEAAAAAAAWQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAEAAAAAAAWQAAAAACeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAATwAAAAAATwAAAAAATwAAAAAATwAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAATwAAAAAATwAAAAAATwAAAAAATwAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAATwAAAAAATwAAAAAATwAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAACWQAAAAAAeQAAAAAATwAAAAAATwAAAAAATwAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAACeQAAAAAATwAAAAAATwAAAAAATwAAAAAAeQAAAAAAWQAAAAADeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAADWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAJgAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAACWQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAACWQAAAAACWQAAAAAAWQAAAAADeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAACWQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAAAWQAAAAADeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAACWQAAAAADWQAAAAABWQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAAD
+          tiles: WQAAAAABeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEAAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAEAAAAAAAWQAAAAACeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAEAAAAAAAWQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAATwAAAAAATwAAAAAATwAAAAAATwAAAAAAeQAAAAAAWQAAAAACeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAATwAAAAAATwAAAAAATwAAAAAATwAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAATwAAAAAATwAAAAAATwAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAAAeQAAAAAATwAAAAAATwAAAAAATwAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAAAeQAAAAAATwAAAAAATwAAAAAATwAAAAAAeQAAAAAAWQAAAAABeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAJgAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAABWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAADeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAADWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAADWQAAAAAAWQAAAAAC
           version: 6
         -3,-1:
           ind: -3,-1
-          tiles: eQAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAEAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACEAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAADHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADEAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAADHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAADHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAACWQAAAAACWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAACHQAAAAACeQAAAAAAFQAAAAAAFQAAAAAAFQAAAAAAHQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAHQAAAAAAeQAAAAAAFQAAAAAAFQAAAAAAFQAAAAAAHQAAAAAAHQAAAAAAHQAAAAACHQAAAAADHQAAAAAAHQAAAAADHQAAAAABHQAAAAAAHQAAAAABHQAAAAADHQAAAAADHQAAAAABeQAAAAAAFQAAAAAAFQAAAAAAFQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAFQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAABWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAACWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAAC
+          tiles: eQAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAWQAAAAACEAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAEAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAADHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACEAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAUAAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAAAWQAAAAABHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABWQAAAAABWQAAAAACWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAACWQAAAAACWQAAAAACWQAAAAABWQAAAAACWQAAAAAAWQAAAAABHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAABWQAAAAACWQAAAAACWQAAAAACWQAAAAADWQAAAAACHQAAAAACeQAAAAAAFQAAAAAAFQAAAAAAFQAAAAAAHQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAADWQAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAAAHQAAAAAAeQAAAAAAFQAAAAAAFQAAAAAAFQAAAAAAHQAAAAABHQAAAAACHQAAAAAAHQAAAAACHQAAAAACHQAAAAABHQAAAAACHQAAAAAAHQAAAAACHQAAAAADHQAAAAAAHQAAAAACeQAAAAAAFQAAAAAAFQAAAAAAFQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAFQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAACWQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAADWQAAAAADWQAAAAACWQAAAAACWQAAAAACWQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAAB
           version: 6
         3,0:
           ind: 3,0
-          tiles: OgAAAAAAOgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADdgAAAAABdgAAAAADdgAAAAAAdgAAAAACdgAAAAADeQAAAAAAHQAAAAAAHQAAAAACHQAAAAACPgAAAAAAOgAAAAAAOgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAABdgAAAAAAdgAAAAADdgAAAAAAdgAAAAADeQAAAAAAHQAAAAAAHQAAAAADeQAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADdgAAAAADdgAAAAACdgAAAAADdgAAAAACdgAAAAAAeQAAAAAAHQAAAAAAHQAAAAACeQAAAAAAPgAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAADdgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAUgAAAAAAUgAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAUgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAbAAAAAACWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: OgAAAAAAOgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADdgAAAAABdgAAAAABdgAAAAABdgAAAAACdgAAAAABeQAAAAAAHQAAAAACHQAAAAABHQAAAAADPgAAAAAAOgAAAAAAOgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAADdgAAAAAAdgAAAAACdgAAAAACdgAAAAAAeQAAAAAAHQAAAAACHQAAAAABeQAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAAAdgAAAAABdgAAAAACdgAAAAABdgAAAAAAeQAAAAAAHQAAAAABHQAAAAAAeQAAAAAAPgAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADdgAAAAAAdgAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAUgAAAAAAUgAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAUgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAbAAAAAABWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         2,-1:
           ind: 2,-1
-          tiles: eQAAAAAAbAAAAAACbAAAAAACbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAADWQAAAAACWQAAAAACWQAAAAABWQAAAAACWQAAAAABWQAAAAADWQAAAAABWQAAAAADWQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAABWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAABWQAAAAABWQAAAAACeQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAPAAAAAAAPAAAAAAAPAAAAAAAPAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAWQAAAAABHQAAAAABXAAAAAADXAAAAAADXAAAAAAAXAAAAAADXAAAAAACXAAAAAADXAAAAAABXAAAAAADeQAAAAAAWQAAAAACWQAAAAACWQAAAAABHQAAAAACHQAAAAADWQAAAAAAeQAAAAAAXAAAAAAAXAAAAAACXAAAAAACXAAAAAABXAAAAAAAXAAAAAAAXAAAAAACXAAAAAABeQAAAAAAHQAAAAADWQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAACdgAAAAAAXAAAAAAAXAAAAAAAXAAAAAACXAAAAAACXAAAAAABXAAAAAADXAAAAAADXAAAAAABeQAAAAAAHQAAAAABWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAACeQAAAAAAXAAAAAABXAAAAAADXAAAAAACXAAAAAACXAAAAAADXAAAAAAAXAAAAAAAXAAAAAACWQAAAAABHQAAAAAAWQAAAAAAWQAAAAADHQAAAAACHQAAAAADWQAAAAACHQAAAAADXAAAAAABXAAAAAAAXAAAAAADXAAAAAACXAAAAAADXAAAAAAAXAAAAAADXAAAAAADWQAAAAAAHQAAAAAAWQAAAAAAWQAAAAAAHQAAAAADHQAAAAACWQAAAAAAeQAAAAAAXAAAAAADXAAAAAACXAAAAAACXAAAAAACXAAAAAAAXAAAAAAAXAAAAAAAXAAAAAADWQAAAAADHQAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAHQAAAAADHQAAAAACHQAAAAADHQAAAAACHQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAWQAAAAABLwAAAAAALwAAAAAALwAAAAAAOgAAAAAAOgAAAAAAOgAAAAAA
+          tiles: eQAAAAAAbAAAAAADbAAAAAADbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAACWQAAAAACWQAAAAADWQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAABeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAABWQAAAAACWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAPAAAAAAAPAAAAAAAPAAAAAAAPAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAWQAAAAAAHQAAAAACXAAAAAABXAAAAAACXAAAAAADXAAAAAADXAAAAAABXAAAAAAAXAAAAAAAXAAAAAACeQAAAAAAWQAAAAABWQAAAAABWQAAAAAAHQAAAAABHQAAAAAAWQAAAAAAeQAAAAAAXAAAAAABXAAAAAACXAAAAAABXAAAAAADXAAAAAADXAAAAAACXAAAAAAAXAAAAAADeQAAAAAAHQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAAAWQAAAAAAdgAAAAAAXAAAAAAAXAAAAAABXAAAAAAAXAAAAAAAXAAAAAACXAAAAAADXAAAAAACXAAAAAADeQAAAAAAHQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAADWQAAAAADeQAAAAAAXAAAAAABXAAAAAADXAAAAAAAXAAAAAADXAAAAAAAXAAAAAABXAAAAAABXAAAAAADWQAAAAAAHQAAAAABWQAAAAABWQAAAAACHQAAAAADHQAAAAABWQAAAAADHQAAAAADXAAAAAAAXAAAAAABXAAAAAABXAAAAAADXAAAAAABXAAAAAABXAAAAAAAXAAAAAAAWQAAAAAAHQAAAAADWQAAAAACWQAAAAADHQAAAAACHQAAAAADWQAAAAABeQAAAAAAXAAAAAAAXAAAAAAAXAAAAAACXAAAAAAAXAAAAAABXAAAAAABXAAAAAACXAAAAAACWQAAAAAAHQAAAAADWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAHQAAAAACHQAAAAAAHQAAAAADHQAAAAABHQAAAAACHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAAAAAWQAAAAACLwAAAAAALwAAAAAALwAAAAAAOgAAAAAAOgAAAAAAOgAAAAAA
           version: 6
         3,1:
           ind: 3,1
@@ -235,11 +236,11 @@ entities:
           version: 6
         4,1:
           ind: 4,1
-          tiles: HQAAAAADeQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAADeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAADPgAAAAAAeQAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAADeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: HQAAAAADeQAAAAAAeQAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAABeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAABPgAAAAAAeQAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAABeQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         4,0:
           ind: 4,0
-          tiles: PgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAAAHQAAAAABHQAAAAADCAAAAAAACAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAADHQAAAAADHQAAAAABCAAAAAAACAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAAAHQAAAAAAHQAAAAACHQAAAAABHQAAAAAAHQAAAAABCAAAAAAACAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAACHQAAAAADHQAAAAADHQAAAAAAHQAAAAACCAAAAAAACAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAABHQAAAAADHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAABHQAAAAACHQAAAAAAHQAAAAADHQAAAAABeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAHQAAAAADHQAAAAAAHQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYAAAAAAAeQAAAAAAYAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: PgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAACHQAAAAAAHQAAAAABCAAAAAAACAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAAAHQAAAAABHQAAAAADCAAAAAAACAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAABHQAAAAABHQAAAAAAHQAAAAADHQAAAAACHQAAAAAACAAAAAAACAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAHQAAAAADHQAAAAACHQAAAAACHQAAAAADHQAAAAACCAAAAAAACAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAAAHQAAAAACHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAABHQAAAAACHQAAAAAAHQAAAAADeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAHQAAAAACHQAAAAADHQAAAAADHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYAAAAAAAeQAAAAAAYAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAYAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         5,0:
           ind: 5,0
@@ -247,11 +248,11 @@ entities:
           version: 6
         3,-1:
           ind: 3,-1
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAADWQAAAAACWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAACWQAAAAAAWQAAAAABeQAAAAAAdgAAAAADdgAAAAADdgAAAAABdgAAAAADdgAAAAADdgAAAAAAdgAAAAAAdgAAAAADdgAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAdgAAAAACdgAAAAABdgAAAAACdgAAAAAAdgAAAAAAdgAAAAACdgAAAAADdgAAAAACdgAAAAADdgAAAAAAWQAAAAADHQAAAAADeQAAAAAAWQAAAAABWQAAAAABWQAAAAADdgAAAAACdgAAAAADdgAAAAAAdgAAAAAAdgAAAAAAdgAAAAADdgAAAAAAdgAAAAADdgAAAAABdgAAAAACWQAAAAABHQAAAAABWQAAAAABWQAAAAADWQAAAAACeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAACdgAAAAADdgAAAAAAdgAAAAAAdgAAAAACdgAAAAABdgAAAAADdgAAAAADWQAAAAABHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADdgAAAAACdgAAAAADdgAAAAACdgAAAAADdgAAAAACdgAAAAACdgAAAAACdgAAAAAAdgAAAAACdgAAAAABWQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAADdgAAAAACdgAAAAADdgAAAAABdgAAAAADdgAAAAACdgAAAAABdgAAAAADdgAAAAADdgAAAAACWQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAABdgAAAAABdgAAAAABdgAAAAADdgAAAAAAdgAAAAADeQAAAAAAeQAAAAAAdgAAAAAAeQAAAAAAWQAAAAABHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAAAdgAAAAAAdgAAAAACdgAAAAAAdgAAAAABdgAAAAACeQAAAAAAdgAAAAADdgAAAAACdgAAAAACHQAAAAACHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADdgAAAAACdgAAAAACdgAAAAACdgAAAAAAdgAAAAACdgAAAAABeQAAAAAAdgAAAAABdgAAAAACdgAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAABdgAAAAABdgAAAAABdgAAAAAAdgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAOgAAAAAAOgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAAAdgAAAAADdgAAAAAAdgAAAAADdgAAAAACeQAAAAAAHQAAAAACHQAAAAABeQAAAAAAPgAAAAAA
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAADWQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAACWQAAAAAAWQAAAAACeQAAAAAAdgAAAAABdgAAAAACdgAAAAABdgAAAAACdgAAAAABdgAAAAABdgAAAAABdgAAAAACdgAAAAADWQAAAAABWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAACdgAAAAABdgAAAAACdgAAAAADdgAAAAADdgAAAAABdgAAAAACdgAAAAAAdgAAAAADdgAAAAACdgAAAAAAWQAAAAADHQAAAAABeQAAAAAAWQAAAAAAWQAAAAADWQAAAAADdgAAAAACdgAAAAACdgAAAAABdgAAAAACdgAAAAACdgAAAAADdgAAAAACdgAAAAADdgAAAAAAdgAAAAADWQAAAAAAHQAAAAAAWQAAAAABWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAdgAAAAACdgAAAAAAdgAAAAACdgAAAAAAdgAAAAACdgAAAAAAdgAAAAACdgAAAAADdgAAAAAAWQAAAAADHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAACdgAAAAAAdgAAAAADdgAAAAABdgAAAAABdgAAAAACdgAAAAACdgAAAAADdgAAAAADdgAAAAADWQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAAAdgAAAAACdgAAAAABdgAAAAACdgAAAAAAdgAAAAACdgAAAAABdgAAAAABdgAAAAACdgAAAAACWQAAAAADHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAABdgAAAAAAdgAAAAADdgAAAAABdgAAAAABdgAAAAAAeQAAAAAAeQAAAAAAdgAAAAADeQAAAAAAWQAAAAACHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAADdgAAAAABdgAAAAACdgAAAAADdgAAAAAAdgAAAAAAeQAAAAAAdgAAAAACdgAAAAAAdgAAAAADHQAAAAACHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAAAdgAAAAADdgAAAAADdgAAAAABdgAAAAAAdgAAAAADeQAAAAAAdgAAAAADdgAAAAADdgAAAAACWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAADdgAAAAAAdgAAAAADdgAAAAADdgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAOgAAAAAAOgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAADdgAAAAACdgAAAAACdgAAAAAAdgAAAAABeQAAAAAAHQAAAAABHQAAAAADeQAAAAAAPgAAAAAA
           version: 6
         -5,-2:
           ind: -5,-2
-          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         -4,-2:
           ind: -4,-2
@@ -259,7 +260,7 @@ entities:
           version: 6
         -3,-2:
           ind: -3,-2
-          tiles: AAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAABWQAAAAADWQAAAAADeQAAAAAAWQAAAAAAWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAABWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAADWQAAAAABWQAAAAADWQAAAAACWQAAAAADeQAAAAAAWQAAAAABWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACWQAAAAADWQAAAAACeQAAAAAAdgAAAAACdgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAABeQAAAAAAdgAAAAABdgAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAACWQAAAAACWQAAAAADWQAAAAADeQAAAAAAdgAAAAACdgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAADWQAAAAABeQAAAAAAdgAAAAADdgAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAACWQAAAAACWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAABWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAABWQAAAAACWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAABWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAA
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAADWQAAAAACWQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAACWQAAAAABWQAAAAAAWQAAAAABWQAAAAADeQAAAAAAWQAAAAABWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAADeQAAAAAAWQAAAAAAWQAAAAADAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAADeQAAAAAAdgAAAAACdgAAAAACAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAeQAAAAAAdgAAAAACdgAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAAAeQAAAAAAdgAAAAAAdgAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAACWQAAAAADWQAAAAABWQAAAAADeQAAAAAAdgAAAAACdgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAACWQAAAAADWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAABWQAAAAACWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAADWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEAAAAAAAUAAAAAAAUAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAC
           version: 6
         -3,-3:
           ind: -3,-3
@@ -267,71 +268,71 @@ entities:
           version: 6
         -2,-4:
           ind: -2,-4
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAACWQAAAAADeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABQAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAACWQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAADWQAAAAAAWQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACQAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         -1,-4:
           ind: -1,-4
-          tiles: eQAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAagAAAAADHQAAAAACHQAAAAACHQAAAAACHQAAAAACHQAAAAACHQAAAAABHQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAHQAAAAADHQAAAAAAHQAAAAABHQAAAAADHQAAAAADHQAAAAAAHQAAAAABHQAAAAABeQAAAAAAeQAAAAAATQAAAAAATQAAAAAAeQAAAAAATQAAAAAATQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAABeQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAHQAAAAADHQAAAAAAEQAAAAAAHQAAAAADHQAAAAABEQAAAAAAeQAAAAAAHQAAAAABWQAAAAABWQAAAAADWQAAAAADeQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAACHQAAAAADHQAAAAAAEQAAAAAAHQAAAAABHQAAAAACEQAAAAAAeQAAAAAAHQAAAAADWQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAADHQAAAAACHQAAAAAAEQAAAAAAHQAAAAADHQAAAAABHQAAAAADeQAAAAAAHQAAAAACWQAAAAACWQAAAAAAWQAAAAADeQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAABHQAAAAABEQAAAAAAEQAAAAAAEQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAADeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAEQAAAAAAEQAAAAAAEQAAAAAAEQAAAAAAEQAAAAAAHQAAAAACHQAAAAABHQAAAAABWQAAAAABWQAAAAACWQAAAAABeQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAACHQAAAAACEQAAAAAAEQAAAAAAEQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAADWQAAAAACHQAAAAACHQAAAAABEQAAAAAAHQAAAAAAHQAAAAADHQAAAAAAeQAAAAAAHQAAAAACWQAAAAABWQAAAAADWQAAAAADeQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAABHQAAAAADHQAAAAAAEQAAAAAAHQAAAAACHQAAAAAAEQAAAAAAeQAAAAAAHQAAAAACWQAAAAADWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAHQAAAAABHQAAAAACEQAAAAAAHQAAAAABHQAAAAABEQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAWQAAAAADWQAAAAAD
+          tiles: eQAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAagAAAAAAHQAAAAAAHQAAAAAAHQAAAAACHQAAAAAAHQAAAAACHQAAAAAAHQAAAAADHQAAAAADeQAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAAAHQAAAAABHQAAAAABHQAAAAAAHQAAAAADHQAAAAADeQAAAAAAeQAAAAAATQAAAAAATQAAAAAAeQAAAAAATQAAAAAATQAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAHQAAAAAAHQAAAAADEQAAAAAAHQAAAAAAHQAAAAAAEQAAAAAAeQAAAAAAHQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAHQAAAAABHQAAAAADEQAAAAAAHQAAAAAAHQAAAAABEQAAAAAAeQAAAAAAHQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAHQAAAAADHQAAAAACEQAAAAAAHQAAAAABHQAAAAABHQAAAAAAeQAAAAAAHQAAAAACWQAAAAACWQAAAAADWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAACHQAAAAACEQAAAAAAEQAAAAAAEQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAAAEQAAAAAAEQAAAAAAEQAAAAAAEQAAAAAAEQAAAAAAHQAAAAAAHQAAAAACHQAAAAACWQAAAAABWQAAAAABWQAAAAACeQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAACHQAAAAADEQAAAAAAEQAAAAAAEQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAACHQAAAAABHQAAAAACEQAAAAAAHQAAAAADHQAAAAADHQAAAAABeQAAAAAAHQAAAAABWQAAAAABWQAAAAAAWQAAAAABeQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAACHQAAAAABHQAAAAAAEQAAAAAAHQAAAAAAHQAAAAABEQAAAAAAeQAAAAAAHQAAAAACWQAAAAABWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACHQAAAAACHQAAAAABEQAAAAAAHQAAAAABHQAAAAABEQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAWQAAAAACWQAAAAAB
           version: 6
         0,-4:
           ind: 0,-4
-          tiles: eQAAAAAAYgAAAAADYgAAAAAAYgAAAAACYgAAAAACYgAAAAADYgAAAAADYgAAAAAAYgAAAAACYgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAAAYgAAAAACYgAAAAACYgAAAAACYgAAAAABYgAAAAADYgAAAAABYgAAAAABYgAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAYgAAAAADYgAAAAACYgAAAAAAYgAAAAAAYgAAAAACYgAAAAADYgAAAAABYgAAAAAAYgAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAABYgAAAAADYgAAAAACYgAAAAAAYgAAAAAAYgAAAAABYgAAAAADYgAAAAAAYgAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAAAYgAAAAABYgAAAAADYgAAAAABYgAAAAABYgAAAAABYgAAAAADYgAAAAABYgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABeQAAAAAAYgAAAAACYgAAAAADYgAAAAADYgAAAAAAYgAAAAADYgAAAAAAYgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABYgAAAAAAYgAAAAABYgAAAAACYgAAAAAAYgAAAAACYgAAAAABYgAAAAACYgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACeQAAAAAAYgAAAAACYgAAAAADYgAAAAABYgAAAAADYgAAAAADYgAAAAAAYgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAYgAAAAACYgAAAAAAYgAAAAAAYgAAAAAAYgAAAAAAYgAAAAAAYgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAWQAAAAACeQAAAAAAYgAAAAAAYgAAAAAAYgAAAAABYgAAAAAAYgAAAAADYgAAAAADYgAAAAADYgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAYgAAAAADYgAAAAACYgAAAAABYgAAAAADYgAAAAADYgAAAAAAYgAAAAAAYgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAYgAAAAAAYgAAAAACYgAAAAAAYgAAAAAAYgAAAAABYgAAAAABYgAAAAAAYgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAYgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAADaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: eQAAAAAAYgAAAAAAYgAAAAAAYgAAAAABYgAAAAABYgAAAAAAYgAAAAAAYgAAAAAAYgAAAAABYgAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAABYgAAAAACYgAAAAABYgAAAAAAYgAAAAACYgAAAAAAYgAAAAAAYgAAAAABYgAAAAACeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAYgAAAAABYgAAAAADYgAAAAADYgAAAAAAYgAAAAADYgAAAAADYgAAAAABYgAAAAABYgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAADYgAAAAACYgAAAAADYgAAAAADYgAAAAABYgAAAAAAYgAAAAACYgAAAAABYgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAACYgAAAAABYgAAAAACYgAAAAAAYgAAAAAAYgAAAAAAYgAAAAAAYgAAAAACYgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACeQAAAAAAYgAAAAACYgAAAAABYgAAAAACYgAAAAACYgAAAAABYgAAAAABYgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABYgAAAAABYgAAAAADYgAAAAACYgAAAAACYgAAAAAAYgAAAAACYgAAAAAAYgAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAYgAAAAAAYgAAAAADYgAAAAADYgAAAAAAYgAAAAADYgAAAAADYgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAYgAAAAACYgAAAAAAYgAAAAACYgAAAAABYgAAAAACYgAAAAAAYgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAWQAAAAABeQAAAAAAYgAAAAAAYgAAAAACYgAAAAACYgAAAAACYgAAAAADYgAAAAABYgAAAAACYgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAYgAAAAADYgAAAAAAYgAAAAACYgAAAAABYgAAAAADYgAAAAADYgAAAAADYgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAYgAAAAACYgAAAAADYgAAAAABYgAAAAABYgAAAAADYgAAAAADYgAAAAABYgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAYgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABeQAAAAAAWQAAAAABeQAAAAAAWQAAAAADWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAAAWQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         2,-3:
           ind: 2,-3
-          tiles: eQAAAAAAaQAAAAAAHQAAAAABHQAAAAAAHQAAAAABHQAAAAAAHQAAAAADbAAAAAAAbAAAAAACbAAAAAABeQAAAAAAbAAAAAADbAAAAAACbAAAAAAAbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAABHQAAAAACeQAAAAAAbAAAAAABbAAAAAACbAAAAAACeQAAAAAAbAAAAAABbAAAAAACbAAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAAAHQAAAAAAHQAAAAACeQAAAAAAbAAAAAAAbAAAAAADbAAAAAAAbAAAAAADbAAAAAABbAAAAAADbAAAAAADbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAbAAAAAACbAAAAAADbAAAAAABeQAAAAAAbAAAAAADbAAAAAADbAAAAAABbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAeQAAAAAAbAAAAAACbAAAAAACbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAeQAAAAAAbAAAAAACbAAAAAABbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAABbAAAAAABbAAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAbAAAAAAAbAAAAAADbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAACbAAAAAADbAAAAAAAbAAAAAACbAAAAAACeQAAAAAAbAAAAAACbAAAAAACbAAAAAABbAAAAAAAeQAAAAAAXAAAAAADXAAAAAADXAAAAAACXAAAAAACbAAAAAABbAAAAAACbAAAAAACbAAAAAAAbAAAAAABbAAAAAAAeQAAAAAAbAAAAAACbAAAAAACbAAAAAACbAAAAAABbAAAAAACXAAAAAAAXAAAAAABXAAAAAAAXAAAAAADWQAAAAADWQAAAAAAbAAAAAACbAAAAAACbAAAAAAAbAAAAAAAeQAAAAAAbAAAAAAAbAAAAAADbAAAAAADbAAAAAACeQAAAAAAXAAAAAACXAAAAAAAXAAAAAADXAAAAAADWQAAAAADWQAAAAADeQAAAAAAbAAAAAACbAAAAAAAeQAAAAAAeQAAAAAAbAAAAAACbAAAAAAAbAAAAAAAbAAAAAABeQAAAAAAXAAAAAADXAAAAAABXAAAAAAAXAAAAAACWQAAAAABWQAAAAAAeQAAAAAAbAAAAAABbAAAAAACbAAAAAADbAAAAAAAbAAAAAAAbAAAAAADbAAAAAABbAAAAAABeQAAAAAAXAAAAAAAXAAAAAAAXAAAAAABXAAAAAAD
+          tiles: eQAAAAAAaQAAAAAAHQAAAAACHQAAAAACHQAAAAACHQAAAAAAHQAAAAACbAAAAAABbAAAAAABbAAAAAAAeQAAAAAAbAAAAAADbAAAAAACbAAAAAABbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAABHQAAAAACHQAAAAABeQAAAAAAbAAAAAADbAAAAAADbAAAAAACeQAAAAAAbAAAAAAAbAAAAAACbAAAAAAAbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAAAHQAAAAADHQAAAAABeQAAAAAAbAAAAAABbAAAAAADbAAAAAACbAAAAAADbAAAAAADbAAAAAAAbAAAAAABbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAbAAAAAACbAAAAAACbAAAAAACeQAAAAAAbAAAAAADbAAAAAADbAAAAAAAbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAACeQAAAAAAbAAAAAADbAAAAAAAbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAAAHQAAAAACHQAAAAACeQAAAAAAbAAAAAABbAAAAAADbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAABHQAAAAAAeQAAAAAAbAAAAAABbAAAAAAAbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAABHQAAAAABHQAAAAABeQAAAAAAbAAAAAADbAAAAAADbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAAAHQAAAAACHQAAAAACHQAAAAAAbAAAAAABbAAAAAABbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAADeQAAAAAAbAAAAAABbAAAAAABbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAAAbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAADbAAAAAACbAAAAAACbAAAAAABeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAACbAAAAAACeQAAAAAAXAAAAAACXAAAAAAAXAAAAAACXAAAAAACbAAAAAACbAAAAAAAbAAAAAADbAAAAAACbAAAAAADbAAAAAACeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAABbAAAAAAAbAAAAAACXAAAAAADXAAAAAABXAAAAAADXAAAAAACWQAAAAAAWQAAAAAAbAAAAAACbAAAAAABbAAAAAACbAAAAAACeQAAAAAAbAAAAAACbAAAAAABbAAAAAACbAAAAAABeQAAAAAAXAAAAAADXAAAAAACXAAAAAACXAAAAAABWQAAAAACWQAAAAABeQAAAAAAbAAAAAAAbAAAAAABeQAAAAAAeQAAAAAAbAAAAAADbAAAAAADbAAAAAADbAAAAAADeQAAAAAAXAAAAAABXAAAAAABXAAAAAADXAAAAAADWQAAAAACWQAAAAAAeQAAAAAAbAAAAAABbAAAAAABbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAADbAAAAAADbAAAAAADeQAAAAAAXAAAAAABXAAAAAABXAAAAAABXAAAAAAA
           version: 6
         2,-2:
           ind: 2,-2
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAABbAAAAAAAbAAAAAACbAAAAAAAbAAAAAABbAAAAAAAbAAAAAAAeQAAAAAAXAAAAAAAXAAAAAAAXAAAAAAAXAAAAAACbAAAAAADbAAAAAAAeQAAAAAAbAAAAAABbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAbAAAAAAAbAAAAAABbAAAAAAAbAAAAAADbAAAAAADeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAABbAAAAAABeQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAABeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAABbAAAAAAAbAAAAAABeQAAAAAAbAAAAAACbAAAAAABbAAAAAADbAAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAACeQAAAAAAbAAAAAABbAAAAAAAeQAAAAAAbAAAAAAAbAAAAAADeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAADbAAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAADWQAAAAABbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAAAeQAAAAAAbAAAAAAAbAAAAAABbAAAAAACbAAAAAACeQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAADeQAAAAAAbAAAAAACbAAAAAAAbAAAAAABbAAAAAADbAAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAABeQAAAAAAbAAAAAAAbAAAAAABbAAAAAAAbAAAAAAAbAAAAAABbAAAAAAAbAAAAAACbAAAAAADbAAAAAADbAAAAAADbAAAAAABeQAAAAAAWQAAAAACWQAAAAABWQAAAAAAeQAAAAAAbAAAAAADbAAAAAABbAAAAAAAbAAAAAADbAAAAAAAbAAAAAACbAAAAAAAbAAAAAACbAAAAAACbAAAAAACbAAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAACaQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAACbAAAAAACbAAAAAAAbAAAAAACbAAAAAADbAAAAAADbAAAAAADbAAAAAACeQAAAAAAWQAAAAACWQAAAAAAWQAAAAADeQAAAAAAbAAAAAABeQAAAAAAbAAAAAADbAAAAAADeQAAAAAAbAAAAAAAbAAAAAABbAAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAABbAAAAAADbAAAAAABeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaAAAAAAAbAAAAAABbAAAAAADbAAAAAADbAAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAACaQAAAAAAaQAAAAAAHQAAAAAAaQAAAAAAHQAAAAAAaQAAAAAAeQAAAAAAbAAAAAACbAAAAAABbAAAAAABbAAAAAABeQAAAAAAHQAAAAACHQAAAAABHQAAAAABHQAAAAADaQAAAAAAaQAAAAAAHQAAAAABaQAAAAAAHQAAAAADaQAAAAAAHQAAAAADbAAAAAADbAAAAAADbAAAAAAAbAAAAAABeQAAAAAAHQAAAAAAHQAAAAACHQAAAAABeQAAAAAAaQAAAAAAaQAAAAAAHQAAAAABaQAAAAAAHQAAAAABaQAAAAAAHQAAAAACbAAAAAACbAAAAAACbAAAAAACbAAAAAADeQAAAAAAHQAAAAABHQAAAAAAHQAAAAABeQAAAAAAHQAAAAABHQAAAAABHQAAAAABaQAAAAAAHQAAAAABaQAAAAAAHQAAAAAC
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAACbAAAAAACbAAAAAAAbAAAAAABbAAAAAAAbAAAAAABbAAAAAADeQAAAAAAXAAAAAABXAAAAAADXAAAAAABXAAAAAADbAAAAAACbAAAAAABeQAAAAAAbAAAAAAAbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAbAAAAAABbAAAAAADbAAAAAABbAAAAAABbAAAAAABeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAABbAAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAADeQAAAAAAbAAAAAABbAAAAAABbAAAAAAAbAAAAAACbAAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAABbAAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAABWQAAAAADeQAAAAAAbAAAAAACbAAAAAACeQAAAAAAbAAAAAADbAAAAAABeQAAAAAAbAAAAAACbAAAAAADbAAAAAABbAAAAAACWQAAAAACWQAAAAABWQAAAAADWQAAAAABWQAAAAAAbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAADeQAAAAAAbAAAAAACbAAAAAABbAAAAAAAbAAAAAABeQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAADeQAAAAAAbAAAAAABbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAABeQAAAAAAeQAAAAAAbAAAAAABbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAAAeQAAAAAAbAAAAAABbAAAAAADbAAAAAACbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAABbAAAAAABbAAAAAAAbAAAAAABeQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAABbAAAAAACbAAAAAABbAAAAAADbAAAAAADbAAAAAACbAAAAAABbAAAAAABWQAAAAADWQAAAAADWQAAAAACWQAAAAACaQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAACbAAAAAAAbAAAAAACbAAAAAADbAAAAAAAbAAAAAAAbAAAAAACbAAAAAABeQAAAAAAWQAAAAACWQAAAAAAWQAAAAABeQAAAAAAbAAAAAAAeQAAAAAAbAAAAAADbAAAAAACeQAAAAAAbAAAAAACbAAAAAACbAAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAADbAAAAAABbAAAAAACeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaAAAAAAAbAAAAAAAbAAAAAABbAAAAAAAbAAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAABHQAAAAACaQAAAAAAaQAAAAAAHQAAAAADaQAAAAAAHQAAAAABaQAAAAAAeQAAAAAAbAAAAAABbAAAAAADbAAAAAADbAAAAAABeQAAAAAAHQAAAAADHQAAAAACHQAAAAABHQAAAAAAaQAAAAAAaQAAAAAAHQAAAAAAaQAAAAAAHQAAAAACaQAAAAAAHQAAAAADbAAAAAADbAAAAAAAbAAAAAADbAAAAAACeQAAAAAAHQAAAAACHQAAAAACHQAAAAACeQAAAAAAaQAAAAAAaQAAAAAAHQAAAAACaQAAAAAAHQAAAAACaQAAAAAAHQAAAAADbAAAAAAAbAAAAAADbAAAAAACbAAAAAADeQAAAAAAHQAAAAADHQAAAAADHQAAAAACeQAAAAAAHQAAAAACHQAAAAAAHQAAAAAAaQAAAAAAHQAAAAACaQAAAAAAHQAAAAAB
           version: 6
         2,-4:
           ind: 2,-4
-          tiles: aAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAABdgAAAAAAdgAAAAACeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAdgAAAAABdgAAAAACdgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAbAAAAAACbAAAAAABeQAAAAAAbAAAAAABbAAAAAAAeQAAAAAAbAAAAAACbAAAAAABaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAADbAAAAAAAbAAAAAABeQAAAAAAbAAAAAACbAAAAAABeQAAAAAAbAAAAAACbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAABbAAAAAADbAAAAAABeQAAAAAAbAAAAAAAbAAAAAACeQAAAAAAbAAAAAABbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAABbAAAAAADbAAAAAADeQAAAAAAbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAADbAAAAAABbAAAAAABbAAAAAACbAAAAAADbAAAAAADbAAAAAABbAAAAAABbAAAAAABeQAAAAAAeQAAAAAAbAAAAAACbAAAAAABbAAAAAAAbAAAAAADbAAAAAABbAAAAAABbAAAAAADbAAAAAABbAAAAAABbAAAAAABbAAAAAABbAAAAAADbAAAAAADbAAAAAACeQAAAAAAeQAAAAAAbAAAAAABbAAAAAABbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAADbAAAAAADbAAAAAABeQAAAAAAbAAAAAAAbAAAAAACbAAAAAACeQAAAAAAWQAAAAAAWQAAAAADWQAAAAADLwAAAAAALwAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAbAAAAAADbAAAAAAAeQAAAAAAbAAAAAACbAAAAAABbAAAAAADeQAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAAAbAAAAAADbAAAAAADeQAAAAAAbAAAAAABbAAAAAADbAAAAAACeQAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAACHQAAAAABHQAAAAAAeQAAAAAAbAAAAAABbAAAAAABbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAAAHQAAAAABHQAAAAACeQAAAAAAbAAAAAADbAAAAAADbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: aAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAdgAAAAACdgAAAAACeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAdgAAAAADdgAAAAABdgAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAACbAAAAAADbAAAAAABeQAAAAAAbAAAAAACbAAAAAABeQAAAAAAbAAAAAACbAAAAAABaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAABbAAAAAADbAAAAAADeQAAAAAAbAAAAAADbAAAAAACeQAAAAAAbAAAAAACbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAbAAAAAAAbAAAAAAAeQAAAAAAbAAAAAAAbAAAAAADeQAAAAAAbAAAAAADbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAACbAAAAAADbAAAAAADeQAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAABbAAAAAACbAAAAAABbAAAAAABbAAAAAAAbAAAAAADbAAAAAADbAAAAAADbAAAAAABeQAAAAAAeQAAAAAAbAAAAAABbAAAAAABbAAAAAACbAAAAAAAbAAAAAABbAAAAAABbAAAAAAAbAAAAAADbAAAAAABbAAAAAACbAAAAAABbAAAAAABbAAAAAAAbAAAAAACeQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAACbAAAAAABbAAAAAADeQAAAAAAbAAAAAACbAAAAAACbAAAAAACeQAAAAAAWQAAAAAAWQAAAAABWQAAAAADLwAAAAAALwAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAADbAAAAAAAeQAAAAAAbAAAAAACbAAAAAABbAAAAAADeQAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAADbAAAAAACbAAAAAACeQAAAAAAbAAAAAADbAAAAAADbAAAAAAAeQAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAABHQAAAAADHQAAAAABeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAADHQAAAAABHQAAAAADeQAAAAAAbAAAAAACbAAAAAACbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         3,-2:
           ind: 3,-2
-          tiles: eQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAEQAAAAAAEQAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAABeQAAAAAAWQAAAAACWQAAAAAAHQAAAAAAHQAAAAACHQAAAAABeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAHQAAAAABHQAAAAADHQAAAAAAHQAAAAABHQAAAAADHQAAAAAAeQAAAAAAWQAAAAADWQAAAAABHQAAAAADHQAAAAADHQAAAAABaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAEQAAAAAAEQAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABHQAAAAAAHQAAAAABHQAAAAADbAAAAAAAbAAAAAACbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAADWQAAAAAAWQAAAAADbAAAAAABbAAAAAADbAAAAAACbAAAAAAAbAAAAAADbAAAAAACbAAAAAACbAAAAAADbAAAAAABbAAAAAABbAAAAAADbAAAAAADbAAAAAAAbAAAAAAAeQAAAAAAWQAAAAAAbAAAAAABbAAAAAADbAAAAAADbAAAAAADbAAAAAADbAAAAAADbAAAAAAAbAAAAAABbAAAAAADbAAAAAAAbAAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAHQAAAAACHQAAAAAAHQAAAAABaQAAAAAAbAAAAAAAbAAAAAABbAAAAAACbAAAAAABbAAAAAABbAAAAAACbAAAAAADbAAAAAABaAAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAHQAAAAAAHQAAAAACHQAAAAACaQAAAAAAbAAAAAAAbAAAAAACbAAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAbAAAAAABbAAAAAACbAAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAABWQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAADaAAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAACHQAAAAABHQAAAAACHQAAAAAAeQAAAAAAbAAAAAAAbAAAAAADWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADEQAAAAAAWQAAAAADEQAAAAAAHQAAAAACWQAAAAABbAAAAAABbAAAAAACWQAAAAACWQAAAAABWQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACEQAAAAAAEQAAAAAAEQAAAAAAHQAAAAABWQAAAAABbAAAAAAAbAAAAAADbAAAAAACbAAAAAADbAAAAAADbAAAAAABbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABEQAAAAAAWQAAAAACEQAAAAAAHQAAAAABWQAAAAAAbAAAAAACbAAAAAABbAAAAAADbAAAAAACbAAAAAADbAAAAAABbAAAAAABeQAAAAAAeQAAAAAAaAAAAAAAHQAAAAADHQAAAAABHQAAAAADHQAAAAABHQAAAAABeQAAAAAAbAAAAAAAbAAAAAACbAAAAAABeQAAAAAAeQAAAAAAbAAAAAACeQAAAAAA
+          tiles: eQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAEQAAAAAAEQAAAAAAeQAAAAAAHQAAAAABHQAAAAADHQAAAAABeQAAAAAAWQAAAAABWQAAAAACHQAAAAAAHQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAHQAAAAAAHQAAAAADHQAAAAABHQAAAAABHQAAAAABHQAAAAACeQAAAAAAWQAAAAABWQAAAAAAHQAAAAABHQAAAAABHQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAEQAAAAAAEQAAAAAAeQAAAAAAHQAAAAACHQAAAAACHQAAAAABeQAAAAAAWQAAAAABWQAAAAACHQAAAAACHQAAAAABHQAAAAACbAAAAAACbAAAAAACbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAbAAAAAADbAAAAAACbAAAAAACWQAAAAADWQAAAAAAbAAAAAADbAAAAAACbAAAAAADbAAAAAACbAAAAAADbAAAAAADbAAAAAABbAAAAAABbAAAAAACbAAAAAACbAAAAAAAbAAAAAACbAAAAAADbAAAAAADeQAAAAAAWQAAAAABbAAAAAACbAAAAAAAbAAAAAADbAAAAAACbAAAAAABbAAAAAAAbAAAAAADbAAAAAAAbAAAAAABbAAAAAACbAAAAAABeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAHQAAAAABHQAAAAAAHQAAAAABaQAAAAAAbAAAAAAAbAAAAAAAbAAAAAADbAAAAAADbAAAAAACbAAAAAAAbAAAAAADbAAAAAABaAAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAHQAAAAADHQAAAAADHQAAAAABaQAAAAAAbAAAAAAAbAAAAAAAbAAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAADWQAAAAADaAAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAbAAAAAABbAAAAAABbAAAAAACWQAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAABaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAADWQAAAAADWQAAAAABWQAAAAABWQAAAAACWQAAAAABaAAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAABHQAAAAACHQAAAAACeQAAAAAAbAAAAAAAbAAAAAADWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADEQAAAAAAWQAAAAAAEQAAAAAAHQAAAAAAWQAAAAACbAAAAAABbAAAAAACWQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACEQAAAAAAEQAAAAAAEQAAAAAAHQAAAAAAWQAAAAABbAAAAAACbAAAAAACbAAAAAABbAAAAAABbAAAAAAAbAAAAAADbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAEQAAAAAAWQAAAAACEQAAAAAAHQAAAAAAWQAAAAACbAAAAAADbAAAAAABbAAAAAAAbAAAAAABbAAAAAADbAAAAAACbAAAAAABeQAAAAAAeQAAAAAAaAAAAAAAHQAAAAADHQAAAAADHQAAAAADHQAAAAACHQAAAAADeQAAAAAAbAAAAAADbAAAAAABbAAAAAAAeQAAAAAAeQAAAAAAbAAAAAADeQAAAAAA
           version: 6
         4,-2:
           ind: 4,-2
-          tiles: eQAAAAAAbAAAAAACbAAAAAACbAAAAAAAeQAAAAAAHQAAAAACHQAAAAABHQAAAAAAHQAAAAABHQAAAAABHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAAAbAAAAAAAeQAAAAAAHQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAAAHQAAAAACeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAbAAAAAAAbAAAAAACbAAAAAADeQAAAAAAHQAAAAADWQAAAAACWQAAAAAAWQAAAAADWQAAAAABHQAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAbAAAAAABeQAAAAAAHQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAADHQAAAAADeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAbAAAAAAAbAAAAAACbAAAAAABbAAAAAAAeQAAAAAAHQAAAAABWQAAAAADWQAAAAABWQAAAAAAWQAAAAABHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAACbAAAAAAAbAAAAAADeQAAAAAAHQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAACHQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAWQAAAAABeQAAAAAAbAAAAAABbAAAAAAAbAAAAAAAeQAAAAAAHQAAAAAAHQAAAAABHQAAAAADHQAAAAADHQAAAAADHQAAAAACeQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAbAAAAAAAbAAAAAABbAAAAAABbAAAAAACbAAAAAADbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAADeQAAAAAAbAAAAAAAbAAAAAACbAAAAAAAbAAAAAADWQAAAAACbAAAAAACbAAAAAAAbAAAAAADbAAAAAABbAAAAAADbAAAAAABbAAAAAADbAAAAAABbAAAAAABbAAAAAADbAAAAAAAbAAAAAABbAAAAAADbAAAAAACbAAAAAACeQAAAAAAbAAAAAADbAAAAAAAbAAAAAAAbAAAAAADbAAAAAADbAAAAAADbAAAAAACbAAAAAABbAAAAAADbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAADeQAAAAAAbAAAAAABbAAAAAADbAAAAAABbAAAAAACbAAAAAABbAAAAAABbAAAAAABbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAADbAAAAAAAbAAAAAADbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAHQAAAAADaAAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAACbAAAAAACbAAAAAACbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAHQAAAAAAaAAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAAAbAAAAAABbAAAAAABbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAHQAAAAACaAAAAAAAeQAAAAAAbAAAAAABbAAAAAAAbAAAAAAAbAAAAAADbAAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADeQAAAAAAeQAAAAAAbAAAAAACbAAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: eQAAAAAAbAAAAAADbAAAAAADbAAAAAABeQAAAAAAHQAAAAADHQAAAAACHQAAAAADHQAAAAAAHQAAAAADHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAABbAAAAAAAeQAAAAAAHQAAAAABWQAAAAABWQAAAAACWQAAAAADWQAAAAADHQAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAAAeQAAAAAAHQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAHQAAAAABeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAADeQAAAAAAHQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAABHQAAAAACeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAbAAAAAAAbAAAAAABbAAAAAACbAAAAAADeQAAAAAAHQAAAAACWQAAAAACWQAAAAABWQAAAAADWQAAAAADHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAADbAAAAAACbAAAAAABeQAAAAAAHQAAAAACWQAAAAADWQAAAAAAWQAAAAABWQAAAAACHQAAAAADeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAWQAAAAAAeQAAAAAAbAAAAAAAbAAAAAABbAAAAAACeQAAAAAAHQAAAAADHQAAAAAAHQAAAAACHQAAAAADHQAAAAADHQAAAAADeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAABeQAAAAAAbAAAAAABbAAAAAABbAAAAAAAbAAAAAAAbAAAAAADbAAAAAADbAAAAAAAbAAAAAAAbAAAAAADbAAAAAABeQAAAAAAbAAAAAACbAAAAAADbAAAAAACbAAAAAAAWQAAAAABbAAAAAABbAAAAAACbAAAAAABbAAAAAAAbAAAAAACbAAAAAADbAAAAAABbAAAAAABbAAAAAADbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAADbAAAAAACbAAAAAADeQAAAAAAbAAAAAABbAAAAAAAbAAAAAADbAAAAAAAbAAAAAADbAAAAAADbAAAAAABbAAAAAACbAAAAAADbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAADeQAAAAAAbAAAAAACbAAAAAACbAAAAAAAbAAAAAAAbAAAAAADbAAAAAADbAAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAABbAAAAAAAbAAAAAACbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAHQAAAAADaAAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAABbAAAAAACbAAAAAADbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAHQAAAAADaAAAAAAAeQAAAAAAbAAAAAADbAAAAAABbAAAAAADbAAAAAADbAAAAAABbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAHQAAAAACaAAAAAAAeQAAAAAAbAAAAAADbAAAAAACbAAAAAACbAAAAAADbAAAAAACbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         5,-2:
           ind: 5,-2
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAAAAAAAAAAAAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAWQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAAAAAAAAAAAAAAAAAWQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAAAAAAAAAAAAAAAAAbAAAAAABbAAAAAADbAAAAAABeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAbAAAAAABbAAAAAABbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAAAAAAAAAAAAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAWQAAAAADeQAAAAAAWQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAAAAAAAAAAAAAAAAAWQAAAAADWQAAAAADWQAAAAACeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAAAAAAAAAAAAAAAAAbAAAAAACbAAAAAAAbAAAAAADeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAbAAAAAACbAAAAAADbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         4,-3:
           ind: 4,-3
-          tiles: eQAAAAAAbAAAAAABbAAAAAACbAAAAAACbAAAAAABeQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAACWQAAAAABWQAAAAADaAAAAAAAeQAAAAAAbAAAAAABbAAAAAADbAAAAAADbAAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAAAaAAAAAAAeQAAAAAAbAAAAAADbAAAAAADbAAAAAADbAAAAAADbAAAAAACbAAAAAABbAAAAAAAbAAAAAAAbAAAAAABbAAAAAACbAAAAAAAbAAAAAACbAAAAAABbAAAAAADaAAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAAAbAAAAAAAeQAAAAAAbAAAAAADbAAAAAADbAAAAAADbAAAAAAAbAAAAAAAbAAAAAABbAAAAAABbAAAAAACbAAAAAADaAAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAADbAAAAAACeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAACbAAAAAACbAAAAAABbAAAAAABaAAAAAAAeQAAAAAAbAAAAAAAbAAAAAACbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAADbAAAAAACeQAAAAAAeQAAAAAAbAAAAAADbAAAAAACbAAAAAACeQAAAAAAeAAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAATQAAAAAAeQAAAAAAbAAAAAAAbAAAAAAAWQAAAAABeQAAAAAAbAAAAAADbAAAAAABbAAAAAADbAAAAAAAeQAAAAAAeAAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAbAAAAAACbAAAAAABWQAAAAABeQAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAACeQAAAAAAeAAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAATQAAAAAAeQAAAAAAbAAAAAABbAAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAbAAAAAACbAAAAAAAbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAbAAAAAACeQAAAAAAeQAAAAAAbAAAAAACbAAAAAAAbAAAAAABeQAAAAAAbAAAAAABbAAAAAADbAAAAAABbAAAAAADbAAAAAAAbAAAAAADeQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAABbAAAAAADbAAAAAABbAAAAAAAbAAAAAADbAAAAAABbAAAAAABbAAAAAACbAAAAAACeQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAADbAAAAAADbAAAAAADbAAAAAACbAAAAAADeQAAAAAAbAAAAAABbAAAAAAAbAAAAAADbAAAAAACbAAAAAACbAAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAbAAAAAABbAAAAAAAbAAAAAADeQAAAAAAbAAAAAADbAAAAAACbAAAAAADbAAAAAABbAAAAAADbAAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAACeQAAAAAAbAAAAAABbAAAAAABbAAAAAACbAAAAAADbAAAAAABbAAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAbAAAAAADbAAAAAABbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACeQAAAAAA
+          tiles: eQAAAAAAbAAAAAAAbAAAAAADbAAAAAACbAAAAAACeQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAWQAAAAACaAAAAAAAeQAAAAAAbAAAAAABbAAAAAAAbAAAAAADbAAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAACWQAAAAADaAAAAAAAeQAAAAAAbAAAAAAAbAAAAAACbAAAAAADbAAAAAACbAAAAAAAbAAAAAAAbAAAAAABbAAAAAABbAAAAAADbAAAAAABbAAAAAABbAAAAAADbAAAAAABbAAAAAAAaAAAAAAAeQAAAAAAbAAAAAACbAAAAAACbAAAAAADbAAAAAADeQAAAAAAbAAAAAABbAAAAAACbAAAAAAAbAAAAAADbAAAAAABbAAAAAADbAAAAAABbAAAAAACbAAAAAABaAAAAAAAeQAAAAAAbAAAAAAAbAAAAAABbAAAAAADbAAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAABWQAAAAACWQAAAAABbAAAAAADbAAAAAACbAAAAAAAaAAAAAAAeQAAAAAAbAAAAAAAbAAAAAACbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAACbAAAAAAAbAAAAAACeQAAAAAAeQAAAAAAbAAAAAABbAAAAAACbAAAAAAAeQAAAAAAeAAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAATQAAAAAAeQAAAAAAbAAAAAAAbAAAAAADWQAAAAABeQAAAAAAbAAAAAADbAAAAAAAbAAAAAAAbAAAAAAAeQAAAAAAeAAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAbAAAAAABbAAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAACeQAAAAAAeAAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAATQAAAAAAeQAAAAAAbAAAAAABbAAAAAACWQAAAAABeQAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAADbAAAAAABeQAAAAAAeQAAAAAAbAAAAAADbAAAAAADbAAAAAACeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAABbAAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAbAAAAAABbAAAAAAAbAAAAAAAbAAAAAADbAAAAAAAbAAAAAADbAAAAAAAbAAAAAAAbAAAAAADbAAAAAADeQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAAAbAAAAAACbAAAAAAAbAAAAAAAbAAAAAABeQAAAAAAbAAAAAABbAAAAAACbAAAAAACbAAAAAADbAAAAAAAbAAAAAABeQAAAAAAWQAAAAADWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAbAAAAAADbAAAAAACbAAAAAADeQAAAAAAbAAAAAACbAAAAAACbAAAAAAAbAAAAAADbAAAAAAAbAAAAAACeQAAAAAAWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAbAAAAAACbAAAAAACbAAAAAAAeQAAAAAAbAAAAAABbAAAAAADbAAAAAAAbAAAAAAAbAAAAAACbAAAAAABeQAAAAAAWQAAAAACWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAbAAAAAACbAAAAAABbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAA
           version: 6
         3,-3:
           ind: 3,-3
-          tiles: aAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAACbAAAAAADbAAAAAABbAAAAAADbAAAAAADbAAAAAABbAAAAAADbAAAAAABbAAAAAABbAAAAAAAbAAAAAACbAAAAAABeQAAAAAAeQAAAAAAaAAAAAAAbAAAAAACWQAAAAADbAAAAAADWQAAAAACbAAAAAADWQAAAAAAbAAAAAAAWQAAAAABbAAAAAACWQAAAAADbAAAAAADWQAAAAADbAAAAAACeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAADbAAAAAADbAAAAAADbAAAAAACbAAAAAACbAAAAAACbAAAAAADbAAAAAABbAAAAAAAbAAAAAACeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAHQAAAAADHQAAAAADHQAAAAABHQAAAAACHQAAAAACHQAAAAAAHQAAAAACeQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAWQAAAAACeQAAAAAAdgAAAAADdgAAAAADdgAAAAACdgAAAAABdgAAAAABdgAAAAADdgAAAAADeQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAABWQAAAAABHQAAAAACWQAAAAABHQAAAAACdgAAAAADdgAAAAADdgAAAAADdgAAAAABdgAAAAABdgAAAAAAdgAAAAAAeQAAAAAAbAAAAAAAbAAAAAACbAAAAAADbAAAAAAAbAAAAAACeQAAAAAAWQAAAAADeQAAAAAAdgAAAAACdgAAAAABdgAAAAABdgAAAAACdgAAAAADdgAAAAADdgAAAAABeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAACbAAAAAACbAAAAAAAeQAAAAAAWQAAAAABeQAAAAAAdgAAAAADdgAAAAABdgAAAAACdgAAAAADdgAAAAAAdgAAAAACdgAAAAABeQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: aAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEwAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADEwAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABbAAAAAAAbAAAAAACbAAAAAAAbAAAAAACbAAAAAAAbAAAAAADbAAAAAABbAAAAAAAbAAAAAADbAAAAAABbAAAAAADbAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAbAAAAAABWQAAAAADbAAAAAADWQAAAAABbAAAAAABWQAAAAABbAAAAAABWQAAAAAAbAAAAAADWQAAAAAAbAAAAAAAWQAAAAABbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAbAAAAAAAbAAAAAABbAAAAAAAbAAAAAACbAAAAAADbAAAAAAAbAAAAAADbAAAAAABbAAAAAACbAAAAAADbAAAAAADeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAHQAAAAACHQAAAAACHQAAAAAAHQAAAAACHQAAAAAAHQAAAAADHQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAABWQAAAAABeQAAAAAAWQAAAAAAeQAAAAAAdgAAAAADdgAAAAACdgAAAAACdgAAAAACdgAAAAADdgAAAAAAdgAAAAACeQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADHQAAAAABWQAAAAACHQAAAAABdgAAAAABdgAAAAACdgAAAAABdgAAAAADdgAAAAABdgAAAAAAdgAAAAAAeQAAAAAAbAAAAAACbAAAAAADbAAAAAACbAAAAAAAbAAAAAAAeQAAAAAAWQAAAAADeQAAAAAAdgAAAAABdgAAAAABdgAAAAABdgAAAAADdgAAAAACdgAAAAABdgAAAAACeQAAAAAAbAAAAAACbAAAAAABbAAAAAABbAAAAAADbAAAAAACeQAAAAAAWQAAAAABeQAAAAAAdgAAAAAAdgAAAAADdgAAAAAAdgAAAAAAdgAAAAABdgAAAAABdgAAAAACeQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         4,-4:
           ind: 4,-4
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAPAAAAAAAYAAAAAAAeQAAAAAAHQAAAAADHQAAAAABHQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAPAAAAAAAeQAAAAAAHQAAAAAAHQAAAAADHQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAYAAAAAAAPAAAAAAAPAAAAAAAeQAAAAAAHQAAAAADHQAAAAACHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAAAHQAAAAACHQAAAAADHQAAAAABHQAAAAADHQAAAAABHQAAAAADeQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAABeQAAAAAAHQAAAAADHQAAAAADHQAAAAACHQAAAAABHQAAAAABHQAAAAAAHQAAAAABHQAAAAACeQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAACWQAAAAAAWQAAAAAAHQAAAAACHQAAAAADHQAAAAADHQAAAAAAHQAAAAADHQAAAAACHQAAAAACHQAAAAACHQAAAAABeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAABHQAAAAACHQAAAAADHQAAAAADHQAAAAABaQAAAAAAaQAAAAAAaQAAAAAAHQAAAAADHQAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAADWQAAAAABWQAAAAACHQAAAAACHQAAAAADHQAAAAACHQAAAAABaQAAAAAAaQAAAAAAaQAAAAAAHQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAeQAAAAAAbAAAAAAAbAAAAAACbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAPAAAAAAAYAAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAPAAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAACeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAYAAAAAAAPAAAAAAAPAAAAAAAeQAAAAAAHQAAAAACHQAAAAADHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAABHQAAAAACHQAAAAABHQAAAAADHQAAAAADHQAAAAACHQAAAAABeQAAAAAAWQAAAAABWQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAACeQAAAAAAHQAAAAADHQAAAAACHQAAAAABHQAAAAABHQAAAAADHQAAAAAAHQAAAAACHQAAAAABeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAACWQAAAAABHQAAAAABHQAAAAABHQAAAAADHQAAAAAAHQAAAAACHQAAAAAAHQAAAAAAHQAAAAACHQAAAAADeQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAACHQAAAAADHQAAAAAAHQAAAAABHQAAAAACaQAAAAAAaQAAAAAAaQAAAAAAHQAAAAACHQAAAAADeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAABHQAAAAAAHQAAAAACHQAAAAADHQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAHQAAAAABHQAAAAABeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAaQAAAAAAeQAAAAAAbAAAAAAAbAAAAAABbAAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         5,-3:
           ind: 5,-3
-          tiles: aAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: aAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAABeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         5,-4:
           ind: 5,-4
-          tiles: eQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAACeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: eQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAACeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         3,-4:
           ind: 3,-4
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAABWQAAAAACWQAAAAABWQAAAAADWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAADWQAAAAACWQAAAAACWQAAAAACWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEwAAAAAA
           version: 6
         4,-1:
           ind: 4,-1
-          tiles: WQAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAABWQAAAAACWQAAAAABWQAAAAADWQAAAAACWQAAAAADWQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAACWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAACWQAAAAADWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAACWQAAAAADWQAAAAACWQAAAAABWQAAAAACWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAAAeQAAAAAAHQAAAAABHQAAAAADHQAAAAAAHQAAAAAAHQAAAAADHQAAAAACHQAAAAADHQAAAAAAHQAAAAABeQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAACWQAAAAACHQAAAAACHQAAAAACHQAAAAABHQAAAAABHQAAAAABHQAAAAACHQAAAAACHQAAAAABHQAAAAADHQAAAAACHQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAABeQAAAAAAHQAAAAAAHQAAAAADHQAAAAAAHQAAAAACHQAAAAABHQAAAAABHQAAAAADHQAAAAACHQAAAAACHQAAAAADHQAAAAABWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAHQAAAAAAWQAAAAAAWQAAAAADHQAAAAABHQAAAAABHQAAAAACWQAAAAACWQAAAAAAHQAAAAACeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAHQAAAAABWQAAAAACWQAAAAADHQAAAAACHQAAAAABHQAAAAADWQAAAAAAWQAAAAABHQAAAAADeQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAHQAAAAAAWQAAAAACWQAAAAADHQAAAAACHQAAAAACHQAAAAADWQAAAAADWQAAAAABHQAAAAABeQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAHQAAAAABWQAAAAAAWQAAAAABHQAAAAADHQAAAAAAHQAAAAADWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAWQAAAAABWQAAAAACHQAAAAACHQAAAAADHQAAAAABWQAAAAABWQAAAAAAHQAAAAAAHQAAAAACeQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAACeQAAAAAAHQAAAAADWQAAAAADWQAAAAAAHQAAAAACHQAAAAADHQAAAAADWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAHQAAAAABHQAAAAADHQAAAAACHQAAAAABHQAAAAADHQAAAAABHQAAAAACeQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: WQAAAAADWQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAADWQAAAAACWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAACWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAACWQAAAAABWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAADWQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAACWQAAAAACWQAAAAACWQAAAAABWQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAADWQAAAAABWQAAAAADWQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAABeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAADHQAAAAABHQAAAAACHQAAAAADHQAAAAABHQAAAAAAHQAAAAADeQAAAAAAWQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAACHQAAAAABHQAAAAABHQAAAAABHQAAAAABHQAAAAADHQAAAAACHQAAAAACHQAAAAADHQAAAAADHQAAAAACHQAAAAADWQAAAAABWQAAAAACWQAAAAACWQAAAAADeQAAAAAAHQAAAAACHQAAAAADHQAAAAACHQAAAAABHQAAAAAAHQAAAAACHQAAAAADHQAAAAABHQAAAAADHQAAAAABHQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAHQAAAAACWQAAAAABWQAAAAAAHQAAAAADHQAAAAADHQAAAAADWQAAAAADWQAAAAACHQAAAAADeQAAAAAAWQAAAAABWQAAAAACWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAHQAAAAAAWQAAAAAAWQAAAAACHQAAAAADHQAAAAAAHQAAAAADWQAAAAACWQAAAAABHQAAAAABeQAAAAAAWQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAHQAAAAACWQAAAAABWQAAAAABHQAAAAADHQAAAAAAHQAAAAAAWQAAAAADWQAAAAAAHQAAAAABeQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAACeQAAAAAAHQAAAAAAWQAAAAACWQAAAAABHQAAAAACHQAAAAAAHQAAAAACWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACWQAAAAABWQAAAAADHQAAAAABHQAAAAABHQAAAAADWQAAAAADWQAAAAADHQAAAAADHQAAAAACeQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAHQAAAAABWQAAAAABWQAAAAADHQAAAAABHQAAAAACHQAAAAACWQAAAAADWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAHQAAAAAAHQAAAAACHQAAAAAAHQAAAAAAHQAAAAADHQAAAAABHQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         5,-1:
           ind: 5,-1
-          tiles: eQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAACWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAABWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAABWQAAAAACWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAABWQAAAAABWQAAAAACeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAADWQAAAAADWQAAAAADeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAABWQAAAAADWQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAACWQAAAAACWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAADWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAADWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAADWQAAAAADWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAABWQAAAAABWQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: eQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAADWQAAAAADWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAABWQAAAAACWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAADWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAACWQAAAAABWQAAAAADeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAADWQAAAAABWQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAACWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAAAWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAAAWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWQAAAAABWQAAAAABWQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         4,-5:
           ind: 4,-5
@@ -343,7 +344,7 @@ entities:
           version: 6
         3,-5:
           ind: 3,-5
-          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAABwAAAAAABwAAAAADBwAAAAAABwAAAAAABwAAAAAABwAAAAALeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAABwAAAAAABwAAAAAABwAAAAAEBwAAAAAABwAAAAAABwAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAABwAAAAAABwAAAAAABwAAAAAABwAAAAAABwAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAABwAAAAAABwAAAAAABwAAAAADAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAA
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAABwAAAAAABwAAAAAMBwAAAAAABwAAAAAABwAAAAAABwAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAABwAAAAAHBwAAAAAABwAAAAAABwAAAAAABwAAAAACBwAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAABwAAAAAABwAAAAAABwAAAAAKBwAAAAAABwAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAABwAAAAAABwAAAAAABwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAaAAAAAAAaAAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAA
           version: 6
         2,-5:
           ind: 2,-5
@@ -359,11 +360,11 @@ entities:
           version: 6
         -1,-5:
           ind: -1,-5
-          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAADeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAABWQAAAAACWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAADeQAAAAAAWQAAAAADWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAADeQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAABWQAAAAACWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAACWQAAAAACWQAAAAABWQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAACWQAAAAADaQAAAAAAeQAAAAAAeQAAAAAAagAAAAABagAAAAABagAAAAACeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAABWQAAAAACWQAAAAADWQAAAAABeQAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAABeQAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAHQAAAAADHQAAAAAAHQAAAAABHQAAAAACHQAAAAABHQAAAAABHQAAAAADHQAAAAAB
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAABeQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAADWQAAAAACWQAAAAADeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAACWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAADeQAAAAAAWQAAAAAAWQAAAAABWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAABeQAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAACWQAAAAACWQAAAAAAWQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAADaQAAAAAAeQAAAAAAeQAAAAAAagAAAAACagAAAAACagAAAAABeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAWQAAAAADWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAHQAAAAAAHQAAAAABHQAAAAACHQAAAAAAHQAAAAAAHQAAAAACHQAAAAADHQAAAAAA
           version: 6
         -2,-5:
           ind: -2,-5
-          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAWQAAAAABWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAWQAAAAAAWQAAAAADDgAAAAABDgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACeQAAAAAAeQAAAAAADgAAAAABeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADeQAAAAAADgAAAAADeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAagAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAWQAAAAACWQAAAAABeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAABWQAAAAABHQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAABHQAAAAADHQAAAAABHQAAAAAAHQAAAAACeQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAADHQAAAAAAHQAAAAACHQAAAAACHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAABHQAAAAADHQAAAAACHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAADHQAAAAACHQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAADHQAAAAACHQAAAAACeQAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAA
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAWQAAAAADWQAAAAADDgAAAAAADgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAADgAAAAABeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAADeQAAAAAADgAAAAACeQAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAagAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAABWQAAAAABHQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAABWQAAAAACeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAAAHQAAAAACHQAAAAABeQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAACHQAAAAAAHQAAAAABHQAAAAACHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAACHQAAAAACHQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAABHQAAAAABHQAAAAACHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAABHQAAAAAAHQAAAAADeQAAAAAAAAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         -3,-4:
           ind: -3,-4
@@ -371,11 +372,11 @@ entities:
           version: 6
         -3,-5:
           ind: -3,-5
-          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAADgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAADgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAAAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAA
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAADgAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAADgAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAAAAAAAAAeQAAAAAAeAAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAA
           version: 6
         0,-5:
           ind: 0,-5
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAWQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAAAWQAAAAADWQAAAAADeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAABWQAAAAAAWQAAAAACWQAAAAACWQAAAAAAWQAAAAACaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAADWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAAAWQAAAAACaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAACWQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAWQAAAAADWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAADWQAAAAABWQAAAAADWQAAAAABWQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAAAWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAACWQAAAAACeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAAAWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAABWQAAAAACeQAAAAAAeQAAAAAATgAAAAAATgAAAAAATgAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAADWQAAAAAAeQAAAAAAeQAAAAAATgAAAAAATgAAAAAATgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAACeQAAAAAAeQAAAAAAeQAAAAAATgAAAAAATgAAAAAATgAAAAAAeQAAAAAA
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADeQAAAAAAWQAAAAADWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAACaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAACaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAAAWQAAAAABWQAAAAADeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACeQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAACWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAAAeQAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAaAAAAAAAWQAAAAAAWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAABWQAAAAABWQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAABWQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAADWQAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAACeQAAAAAAeQAAAAAATgAAAAAATgAAAAAATgAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAACWQAAAAACWQAAAAABeQAAAAAAeQAAAAAATgAAAAAATgAAAAAATgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAYgAAAAACeQAAAAAAeQAAAAAAeQAAAAAATgAAAAAATgAAAAAATgAAAAAAeQAAAAAA
           version: 6
         0,-6:
           ind: 0,-6
@@ -387,11 +388,11 @@ entities:
           version: 6
         1,-6:
           ind: 1,-6
-          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAACHQAAAAACeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAABeQAAAAAAHQAAAAABeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAADHQAAAAADeQAAAAAAHQAAAAABHQAAAAABHQAAAAAAeQAAAAAAHQAAAAADeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAABHQAAAAABHQAAAAAAHQAAAAABHQAAAAABHQAAAAABHQAAAAABHQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAACHQAAAAADeQAAAAAAHQAAAAACHQAAAAABHQAAAAABeQAAAAAAHQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAACHQAAAAABeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAABeQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAHQAAAAABPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAAAeQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAACPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAABHQAAAAADTQAAAAAATQAAAAAATQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAACPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAADHQAAAAACTQAAAAAATQAAAAAATQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAACHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAA
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAAAHQAAAAADeQAAAAAAHQAAAAACHQAAAAADHQAAAAAAeQAAAAAAHQAAAAACeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAADHQAAAAAAeQAAAAAAHQAAAAABHQAAAAADHQAAAAACeQAAAAAAHQAAAAACeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAAAHQAAAAADHQAAAAAAHQAAAAADHQAAAAAAHQAAAAADHQAAAAADHQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAAAeQAAAAAAHQAAAAADHQAAAAAAHQAAAAAAeQAAAAAAHQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAADHQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAAAHQAAAAABHQAAAAADeQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAHQAAAAABPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAABeQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAADHQAAAAAATQAAAAAATQAAAAAATQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAHQAAAAAAPgAAAAAAPgAAAAAAPgAAAAAAHQAAAAABHQAAAAACTQAAAAAATQAAAAAATQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAADHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAA
           version: 6
         2,-6:
           ind: 2,-6
-          tiles: eQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAABHQAAAAABeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAACHQAAAAABeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAACHQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: eQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAADHQAAAAADeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAACHQAAAAABeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAACHQAAAAACeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAABHQAAAAACeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         2,-7:
           ind: 2,-7
@@ -403,11 +404,11 @@ entities:
           version: 6
         1,-7:
           ind: 1,-7
-          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAACeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAADEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAABEQAAAAAAEQAAAAAAEQAAAAAAHQAAAAABEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAAAHQAAAAADHQAAAAABHQAAAAACHQAAAAACEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAEQAAAAAAHQAAAAABHQAAAAAAHQAAAAACEQAAAAAAEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAACHQAAAAAAHQAAAAAAHQAAAAACeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAAAHQAAAAAAHQAAAAABHQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAEQAAAAAAeQAAAAAA
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAACeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAACEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAAAEQAAAAAAEQAAAAAAEQAAAAAAHQAAAAACEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAABHQAAAAAAHQAAAAAAHQAAAAADHQAAAAACEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAEQAAAAAAHQAAAAACHQAAAAADHQAAAAAAEQAAAAAAEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAADHQAAAAACHQAAAAABHQAAAAACeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAACHQAAAAACHQAAAAADeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAABeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAADeQAAAAAAEQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAACeQAAAAAAEQAAAAAAeQAAAAAA
           version: 6
         1,-8:
           ind: 1,-8
-          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAADHQAAAAABHQAAAAAAHQAAAAAAHQAAAAADEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAADEQAAAAAAEQAAAAAAEQAAAAAAHQAAAAADEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAAAeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAAAEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAABHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAAA
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAADHQAAAAAAHQAAAAADHQAAAAAAHQAAAAACEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAAAEQAAAAAAEQAAAAAAEQAAAAAAHQAAAAADEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAADeQAAAAAAEQAAAAAAeQAAAAAAHQAAAAADEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAEQAAAAAAHQAAAAACHQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAACHQAAAAAB
           version: 6
         -2,-6:
           ind: -2,-6
@@ -435,7 +436,7 @@ entities:
           version: 6
         -1,3:
           ind: -1,3
-          tiles: dgAAAAABdgAAAAABdgAAAAABdgAAAAABdgAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAAAeQAAAAAALwAAAAAAHQAAAAABLwAAAAAAdgAAAAADdgAAAAABdgAAAAABdgAAAAAAdgAAAAADeQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAACWQAAAAACWQAAAAACeQAAAAAAWQAAAAADWQAAAAAAWQAAAAADdgAAAAAAdgAAAAACdgAAAAACdgAAAAAAdgAAAAADeQAAAAAAWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAAAWQAAAAABWQAAAAACWQAAAAACWQAAAAAAWQAAAAADdgAAAAADdgAAAAAAdgAAAAACdgAAAAABdgAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAACeQAAAAAAWQAAAAADWQAAAAACWQAAAAACdgAAAAACdgAAAAAAdgAAAAABdgAAAAADdgAAAAABeQAAAAAAPQAAAAAAPQAAAAAAWQAAAAADWQAAAAAAWQAAAAADWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAABHQAAAAABHQAAAAAAHQAAAAABHQAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+          tiles: dgAAAAABdgAAAAACdgAAAAABdgAAAAADdgAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAACWQAAAAABWQAAAAACWQAAAAACeQAAAAAALwAAAAAAHQAAAAADLwAAAAAAdgAAAAADdgAAAAADdgAAAAABdgAAAAABdgAAAAABeQAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAWQAAAAACWQAAAAABWQAAAAABdgAAAAACdgAAAAABdgAAAAADdgAAAAABdgAAAAADeQAAAAAAWQAAAAABWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAAAWQAAAAACWQAAAAABWQAAAAAAWQAAAAADdgAAAAAAdgAAAAABdgAAAAABdgAAAAAAdgAAAAADeQAAAAAAPQAAAAAAPQAAAAAAWQAAAAADWQAAAAACWQAAAAADWQAAAAADeQAAAAAAWQAAAAACWQAAAAAAWQAAAAACdgAAAAAAdgAAAAADdgAAAAAAdgAAAAAAdgAAAAABeQAAAAAAPQAAAAAAPQAAAAAAWQAAAAABWQAAAAABWQAAAAACWQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAACHQAAAAADHQAAAAAAHQAAAAAAeQAAAAAAPQAAAAAAPQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
           version: 6
         1,3:
           ind: 1,3
@@ -471,7 +472,7 @@ entities:
           version: 6
         3,-6:
           ind: 3,-6
-          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABwAAAAAABwAAAAAABwAAAAACAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAABwAAAAAABwAAAAAHBwAAAAAABwAAAAAABwAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAA
+          tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAeAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABwAAAAAABwAAAAAABwAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAAAAAAAAABwAAAAAABwAAAAAABwAAAAAGBwAAAAAABwAAAAAAAAAAAAAAeAAAAAAAAAAAAAAAeAAAAAAA
           version: 6
         -6,-1:
           ind: -6,-1
@@ -500,51 +501,57 @@ entities:
             color: '#FFFFFFFF'
             id: Arrows
           decals:
-            2456: 30,-34
-            2457: 32,-34
+            2432: 30,-34
+            2433: 32,-34
         - node:
             angle: -1.5707963267948966 rad
             color: '#FFFFFFFF'
             id: Arrows
           decals:
-            1138: -24,-18
-            1139: -24,-16
-            2978: 2,-67
-            2979: 2,-66
-            3055: 66,-52
-            3056: 66,-51
-            3287: -23,-25
-            3288: -25,-25
-            3492: 2,-64
-            3493: 2,-63
-            3494: 2,-62
-            3495: 2,-61
-            3496: 2,-60
+            1116: -24,-18
+            1117: -24,-16
+            2954: 2,-67
+            2955: 2,-66
+            3031: 66,-52
+            3032: 66,-51
+            3263: -23,-25
+            3264: -25,-25
+            3468: 2,-64
+            3469: 2,-63
+            3470: 2,-62
+            3471: 2,-61
+            3472: 2,-60
         - node:
             color: '#FFFFFFFF'
             id: Arrows
           decals:
-            1514: 73,-55
-            2579: 5,-49
-            2580: 6,-49
-            2581: 7,-49
-            2619: 3,-45
-            2655: -6,-76
-            2720: 4,-76
-            3051: 80,-54
-            3052: 79,-54
-            3053: 74,-54
-            3054: 72,-54
+            1492: 73,-55
+            2555: 5,-49
+            2556: 6,-49
+            2557: 7,-49
+            2595: 3,-45
+            2631: -6,-76
+            2696: 4,-76
+            3027: 80,-54
+            3028: 79,-54
+            3029: 74,-54
+            3030: 72,-54
         - node:
             angle: 1.5707963267948966 rad
             color: '#FFFFFFFF'
             id: Arrows
           decals:
-            2644: 9,-75
-            3289: -25,-27
-            3290: -23,-27
-            3497: 8,-64
-            3498: 8,-63
+            2620: 9,-75
+            3265: -25,-27
+            3266: -23,-27
+            3473: 8,-64
+            3474: 8,-63
+        - node:
+            angle: 3.141592653589793 rad
+            color: '#FFFFFFFF'
+            id: Arrows
+          decals:
+            3660: 60,-52
         - node:
             color: '#FFFFFFFF'
             id: ArrowsGreyscale
@@ -554,23 +561,23 @@ entities:
             color: '#529CFF93'
             id: Bot
           decals:
-            2622: 16,-79
-            2623: 16,-79
+            2598: 16,-79
+            2599: 16,-79
         - node:
             color: '#DE3A3A96'
             id: Bot
           decals:
-            2620: 13,-79
-            2621: 14,-79
+            2596: 13,-79
+            2597: 14,-79
         - node:
             angle: -1.5707963267948966 rad
             color: '#FFFFFFFF'
             id: Bot
           decals:
-            2980: 1,-72
-            2981: 9,-68
-            2982: 9,-67
-            2983: 5,-66
+            2956: 1,-72
+            2957: 9,-68
+            2958: 9,-67
+            2959: 5,-66
         - node:
             color: '#FFFFFFFF'
             id: Bot
@@ -608,115 +615,114 @@ entities:
             1007: 81,-4
             1008: 81,-12
             1009: 81,-14
-            1088: 63,-56
-            1089: 62,-56
-            1090: 61,-56
-            1091: 60,-56
-            1137: -23,-16
-            1142: -25,-18
-            1143: -25,-16
-            1233: 59,-38
-            1234: 59,-37
-            1235: 60,-37
-            1236: 60,-38
-            1237: 61,-38
-            1238: 61,-37
-            1239: 62,-37
-            1240: 62,-38
-            1509: 72,-58
-            1510: 72,-57
-            1511: 73,-58
-            1512: 74,-58
-            1513: 74,-57
-            2328: -73,8
-            2329: -74,8
-            2330: -75,8
-            2331: -76,8
-            2332: -73,-4
-            2333: -74,-4
-            2334: -75,-4
-            2335: -76,-4
-            2455: 33,-33
-            2470: 11,-45
-            2471: 10,-45
-            2472: 9,-45
-            2473: 9,-44
-            2474: 10,-44
-            2475: 11,-44
-            2476: 11,-43
-            2477: 9,-43
-            2478: 10,-43
-            2481: 14,-45
-            2482: 14,-44
-            2483: 14,-43
-            2617: 6,-41
-            2618: 7,-41
-            2641: 5,-73
-            2642: 6,-73
-            2643: 7,-73
-            2888: -1,-63
-            2889: -1,-64
-            2976: 1,-67
-            2977: 1,-66
-            3045: 65,-52
-            3046: 65,-51
-            3047: 72,-55
-            3048: 74,-55
-            3049: 79,-55
-            3050: 80,-55
-            3058: 74,-44
-            3059: 73,-44
-            3113: 34,-47
-            3114: 34,-46
-            3115: 34,-50
-            3116: 34,-49
-            3117: 37,-50
-            3118: 37,-49
-            3119: 18,-84
-            3120: 14,-85
-            3121: 14,-86
-            3122: 14,-87
-            3170: 34,-44
-            3171: 35,-44
-            3172: 34,-39
-            3254: -35,-19
-            3255: -36,-19
-            3256: -37,-19
-            3257: -38,-19
-            3258: -37,-27
-            3259: -38,-27
-            3260: -39,-27
-            3261: -37,-25
-            3262: -38,-25
-            3263: -39,-25
-            3264: -37,-23
-            3265: -38,-23
-            3266: -39,-23
-            3276: -26,-32
-            3277: -27,-32
-            3278: -27,-34
-            3279: -27,-33
-            3280: -26,-33
-            3281: -26,-34
-            3282: -26,-35
-            3283: -27,-35
-            3484: 3,-55
-            3485: 1,-64
-            3486: 1,-63
-            3487: 1,-62
-            3488: 1,-61
-            3489: 1,-60
-            3490: 9,-64
-            3491: 9,-63
-            3560: -10,31
-            3561: -7,31
-            3588: -10,29
+            1115: -23,-16
+            1120: -25,-18
+            1121: -25,-16
+            1211: 59,-38
+            1212: 59,-37
+            1213: 60,-37
+            1214: 60,-38
+            1215: 61,-38
+            1216: 61,-37
+            1217: 62,-37
+            1218: 62,-38
+            1487: 72,-58
+            1488: 72,-57
+            1489: 73,-58
+            1490: 74,-58
+            1491: 74,-57
+            2304: -73,8
+            2305: -74,8
+            2306: -75,8
+            2307: -76,8
+            2308: -73,-4
+            2309: -74,-4
+            2310: -75,-4
+            2311: -76,-4
+            2431: 33,-33
+            2446: 11,-45
+            2447: 10,-45
+            2448: 9,-45
+            2449: 9,-44
+            2450: 10,-44
+            2451: 11,-44
+            2452: 11,-43
+            2453: 9,-43
+            2454: 10,-43
+            2457: 14,-45
+            2458: 14,-44
+            2459: 14,-43
+            2593: 6,-41
+            2594: 7,-41
+            2617: 5,-73
+            2618: 6,-73
+            2619: 7,-73
+            2864: -1,-63
+            2865: -1,-64
+            2952: 1,-67
+            2953: 1,-66
+            3021: 65,-52
+            3022: 65,-51
+            3023: 72,-55
+            3024: 74,-55
+            3025: 79,-55
+            3026: 80,-55
+            3034: 74,-44
+            3035: 73,-44
+            3089: 34,-47
+            3090: 34,-46
+            3091: 34,-50
+            3092: 34,-49
+            3093: 37,-50
+            3094: 37,-49
+            3095: 18,-84
+            3096: 14,-85
+            3097: 14,-86
+            3098: 14,-87
+            3146: 34,-44
+            3147: 35,-44
+            3148: 34,-39
+            3230: -35,-19
+            3231: -36,-19
+            3232: -37,-19
+            3233: -38,-19
+            3234: -37,-27
+            3235: -38,-27
+            3236: -39,-27
+            3237: -37,-25
+            3238: -38,-25
+            3239: -39,-25
+            3240: -37,-23
+            3241: -38,-23
+            3242: -39,-23
+            3252: -26,-32
+            3253: -27,-32
+            3254: -27,-34
+            3255: -27,-33
+            3256: -26,-33
+            3257: -26,-34
+            3258: -26,-35
+            3259: -27,-35
+            3460: 3,-55
+            3461: 1,-64
+            3462: 1,-63
+            3463: 1,-62
+            3464: 1,-61
+            3465: 1,-60
+            3466: 9,-64
+            3467: 9,-63
+            3536: -10,31
+            3537: -7,31
+            3564: -10,29
+            3656: 60,-51
+            3657: 59,-51
+            3659: 57,-51
         - node:
             color: '#529CFF93'
             id: BotGreyscale
           decals:
-            2624: 16,-79
-            2625: 17,-79
+            2600: 16,-79
+            2601: 17,-79
         - node:
             color: '#FFFFFFFF'
             id: BotGreyscale
@@ -730,27 +736,27 @@ entities:
             1063: 0,-21
             1079: -2,-14
             1080: 0,-14
-            3611: -16,36
-            3612: -15,36
-            3613: -14,36
-            3614: -13,36
-            3615: -12,36
+            3587: -16,36
+            3588: -15,36
+            3589: -14,36
+            3590: -13,36
+            3591: -12,36
         - node:
             color: '#FFFFFFFF'
             id: BotLeft
           decals:
-            1710: 55,-32
-            3135: 18,-71
-            3136: 17,-71
-            3137: 16,-71
-            3138: 15,-71
-            3273: -40,-28
-            3274: -39,-28
-            3275: -38,-28
-            3630: -1,37
-            3631: 0,37
-            3632: 1,37
-            3633: 2,37
+            1688: 55,-32
+            3111: 18,-71
+            3112: 17,-71
+            3113: 16,-71
+            3114: 15,-71
+            3249: -40,-28
+            3250: -39,-28
+            3251: -38,-28
+            3606: -1,37
+            3607: 0,37
+            3608: 1,37
+            3609: 2,37
         - node:
             color: '#FFFFFFFF'
             id: BotLeftGreyscale
@@ -762,15 +768,15 @@ entities:
             color: '#DE3A3A96'
             id: BotRight
           decals:
-            1429: -9,41
-            1430: -9,40
-            1431: -9,39
+            1407: -9,41
+            1408: -9,40
+            1409: -9,39
         - node:
             color: '#FFFFFFFF'
             id: BotRight
           decals:
-            2479: 10,-42
-            2480: 10,-41
+            2455: 10,-42
+            2456: 10,-41
         - node:
             color: '#FFFFFFFF'
             id: BotRightGreyscale
@@ -782,894 +788,894 @@ entities:
             color: '#FFFFFFFF'
             id: Box
           decals:
-            3587: -7,32
+            3563: -7,32
         - node:
             color: '#FFFFFFFF'
             id: BoxGreyscale
           decals:
-            2484: 14,-42
-            2485: 14,-41
-            3139: 15,-81
+            2460: 14,-42
+            2461: 14,-41
+            3115: 15,-81
         - node:
             color: '#FFFFFFFF'
             id: BrickTileDarkBox
           decals:
-            2086: -3,-17
-            2087: -1,-17
-            2088: 1,-17
+            2062: -3,-17
+            2063: -1,-17
+            2064: 1,-17
         - node:
             color: '#FFFFFFFF'
             id: BrickTileDarkCornerSe
           decals:
-            3000: 11,-35
+            2976: 11,-35
         - node:
             color: '#FFFFFFFF'
             id: BrickTileDarkInnerNe
           decals:
-            3628: -2,36
+            3604: -2,36
         - node:
             color: '#FFFFFFFF'
             id: BrickTileDarkInnerNw
           decals:
-            3629: 3,36
+            3605: 3,36
         - node:
             color: '#FFFFFFFF'
             id: BrickTileDarkInnerSe
           decals:
-            3627: -2,38
+            3603: -2,38
         - node:
             color: '#FFFFFFFF'
             id: BrickTileDarkInnerSw
           decals:
-            3626: 3,38
+            3602: 3,38
         - node:
             color: '#FFFFFFFF'
             id: BrickTileDarkLineE
           decals:
-            3001: 11,-34
-            3617: -2,37
+            2977: 11,-34
+            3593: -2,37
         - node:
             color: '#FFFFFFFF'
             id: BrickTileDarkLineN
           decals:
-            2965: -6,-66
-            2966: -7,-66
-            2967: -8,-66
-            2993: 13,-36
-            2994: 11,-36
-            2997: 12,-36
-            2998: 10,-36
-            2999: 9,-36
-            3622: -1,36
-            3623: 0,36
-            3624: 1,36
-            3625: 2,36
+            2941: -6,-66
+            2942: -7,-66
+            2943: -8,-66
+            2969: 13,-36
+            2970: 11,-36
+            2973: 12,-36
+            2974: 10,-36
+            2975: 9,-36
+            3598: -1,36
+            3599: 0,36
+            3600: 1,36
+            3601: 2,36
         - node:
             color: '#FFFFFFFF'
             id: BrickTileDarkLineS
           decals:
-            2968: -8,-62
-            2969: -7,-62
-            2970: -6,-62
-            2971: -4,-62
-            2972: -3,-62
-            2973: -2,-62
-            2974: -1,-62
-            2991: 10,-35
-            2992: 9,-35
-            3618: -1,38
-            3619: 0,38
-            3620: 1,38
-            3621: 2,38
+            2944: -8,-62
+            2945: -7,-62
+            2946: -6,-62
+            2947: -4,-62
+            2948: -3,-62
+            2949: -2,-62
+            2950: -1,-62
+            2967: 10,-35
+            2968: 9,-35
+            3594: -1,38
+            3595: 0,38
+            3596: 1,38
+            3597: 2,38
         - node:
             color: '#FFFFFFFF'
             id: BrickTileDarkLineW
           decals:
-            3579: -6,29
-            3580: -6,30
-            3581: -6,31
-            3582: -6,32
-            3616: 3,37
+            3555: -6,29
+            3556: -6,30
+            3557: -6,31
+            3558: -6,32
+            3592: 3,37
         - node:
             color: '#9FED584D'
             id: BrickTileSteelCornerNe
           decals:
-            3087: 35,-46
+            3063: 35,-46
         - node:
             color: '#D381C996'
             id: BrickTileSteelCornerNe
           decals:
-            1489: 74,-51
+            1467: 74,-51
         - node:
             color: '#EFB34196'
             id: BrickTileSteelCornerNe
           decals:
-            3093: 35,-49
+            3069: 35,-49
         - node:
             color: '#9FED584D'
             id: BrickTileSteelCornerNw
           decals:
-            3088: 34,-46
+            3064: 34,-46
         - node:
             color: '#D381C996'
             id: BrickTileSteelCornerNw
           decals:
-            1486: 71,-51
-            1495: 78,-51
+            1464: 71,-51
+            1473: 78,-51
         - node:
             color: '#EFB34196'
             id: BrickTileSteelCornerNw
           decals:
-            3094: 34,-49
+            3070: 34,-49
         - node:
             color: '#52B4E996'
             id: BrickTileSteelCornerSe
           decals:
-            3005: 19,-34
+            2981: 19,-34
         - node:
             color: '#9FED584D'
             id: BrickTileSteelCornerSe
           decals:
-            3089: 35,-47
+            3065: 35,-47
         - node:
             color: '#EFB34196'
             id: BrickTileSteelCornerSe
           decals:
-            3092: 35,-50
+            3068: 35,-50
         - node:
             color: '#52B4E996'
             id: BrickTileSteelCornerSw
           decals:
-            3004: 21,-34
+            2980: 21,-34
         - node:
             color: '#9FED584D'
             id: BrickTileSteelCornerSw
           decals:
-            3090: 34,-47
+            3066: 34,-47
         - node:
             color: '#EFB34196'
             id: BrickTileSteelCornerSw
           decals:
-            3091: 34,-50
+            3067: 34,-50
         - node:
             color: '#D381C996'
             id: BrickTileSteelInnerNe
           decals:
-            1498: 74,-53
+            1476: 74,-53
         - node:
             color: '#FFFFFFFF'
             id: BrickTileSteelInnerNe
           decals:
-            2431: 28,-36
+            2407: 28,-36
         - node:
             color: '#D381C996'
             id: BrickTileSteelInnerNw
           decals:
-            1499: 78,-53
+            1477: 78,-53
         - node:
             color: '#FFFFFFFF'
             id: BrickTileSteelInnerNw
           decals:
-            2430: 34,-36
+            2406: 34,-36
         - node:
             color: '#FFFFFFFF'
             id: BrickTileSteelInnerSw
           decals:
-            2466: 46,-53
+            2442: 46,-53
         - node:
             color: '#52B4E996'
             id: BrickTileSteelLineE
           decals:
-            3007: 19,-33
-            3095: 37,-50
-            3096: 37,-49
-            3097: 37,-47
-            3098: 37,-46
+            2983: 19,-33
+            3071: 37,-50
+            3072: 37,-49
+            3073: 37,-47
+            3074: 37,-46
         - node:
             color: '#D381C996'
             id: BrickTileSteelLineE
           decals:
-            1490: 74,-52
+            1468: 74,-52
         - node:
             color: '#FFFFFFFF'
             id: BrickTileSteelLineE
           decals:
-            2422: 28,-33
-            2423: 28,-34
-            2424: 28,-35
+            2398: 28,-33
+            2399: 28,-34
+            2400: 28,-35
         - node:
             color: '#D381C996'
             id: BrickTileSteelLineN
           decals:
-            1487: 72,-51
-            1488: 73,-51
-            1491: 75,-53
-            1492: 76,-53
-            1493: 77,-53
-            1496: 79,-51
-            1497: 80,-51
+            1465: 72,-51
+            1466: 73,-51
+            1469: 75,-53
+            1470: 76,-53
+            1471: 77,-53
+            1474: 79,-51
+            1475: 80,-51
         - node:
             color: '#DE3A3A96'
             id: BrickTileSteelLineN
           decals:
-            1389: -16,45
-            1390: -15,45
-            1391: -13,45
-            1392: -12,45
-            1393: -11,45
-            1394: -10,45
-            1395: -9,45
-            1396: -7,45
-            1397: -6,45
-            1398: -5,45
-            1399: -17,45
-            1400: -19,45
-            1401: -20,45
-            1402: -22,45
-            1403: -23,45
-            1404: -25,45
+            1367: -16,45
+            1368: -15,45
+            1369: -13,45
+            1370: -12,45
+            1371: -11,45
+            1372: -10,45
+            1373: -9,45
+            1374: -7,45
+            1375: -6,45
+            1376: -5,45
+            1377: -17,45
+            1378: -19,45
+            1379: -20,45
+            1380: -22,45
+            1381: -23,45
+            1382: -25,45
         - node:
             color: '#FFFFFFFF'
             id: BrickTileSteelLineN
           decals:
-            2425: 33,-36
-            2426: 32,-36
-            2427: 31,-36
-            2428: 30,-36
-            2429: 29,-36
+            2401: 33,-36
+            2402: 32,-36
+            2403: 31,-36
+            2404: 30,-36
+            2405: 29,-36
         - node:
             color: '#52B4E996'
             id: BrickTileSteelLineS
           decals:
-            3002: 22,-34
-            3003: 18,-34
+            2978: 22,-34
+            2979: 18,-34
         - node:
             color: '#D381C996'
             id: BrickTileSteelLineS
           decals:
-            1500: 72,-55
-            1501: 73,-55
-            1502: 74,-55
-            1503: 75,-55
-            1504: 76,-55
-            1505: 77,-55
-            1506: 78,-55
-            1507: 79,-55
-            1508: 80,-55
+            1478: 72,-55
+            1479: 73,-55
+            1480: 74,-55
+            1481: 75,-55
+            1482: 76,-55
+            1483: 77,-55
+            1484: 78,-55
+            1485: 79,-55
+            1486: 80,-55
         - node:
             color: '#DE3A3A96'
             id: BrickTileSteelLineS
           decals:
-            1380: -10,43
-            1381: -9,43
-            1382: -8,43
-            1383: -7,43
-            1384: -5,43
-            1385: -12,43
-            1386: -13,43
-            1387: -14,43
-            1388: -16,43
-            1405: -25,43
-            1406: -23,43
-            1407: -21,43
-            1408: -20,43
-            1409: -18,43
-            1410: -17,43
+            1358: -10,43
+            1359: -9,43
+            1360: -8,43
+            1361: -7,43
+            1362: -5,43
+            1363: -12,43
+            1364: -13,43
+            1365: -14,43
+            1366: -16,43
+            1383: -25,43
+            1384: -23,43
+            1385: -21,43
+            1386: -20,43
+            1387: -18,43
+            1388: -17,43
         - node:
             color: '#FFFFFFFF'
             id: BrickTileSteelLineS
           decals:
-            2463: 45,-53
-            2464: 44,-53
-            2465: 43,-53
+            2439: 45,-53
+            2440: 44,-53
+            2441: 43,-53
         - node:
             color: '#52B4E996'
             id: BrickTileSteelLineW
           decals:
-            3006: 21,-33
+            2982: 21,-33
         - node:
             color: '#D381C996'
             id: BrickTileSteelLineW
           decals:
-            1484: 71,-53
-            1485: 71,-52
-            1494: 78,-52
+            1462: 71,-53
+            1463: 71,-52
+            1472: 78,-52
         - node:
             color: '#FFFFFFFF'
             id: BrickTileSteelLineW
           decals:
-            2454: 34,-35
-            2462: 46,-54
-            3417: 45,-1
-            3418: 45,0
+            2430: 34,-35
+            2438: 46,-54
+            3393: 45,-1
+            3394: 45,0
         - node:
             color: '#D4D4D428'
             id: BrickTileWhiteBox
           decals:
-            2300: -16,-56
-            2301: -16,-52
+            2276: -16,-56
+            2277: -16,-52
         - node:
             color: '#334E6DC8'
             id: BrickTileWhiteCornerNe
           decals:
-            1337: -7,-12
-            2143: -10,-14
-            2296: -6,-51
+            1315: -7,-12
+            2119: -10,-14
+            2272: -6,-51
         - node:
             color: '#5299B43A'
             id: BrickTileWhiteCornerNe
           decals:
-            3077: 37,-40
+            3053: 37,-40
         - node:
             color: '#52B4E996'
             id: BrickTileWhiteCornerNe
           decals:
-            1707: 54,-24
-            2270: -15,-50
+            1685: 54,-24
+            2246: -15,-50
         - node:
             color: '#9FED5896'
             id: BrickTileWhiteCornerNe
           decals:
-            1317: 48,-4
+            1295: 48,-4
         - node:
             color: '#D381C996'
             id: BrickTileWhiteCornerNe
           decals:
-            1478: 70,-51
+            1456: 70,-51
         - node:
             color: '#D4D4D496'
             id: BrickTileWhiteCornerNe
           decals:
-            2284: -12,-57
+            2260: -12,-57
         - node:
             color: '#DE3A3A96'
             id: BrickTileWhiteCornerNe
           decals:
-            2280: -15,-57
+            2256: -15,-57
         - node:
             color: '#EFB34196'
             id: BrickTileWhiteCornerNe
           decals:
-            1520: -4,9
-            2276: -12,-50
-            2597: 7,-41
-            2665: -10,-73
-            2890: 9,-66
+            1498: -4,9
+            2252: -12,-50
+            2573: 7,-41
+            2641: -10,-73
+            2866: 9,-66
         - node:
             color: '#FFEBAE96'
             id: BrickTileWhiteCornerNe
           decals:
-            1642: 19,-21
+            1620: 19,-21
         - node:
             color: '#334E6DC8'
             id: BrickTileWhiteCornerNw
           decals:
-            1331: -14,-12
-            2142: -11,-14
-            2295: -8,-51
+            1309: -14,-12
+            2118: -11,-14
+            2271: -8,-51
         - node:
             color: '#5299B43A'
             id: BrickTileWhiteCornerNw
           decals:
-            3078: 34,-40
+            3054: 34,-40
         - node:
             color: '#52B4E996'
             id: BrickTileWhiteCornerNw
           decals:
-            1706: 52,-24
-            2269: -16,-50
+            1684: 52,-24
+            2245: -16,-50
         - node:
             color: '#9FED5896'
             id: BrickTileWhiteCornerNw
           decals:
-            1312: 43,-4
+            1290: 43,-4
         - node:
             color: '#D4D4D496'
             id: BrickTileWhiteCornerNw
           decals:
-            2283: -13,-57
+            2259: -13,-57
         - node:
             color: '#DE3A3A96'
             id: BrickTileWhiteCornerNw
           decals:
-            2279: -16,-57
-            3569: -15,27
+            2255: -16,-57
+            3545: -15,27
         - node:
             color: '#EFB34196'
             id: BrickTileWhiteCornerNw
           decals:
-            1519: -7,9
-            2275: -13,-50
-            2596: 3,-41
-            2666: -18,-73
-            2896: 1,-66
-            2901: -4,-67
-            2902: -8,-68
+            1497: -7,9
+            2251: -13,-50
+            2572: 3,-41
+            2642: -18,-73
+            2872: 1,-66
+            2877: -4,-67
+            2878: -8,-68
         - node:
             color: '#334E6DC8'
             id: BrickTileWhiteCornerSe
           decals:
-            1344: -7,-20
-            2144: -10,-16
-            2278: -15,-58
+            1322: -7,-20
+            2120: -10,-16
+            2254: -15,-58
         - node:
             color: '#5299B43A'
             id: BrickTileWhiteCornerSe
           decals:
-            3080: 37,-43
+            3056: 37,-43
         - node:
             color: '#9FED5896'
             id: BrickTileWhiteCornerSe
           decals:
-            2281: -12,-58
+            2257: -12,-58
         - node:
             color: '#A4610696'
             id: BrickTileWhiteCornerSe
           decals:
-            2274: -12,-51
+            2250: -12,-51
         - node:
             color: '#D381C996'
             id: BrickTileWhiteCornerSe
           decals:
-            2271: -15,-51
+            2247: -15,-51
         - node:
             color: '#EFB34196'
             id: BrickTileWhiteCornerSe
           decals:
-            2291: -6,-58
-            2604: 7,-45
-            2647: -5,-76
-            2680: -10,-77
+            2267: -6,-58
+            2580: 7,-45
+            2623: -5,-76
+            2656: -10,-77
         - node:
             color: '#334E6DC8'
             id: BrickTileWhiteCornerSw
           decals:
-            1345: -9,-20
-            2145: -11,-16
-            2277: -16,-58
+            1323: -9,-20
+            2121: -11,-16
+            2253: -16,-58
         - node:
             color: '#5299B43A'
             id: BrickTileWhiteCornerSw
           decals:
-            3079: 34,-43
+            3055: 34,-43
         - node:
             color: '#9FED5896'
             id: BrickTileWhiteCornerSw
           decals:
-            2282: -13,-58
+            2258: -13,-58
         - node:
             color: '#A4610696'
             id: BrickTileWhiteCornerSw
           decals:
-            2273: -13,-51
+            2249: -13,-51
         - node:
             color: '#D381C996'
             id: BrickTileWhiteCornerSw
           decals:
-            2272: -16,-51
+            2248: -16,-51
         - node:
             color: '#DE3A3A96'
             id: BrickTileWhiteCornerSw
           decals:
-            3570: -15,26
+            3546: -15,26
         - node:
             color: '#EFB34196'
             id: BrickTileWhiteCornerSw
           decals:
-            1522: -7,6
-            2289: -8,-58
-            2593: 3,-45
-            2646: -8,-76
-            2679: -18,-77
+            1500: -7,6
+            2265: -8,-58
+            2569: 3,-45
+            2622: -8,-76
+            2655: -18,-77
         - node:
             color: '#EFB34196'
             id: BrickTileWhiteInnerNe
           decals:
-            1527: -4,6
+            1505: -4,6
         - node:
             color: '#FFEBAE96'
             id: BrickTileWhiteInnerNe
           decals:
-            1641: 19,-22
+            1619: 19,-22
         - node:
             color: '#DE3A3A96'
             id: BrickTileWhiteInnerNw
           decals:
-            3577: -6,27
+            3553: -6,27
         - node:
             color: '#EFB34196'
             id: BrickTileWhiteInnerNw
           decals:
-            2925: -4,-68
+            2901: -4,-68
         - node:
             color: '#334E6DC8'
             id: BrickTileWhiteInnerSe
           decals:
-            1543: -10,8
+            1521: -10,8
         - node:
             color: '#334E6DC8'
             id: BrickTileWhiteInnerSw
           decals:
-            1347: -9,-18
-            1542: -14,8
+            1325: -9,-18
+            1520: -14,8
         - node:
             color: '#334E6DC8'
             id: BrickTileWhiteLineE
           decals:
-            1338: -7,-13
-            1339: -7,-14
-            1340: -7,-15
-            1341: -7,-16
-            1342: -7,-18
-            1343: -7,-19
-            1544: -10,7
-            1545: -10,6
-            1550: -11,2
-            1551: -11,3
-            2146: -10,-15
-            2298: -6,-52
+            1316: -7,-13
+            1317: -7,-14
+            1318: -7,-15
+            1319: -7,-16
+            1320: -7,-18
+            1321: -7,-19
+            1522: -10,7
+            1523: -10,6
+            1528: -11,2
+            1529: -11,3
+            2122: -10,-15
+            2274: -6,-52
         - node:
             color: '#5299B43A'
             id: BrickTileWhiteLineE
           decals:
-            3083: 37,-42
-            3084: 37,-41
+            3059: 37,-42
+            3060: 37,-41
         - node:
             color: '#52B4E996'
             id: BrickTileWhiteLineE
           decals:
-            1705: 54,-25
+            1683: 54,-25
         - node:
             color: '#9FED5896'
             id: BrickTileWhiteLineE
           decals:
-            1318: 48,-5
-            1319: 48,-6
-            1320: 48,-7
-            1321: 48,-8
-            1322: 48,-9
+            1296: 48,-5
+            1297: 48,-6
+            1298: 48,-7
+            1299: 48,-8
+            1300: 48,-9
         - node:
             color: '#A4610696'
             id: BrickTileWhiteLineE
           decals:
-            1554: -11,1
-            2345: -27,-17
-            2348: -27,-18
-            2349: -27,-16
+            1532: -11,1
+            2321: -27,-17
+            2324: -27,-18
+            2325: -27,-16
         - node:
             color: '#D381C996'
             id: BrickTileWhiteLineE
           decals:
-            1475: 70,-54
-            1476: 70,-53
-            1477: 70,-52
+            1453: 70,-54
+            1454: 70,-53
+            1455: 70,-52
         - node:
             color: '#DE3A3A96'
             id: BrickTileWhiteLineE
           decals:
-            1555: -11,4
-            3573: -5,30
-            3574: -5,31
-            3575: -5,32
-            3576: -5,29
+            1533: -11,4
+            3549: -5,30
+            3550: -5,31
+            3551: -5,32
+            3552: -5,29
         - node:
             color: '#EFB34196'
             id: BrickTileWhiteLineE
           decals:
-            1525: -4,8
-            1526: -4,7
-            2292: -6,-56
-            2293: -6,-55
-            2294: -6,-54
-            2601: 7,-42
-            2602: 7,-43
-            2603: 7,-44
-            2648: -5,-73
-            2652: -5,-72
-            2674: -10,-74
-            2675: -10,-76
-            2913: 9,-70
-            2914: 9,-69
-            2915: 9,-68
-            2916: 9,-67
+            1503: -4,8
+            1504: -4,7
+            2268: -6,-56
+            2269: -6,-55
+            2270: -6,-54
+            2577: 7,-42
+            2578: 7,-43
+            2579: 7,-44
+            2624: -5,-73
+            2628: -5,-72
+            2650: -10,-74
+            2651: -10,-76
+            2889: 9,-70
+            2890: 9,-69
+            2891: 9,-68
+            2892: 9,-67
         - node:
             color: '#334E6DC8'
             id: BrickTileWhiteLineN
           decals:
-            1332: -13,-12
-            1333: -12,-12
-            1334: -11,-12
-            1335: -10,-12
-            1336: -9,-12
-            1533: -9,8
-            1534: -10,8
-            1535: -11,8
-            1536: -12,8
-            1537: -14,8
-            1538: -13,8
-            1539: -15,8
-            2297: -7,-51
+            1310: -13,-12
+            1311: -12,-12
+            1312: -11,-12
+            1313: -10,-12
+            1314: -9,-12
+            1511: -9,8
+            1512: -10,8
+            1513: -11,8
+            1514: -12,8
+            1515: -14,8
+            1516: -13,8
+            1517: -15,8
+            2273: -7,-51
         - node:
             color: '#5299B43A'
             id: BrickTileWhiteLineN
           decals:
-            3075: 36,-40
-            3076: 35,-40
+            3051: 36,-40
+            3052: 35,-40
         - node:
             color: '#52B4E996'
             id: BrickTileWhiteLineN
           decals:
-            1703: 53,-27
-            1708: 53,-24
+            1681: 53,-27
+            1686: 53,-24
         - node:
             color: '#9FED5896'
             id: BrickTileWhiteLineN
           decals:
-            1313: 44,-4
-            1314: 45,-4
-            1315: 46,-4
-            1316: 47,-4
-            1323: 46,-10
-            1324: 45,-10
+            1291: 44,-4
+            1292: 45,-4
+            1293: 46,-4
+            1294: 47,-4
+            1301: 46,-10
+            1302: 45,-10
         - node:
             color: '#D381C996'
             id: BrickTileWhiteLineN
           decals:
-            1207: 64,-27
-            1208: 60,-27
-            1209: 59,-27
-            1210: 58,-27
-            1211: 57,-27
-            1212: 56,-27
-            1213: 55,-27
-            1214: 54,-27
-            1221: 74,-26
-            1222: 73,-26
-            1223: 72,-26
-            1224: 71,-26
-            1225: 70,-26
-            1226: 69,-26
-            1227: 70,-44
-            1228: 71,-44
-            1229: 72,-44
-            1230: 73,-44
-            1231: 74,-44
-            1232: 75,-44
-            1479: 69,-51
-            1480: 68,-51
-            1481: 67,-51
-            1482: 65,-51
+            1185: 64,-27
+            1186: 60,-27
+            1187: 59,-27
+            1188: 58,-27
+            1189: 57,-27
+            1190: 56,-27
+            1191: 55,-27
+            1192: 54,-27
+            1199: 74,-26
+            1200: 73,-26
+            1201: 72,-26
+            1202: 71,-26
+            1203: 70,-26
+            1204: 69,-26
+            1205: 70,-44
+            1206: 71,-44
+            1207: 72,-44
+            1208: 73,-44
+            1209: 74,-44
+            1210: 75,-44
+            1457: 69,-51
+            1458: 68,-51
+            1459: 67,-51
+            1460: 65,-51
         - node:
             color: '#DE3A3A96'
             id: BrickTileWhiteLineN
           decals:
-            3564: -7,27
-            3565: -10,27
-            3566: -11,27
-            3567: -13,27
-            3568: -14,27
-            3598: -12,36
-            3599: -13,36
-            3600: -14,36
-            3601: -15,36
-            3602: -16,36
+            3540: -7,27
+            3541: -10,27
+            3542: -11,27
+            3543: -13,27
+            3544: -14,27
+            3574: -12,36
+            3575: -13,36
+            3576: -14,36
+            3577: -15,36
+            3578: -16,36
         - node:
             color: '#EFB34196'
             id: BrickTileWhiteLineN
           decals:
-            1523: -6,9
-            1524: -5,9
-            2598: 6,-41
-            2599: 5,-41
-            2600: 4,-41
-            2635: 7,-73
-            2636: 6,-73
-            2637: 5,-73
-            2661: -20,-69
-            2662: -21,-69
-            2667: -17,-73
-            2668: -16,-73
-            2669: -15,-73
-            2670: -14,-73
-            2671: -13,-73
-            2672: -12,-73
-            2673: -11,-73
-            2891: 7,-66
-            2892: 6,-66
-            2893: 5,-66
-            2894: 4,-66
-            2895: 2,-66
-            2897: 0,-67
-            2898: -1,-67
-            2899: -2,-67
-            2900: -3,-67
-            2923: -6,-68
-            2924: -5,-68
+            1501: -6,9
+            1502: -5,9
+            2574: 6,-41
+            2575: 5,-41
+            2576: 4,-41
+            2611: 7,-73
+            2612: 6,-73
+            2613: 5,-73
+            2637: -20,-69
+            2638: -21,-69
+            2643: -17,-73
+            2644: -16,-73
+            2645: -15,-73
+            2646: -14,-73
+            2647: -13,-73
+            2648: -12,-73
+            2649: -11,-73
+            2867: 7,-66
+            2868: 6,-66
+            2869: 5,-66
+            2870: 4,-66
+            2871: 2,-66
+            2873: 0,-67
+            2874: -1,-67
+            2875: -2,-67
+            2876: -3,-67
+            2899: -6,-68
+            2900: -5,-68
         - node:
             color: '#FFEBAE96'
             id: BrickTileWhiteLineN
           decals:
-            1638: 22,-22
-            1639: 21,-22
-            1640: 20,-22
-            1643: 18,-21
+            1616: 22,-22
+            1617: 21,-22
+            1618: 20,-22
+            1621: 18,-21
         - node:
             color: '#334E6DC8'
             id: BrickTileWhiteLineS
           decals:
-            1348: -10,-18
-            1349: -11,-18
-            1350: -12,-18
-            1351: -13,-18
-            1540: -9,8
-            1541: -15,8
+            1326: -10,-18
+            1327: -11,-18
+            1328: -12,-18
+            1329: -13,-18
+            1518: -9,8
+            1519: -15,8
         - node:
             color: '#5299B43A'
             id: BrickTileWhiteLineS
           decals:
-            3081: 36,-43
-            3082: 35,-43
+            3057: 36,-43
+            3058: 35,-43
         - node:
             color: '#52B4E996'
             id: BrickTileWhiteLineS
           decals:
-            2095: -11,26
-            2096: -10,26
-            2097: -9,26
+            2071: -11,26
+            2072: -10,26
+            2073: -9,26
         - node:
             color: '#9FED5896'
             id: BrickTileWhiteLineS
           decals:
-            2098: -7,26
-            2099: -6,26
-            2100: -5,26
+            2074: -7,26
+            2075: -6,26
+            2076: -5,26
         - node:
             color: '#D381C996'
             id: BrickTileWhiteLineS
           decals:
-            1197: 64,-28
-            1198: 63,-28
-            1199: 62,-28
-            1200: 60,-28
-            1201: 59,-28
-            1202: 58,-28
-            1203: 56,-28
-            1204: 57,-28
-            1205: 54,-28
-            1206: 53,-28
-            1216: 57,-25
-            1217: 58,-25
-            1218: 59,-25
-            1219: 60,-25
-            1220: 56,-25
+            1175: 64,-28
+            1176: 63,-28
+            1177: 62,-28
+            1178: 60,-28
+            1179: 59,-28
+            1180: 58,-28
+            1181: 56,-28
+            1182: 57,-28
+            1183: 54,-28
+            1184: 53,-28
+            1194: 57,-25
+            1195: 58,-25
+            1196: 59,-25
+            1197: 60,-25
+            1198: 56,-25
         - node:
             color: '#DE3A3A96'
             id: BrickTileWhiteLineS
           decals:
-            2104: -4,26
-            2105: 0,26
-            2106: -8,26
-            2107: -12,26
-            2108: -13,26
-            2109: 1,26
-            2110: 2,26
-            2111: 3,26
-            2112: 5,26
-            2113: 10,26
-            2114: 8,26
-            2115: 7,26
-            3603: -12,34
-            3604: -13,34
-            3605: -14,34
-            3606: -16,34
+            2080: -4,26
+            2081: 0,26
+            2082: -8,26
+            2083: -12,26
+            2084: -13,26
+            2085: 1,26
+            2086: 2,26
+            2087: 3,26
+            2088: 5,26
+            2089: 10,26
+            2090: 8,26
+            2091: 7,26
+            3579: -12,34
+            3580: -13,34
+            3581: -14,34
+            3582: -16,34
         - node:
             color: '#EFB34196'
             id: BrickTileWhiteLineS
           decals:
-            1521: -5,6
-            2101: -3,26
-            2102: -2,26
-            2103: -1,26
-            2290: -7,-58
-            2605: 6,-45
-            2606: 5,-45
-            2607: 4,-45
-            2638: 8,-76
-            2639: 6,-76
-            2640: 7,-76
-            2653: -6,-76
-            2654: -7,-76
-            2663: -20,-71
-            2664: -21,-71
-            2681: -11,-77
-            2682: -12,-77
-            2683: -13,-77
-            2684: -14,-77
-            2685: -15,-77
-            2686: -16,-77
-            2687: -17,-77
-            2903: -4,-71
-            2904: -3,-71
-            2905: -2,-71
-            2906: -1,-71
-            2907: 0,-71
-            2908: 1,-71
-            2909: 2,-71
-            2910: 5,-71
-            2911: 6,-71
-            2912: 7,-71
+            1499: -5,6
+            2077: -3,26
+            2078: -2,26
+            2079: -1,26
+            2266: -7,-58
+            2581: 6,-45
+            2582: 5,-45
+            2583: 4,-45
+            2614: 8,-76
+            2615: 6,-76
+            2616: 7,-76
+            2629: -6,-76
+            2630: -7,-76
+            2639: -20,-71
+            2640: -21,-71
+            2657: -11,-77
+            2658: -12,-77
+            2659: -13,-77
+            2660: -14,-77
+            2661: -15,-77
+            2662: -16,-77
+            2663: -17,-77
+            2879: -4,-71
+            2880: -3,-71
+            2881: -2,-71
+            2882: -1,-71
+            2883: 0,-71
+            2884: 1,-71
+            2885: 2,-71
+            2886: 5,-71
+            2887: 6,-71
+            2888: 7,-71
         - node:
             color: '#334E6DC8'
             id: BrickTileWhiteLineW
           decals:
-            1325: -14,-18
-            1326: -14,-17
-            1327: -14,-16
-            1328: -14,-15
-            1329: -14,-14
-            1330: -14,-13
-            1346: -9,-19
-            1546: -14,6
-            1547: -14,7
-            1548: -13,2
-            1549: -13,3
-            1850: -19,-13
-            1851: -19,-12
-            1852: -19,-11
-            1853: -19,-10
-            2299: -8,-52
-            2351: -19,-14
+            1303: -14,-18
+            1304: -14,-17
+            1305: -14,-16
+            1306: -14,-15
+            1307: -14,-14
+            1308: -14,-13
+            1324: -9,-19
+            1524: -14,6
+            1525: -14,7
+            1526: -13,2
+            1527: -13,3
+            1826: -19,-13
+            1827: -19,-12
+            1828: -19,-11
+            1829: -19,-10
+            2275: -8,-52
+            2327: -19,-14
         - node:
             color: '#5299B43A'
             id: BrickTileWhiteLineW
           decals:
-            3085: 34,-42
-            3086: 34,-41
+            3061: 34,-42
+            3062: 34,-41
         - node:
             color: '#52B4E996'
             id: BrickTileWhiteLineW
           decals:
-            1552: -13,4
-            1709: 52,-25
+            1530: -13,4
+            1687: 52,-25
         - node:
             color: '#9FED5896'
             id: BrickTileWhiteLineW
           decals:
-            1307: 43,-9
-            1308: 43,-8
-            1309: 43,-7
-            1310: 43,-6
-            1311: 43,-5
+            1285: 43,-9
+            1286: 43,-8
+            1287: 43,-7
+            1288: 43,-6
+            1289: 43,-5
         - node:
             color: '#D381C996'
             id: BrickTileWhiteLineW
           decals:
-            1553: -13,1
+            1531: -13,1
         - node:
             color: '#DE3A3A96'
             id: BrickTileWhiteLineW
           decals:
-            3578: -6,28
-            3583: -6,29
-            3584: -6,30
-            3585: -6,31
-            3586: -6,32
+            3554: -6,28
+            3559: -6,29
+            3560: -6,30
+            3561: -6,31
+            3562: -6,32
         - node:
             color: '#EFB34196'
             id: BrickTileWhiteLineW
           decals:
-            1518: -7,7
-            2286: -8,-55
-            2287: -8,-56
-            2288: -8,-57
-            2594: 3,-44
-            2595: 3,-42
-            2649: -8,-74
-            2650: -8,-73
-            2651: -8,-72
-            2676: -18,-74
-            2677: -18,-75
-            2678: -18,-76
+            1496: -7,7
+            2262: -8,-55
+            2263: -8,-56
+            2264: -8,-57
+            2570: 3,-44
+            2571: 3,-42
+            2625: -8,-74
+            2626: -8,-73
+            2627: -8,-72
+            2652: -18,-74
+            2653: -18,-75
+            2654: -18,-76
         - node:
             color: '#FFFFFFFF'
             id: Bushb1
@@ -1679,13 +1685,13 @@ entities:
             color: '#FFFFFFFF'
             id: Bushe3
           decals:
-            1367: 6.4905357,-24.138845
+            1345: 6.4905357,-24.138845
         - node:
             color: '#FFFFFFFF'
             id: Bushe4
           decals:
             501: -15.010791,-24.240007
-            1368: 8.037411,-24.076345
+            1346: 8.037411,-24.076345
         - node:
             color: '#FFFFFFFF'
             id: Bushg2
@@ -1700,28 +1706,28 @@ entities:
             color: '#FFFFFFFF'
             id: Bushi1
           decals:
-            1165: 44.560696,-52.296127
+            1143: 44.560696,-52.296127
         - node:
             color: '#FFFFFFFF'
             id: Bushi3
           decals:
-            1166: 47.01382,-53.968002
+            1144: 47.01382,-53.968002
         - node:
             color: '#FFFFFFFF'
             id: Bushj3
           decals:
-            1164: 45.623196,-52.499252
-            1369: 6.9749107,-24.013845
+            1142: 45.623196,-52.499252
+            1347: 6.9749107,-24.013845
         - node:
             color: '#FFFFFFFF'
             id: Bushl4
           decals:
-            1365: 7.9749107,-24.107595
+            1343: 7.9749107,-24.107595
         - node:
             color: '#FFFFFFFF'
             id: Bushm1
           decals:
-            1366: 6.1780357,-24.02947
+            1344: 6.1780357,-24.02947
         - node:
             color: '#FFFFFFFF'
             id: Bushn1
@@ -1731,56 +1737,56 @@ entities:
             color: '#FFFFFFFF'
             id: Caution
           decals:
-            1702: 66,-22
-            2460: 31,-34
-            2645: 9,-74
+            1680: 66,-22
+            2436: 31,-34
+            2621: 9,-74
         - node:
             color: '#3B393B85'
             id: CheckerNESW
           decals:
-            2570: 5,-50
-            2571: 6,-50
-            2572: 7,-50
-            2573: 5,-47
-            2574: 6,-47
-            2575: 7,-47
+            2546: 5,-50
+            2547: 6,-50
+            2548: 7,-50
+            2549: 5,-47
+            2550: 6,-47
+            2551: 7,-47
         - node:
             color: '#52B4E996'
             id: CheckerNESW
           decals:
             174: 43,-58
             175: 47,-58
-            1270: 1,-48
-            1592: 43,-48
-            1593: 44,-48
-            1594: 45,-48
-            1595: 46,-48
-            1596: 46,-47
-            1597: 45,-47
-            1598: 44,-47
-            1599: 43,-47
-            1600: 43,-46
-            1601: 44,-46
-            1602: 45,-46
-            1603: 46,-46
-            1604: 46,-45
-            1605: 45,-45
-            1606: 44,-45
-            1607: 43,-45
-            1608: 42,-46
-            3162: 34,-44
-            3163: 35,-44
-            3164: 36,-44
-            3165: 37,-44
-            3166: 37,-39
-            3167: 36,-39
-            3168: 35,-39
-            3169: 34,-39
+            1248: 1,-48
+            1570: 43,-48
+            1571: 44,-48
+            1572: 45,-48
+            1573: 46,-48
+            1574: 46,-47
+            1575: 45,-47
+            1576: 44,-47
+            1577: 43,-47
+            1578: 43,-46
+            1579: 44,-46
+            1580: 45,-46
+            1581: 46,-46
+            1582: 46,-45
+            1583: 45,-45
+            1584: 44,-45
+            1585: 43,-45
+            1586: 42,-46
+            3138: 34,-44
+            3139: 35,-44
+            3140: 36,-44
+            3141: 37,-44
+            3142: 37,-39
+            3143: 36,-39
+            3144: 35,-39
+            3145: 34,-39
         - node:
             color: '#92929B96'
             id: CheckerNESW
           decals:
-            1306: 37,-7
+            1284: 37,-7
         - node:
             color: '#9D9D97FF'
             id: CheckerNESW
@@ -1810,33 +1816,33 @@ entities:
             color: '#9FED5896'
             id: CheckerNESW
           decals:
-            3405: 45,-1
-            3406: 45,0
-            3407: 46,-1
-            3408: 46,0
-            3409: 47,-1
-            3410: 47,0
-            3411: 48,-1
-            3412: 48,0
-            3413: 48,1
-            3414: 49,1
-            3415: 49,0
-            3416: 49,-1
+            3381: 45,-1
+            3382: 45,0
+            3383: 46,-1
+            3384: 46,0
+            3385: 47,-1
+            3386: 47,0
+            3387: 48,-1
+            3388: 48,0
+            3389: 48,1
+            3390: 49,1
+            3391: 49,0
+            3392: 49,-1
         - node:
             color: '#D381C996'
             id: CheckerNESW
           decals:
             266: 68,-37
-            1567: 49,-28
-            1714: 61,-32
-            1715: 61,-31
-            1716: 61,-30
-            1717: 62,-30
-            1718: 63,-30
-            1719: 63,-31
-            1720: 62,-31
-            1721: 62,-32
-            1722: 63,-32
+            1545: 49,-28
+            1692: 61,-32
+            1693: 61,-31
+            1694: 61,-30
+            1695: 62,-30
+            1696: 63,-30
+            1697: 63,-31
+            1698: 62,-31
+            1699: 62,-32
+            1700: 63,-32
         - node:
             color: '#D4D4D428'
             id: CheckerNESW
@@ -1846,81 +1852,81 @@ entities:
             color: '#DE3A3A96'
             id: CheckerNESW
           decals:
-            1268: 1,-50
-            1269: 1,-49
+            1246: 1,-50
+            1247: 1,-49
         - node:
             color: '#EFB34196'
             id: CheckerNESW
           decals:
             956: 1,-42
-            2582: 3,-50
-            2583: 3,-49
-            2584: 3,-48
-            2585: 3,-47
+            2558: 3,-50
+            2559: 3,-49
+            2560: 3,-48
+            2561: 3,-47
         - node:
             color: '#EFCC4163'
             id: CheckerNESW
           decals:
-            2864: -1,-65
-            2865: -2,-65
-            2866: -2,-64
-            2867: -1,-64
-            2868: -1,-63
-            2869: -2,-63
-            2870: -4,-63
-            2871: -3,-63
-            2872: -3,-64
-            2873: -4,-64
-            2874: -5,-64
-            2875: -5,-63
-            2876: -3,-65
-            2877: -4,-65
-            2878: -5,-65
-            2879: -6,-65
-            2880: -8,-65
-            2881: -7,-65
-            2882: -6,-64
-            2883: -7,-64
-            2884: -8,-64
-            2885: -8,-63
-            2886: -7,-63
-            2887: -6,-63
+            2840: -1,-65
+            2841: -2,-65
+            2842: -2,-64
+            2843: -1,-64
+            2844: -1,-63
+            2845: -2,-63
+            2846: -4,-63
+            2847: -3,-63
+            2848: -3,-64
+            2849: -4,-64
+            2850: -5,-64
+            2851: -5,-63
+            2852: -3,-65
+            2853: -4,-65
+            2854: -5,-65
+            2855: -6,-65
+            2856: -8,-65
+            2857: -7,-65
+            2858: -6,-64
+            2859: -7,-64
+            2860: -8,-64
+            2861: -8,-63
+            2862: -7,-63
+            2863: -6,-63
         - node:
             color: '#FFEBAE96'
             id: CheckerNESW
           decals:
-            1609: 21,-21
-            1610: 22,-21
-            1611: 22,-20
-            1612: 21,-20
-            1613: 21,-19
-            1614: 22,-19
-            1615: 22,-18
-            1616: 21,-18
-            1617: 21,-17
-            1618: 22,-17
-            1619: 19,-19
-            1620: 19,-18
-            1621: 18,-18
-            1622: 18,-19
-            1623: 18,-17
-            1624: 19,-17
+            1587: 21,-21
+            1588: 22,-21
+            1589: 22,-20
+            1590: 21,-20
+            1591: 21,-19
+            1592: 22,-19
+            1593: 22,-18
+            1594: 21,-18
+            1595: 21,-17
+            1596: 22,-17
+            1597: 19,-19
+            1598: 19,-18
+            1599: 18,-18
+            1600: 18,-19
+            1601: 18,-17
+            1602: 19,-17
         - node:
             color: '#FFFFFFFF'
             id: CheckerNESW
           decals:
-            3393: 45,-1
-            3394: 45,0
-            3395: 46,0
-            3396: 46,-1
-            3397: 47,-1
-            3398: 47,0
-            3399: 48,-1
-            3400: 48,0
-            3401: 49,-1
-            3402: 49,0
-            3403: 49,1
-            3404: 48,1
+            3369: 45,-1
+            3370: 45,0
+            3371: 46,0
+            3372: 46,-1
+            3373: 47,-1
+            3374: 47,0
+            3375: 48,-1
+            3376: 48,0
+            3377: 49,-1
+            3378: 49,0
+            3379: 49,1
+            3380: 48,1
         - node:
             color: '#334E6DC8'
             id: CheckerNWSE
@@ -1960,10 +1966,10 @@ entities:
             color: '#4A464A85'
             id: CheckerNWSE
           decals:
-            2589: 3,-50
-            2590: 3,-49
-            2591: 3,-48
-            2592: 3,-47
+            2565: 3,-50
+            2566: 3,-49
+            2567: 3,-48
+            2568: 3,-47
         - node:
             color: '#52B4E996'
             id: CheckerNWSE
@@ -1978,37 +1984,37 @@ entities:
             806: 31,-22
             807: 32,-22
             808: 32,-21
-            1667: 49,-38
-            1668: 49,-37
-            1669: 49,-36
-            1670: 49,-35
-            1671: 49,-34
-            3012: 38,-30
-            3013: 38,-29
-            3014: 38,-28
-            3015: 38,-27
-            3016: 39,-27
-            3017: 40,-27
-            3018: 41,-27
-            3019: 41,-28
-            3020: 40,-28
-            3021: 39,-28
-            3022: 39,-29
-            3023: 39,-30
-            3024: 40,-30
-            3025: 40,-29
-            3026: 41,-29
-            3027: 41,-30
-            3103: 40,-49
-            3104: 40,-48
-            3105: 40,-47
-            3106: 40,-46
-            3107: 40,-45
-            3108: 40,-44
-            3109: 40,-43
-            3110: 40,-42
-            3111: 40,-41
-            3112: 40,-40
+            1645: 49,-38
+            1646: 49,-37
+            1647: 49,-36
+            1648: 49,-35
+            1649: 49,-34
+            2988: 38,-30
+            2989: 38,-29
+            2990: 38,-28
+            2991: 38,-27
+            2992: 39,-27
+            2993: 40,-27
+            2994: 41,-27
+            2995: 41,-28
+            2996: 40,-28
+            2997: 39,-28
+            2998: 39,-29
+            2999: 39,-30
+            3000: 40,-30
+            3001: 40,-29
+            3002: 41,-29
+            3003: 41,-30
+            3079: 40,-49
+            3080: 40,-48
+            3081: 40,-47
+            3082: 40,-46
+            3083: 40,-45
+            3084: 40,-44
+            3085: 40,-43
+            3086: 40,-42
+            3087: 40,-41
+            3088: 40,-40
         - node:
             color: '#9FED5896'
             id: CheckerNWSE
@@ -2025,61 +2031,61 @@ entities:
             744: 47,-59
             745: 47,-60
             746: 47,-61
-            3196: 3,-36
-            3197: 3,-35
-            3198: 4,-35
-            3199: 4,-36
-            3200: 5,-36
-            3201: 5,-35
-            3202: 6,-35
-            3203: 6,-36
+            3172: 3,-36
+            3173: 3,-35
+            3174: 4,-35
+            3175: 4,-36
+            3176: 5,-36
+            3177: 5,-35
+            3178: 6,-35
+            3179: 6,-36
         - node:
             color: '#A4610696'
             id: CheckerNWSE
           decals:
-            3214: -33,-31
-            3215: -33,-30
-            3216: -32,-30
-            3217: -32,-31
+            3190: -33,-31
+            3191: -33,-30
+            3192: -32,-30
+            3193: -32,-31
         - node:
             color: '#D381C996'
             id: CheckerNWSE
           decals:
-            1181: 82,-25
-            1182: 82,-24
-            1183: 81,-24
-            1184: 81,-25
-            1185: 80,-25
-            1186: 80,-24
-            1187: 79,-24
-            1188: 79,-25
-            1189: 78,-25
-            1190: 78,-24
-            1191: 77,-24
-            1192: 76,-24
-            1193: 76,-25
-            1194: 77,-25
+            1159: 82,-25
+            1160: 82,-24
+            1161: 81,-24
+            1162: 81,-25
+            1163: 80,-25
+            1164: 80,-24
+            1165: 79,-24
+            1166: 79,-25
+            1167: 78,-25
+            1168: 78,-24
+            1169: 77,-24
+            1170: 76,-24
+            1171: 76,-25
+            1172: 77,-25
         - node:
             color: '#D4D4D496'
             id: CheckerNWSE
           decals:
-            1265: 1,-50
-            1266: 1,-49
-            1267: 1,-48
+            1243: 1,-50
+            1244: 1,-49
+            1245: 1,-48
         - node:
             color: '#EFB34196'
             id: CheckerNWSE
           decals:
-            1528: -7,3
-            1529: -7,4
-            1530: -6,4
-            1531: -6,3
-            2567: 5,-50
-            2568: 6,-50
-            2569: 7,-50
-            2576: 7,-47
-            2577: 6,-47
-            2578: 5,-47
+            1506: -7,3
+            1507: -7,4
+            1508: -6,4
+            1509: -6,3
+            2543: 5,-50
+            2544: 6,-50
+            2545: 7,-50
+            2552: 7,-47
+            2553: 6,-47
+            2554: 5,-47
         - node:
             color: '#FFFFFFFF'
             id: Delivery
@@ -2116,98 +2122,103 @@ entities:
             1003: 82,-12
             1004: 82,-6
             1005: 82,-4
-            1140: -26,-18
-            1141: -26,-16
-            1144: 28,-30
-            1145: 28,-29
-            1146: 34,-30
-            1147: 34,-29
-            1148: 35,-27
-            1149: 36,-27
-            1150: 25,-27
-            1151: 26,-27
-            1152: 23,-26
-            1153: 23,-25
-            1154: 39,-38
-            1155: 40,-38
-            1156: 41,-38
-            2163: 14,-24
-            2164: 15,-24
-            2165: 16,-24
-            2166: 16,-11
-            2167: 15,-11
-            2168: 14,-11
-            2169: -10,-32
-            2170: -10,-31
-            2171: -10,-30
-            2172: -16,-21
-            2173: -17,-21
-            2174: -7,-3
-            2175: -7,-2
-            2176: -7,-1
-            2177: 5,-3
-            2178: 5,-2
-            2179: 5,-1
-            2352: -18,-21
-            2458: 30,-33
-            2459: 32,-33
-            2502: 0,-51
-            2503: -1,-51
-            2504: -2,-51
-            2515: 0,-34
-            2516: -1,-34
-            2517: -2,-34
-            2539: 3,-51
-            2540: 2,-57
-            2586: 3,-46
-            2587: 4,-49
-            2588: 4,-48
-            2626: -9,-71
-            2627: -9,-70
-            2628: -9,-69
-            2629: -19,-70
-            2656: -9,-75
-            2657: -8,-72
-            2658: -7,-72
-            2659: -6,-72
-            2660: -5,-72
-            2708: 8,-72
-            2709: 9,-72
-            2710: 4,-72
-            2711: 3,-72
-            2975: -1,-62
-            3057: 67,-54
-            3060: 70,-44
-            3061: 78,-42
-            3062: 78,-40
-            3250: -38,-20
-            3251: -37,-20
-            3252: -36,-20
-            3253: -35,-20
-            3267: -40,-27
-            3268: -40,-25
-            3269: -40,-23
-            3270: -38,-31
-            3271: -39,-31
-            3272: -40,-31
-            3284: -26,-39
-            3285: -27,-39
-            3286: -28,-39
-            3419: 87,-6
-            3420: 87,-4
-            3421: 87,-12
-            3422: 87,-14
-            3423: 83,-14
-            3424: 83,-12
-            3425: 83,-6
-            3426: 83,-4
-            3430: 9,-32
-            3431: 9,-31
-            3432: 9,-30
-            3499: 3,-65
-            3500: 8,-65
-            3501: 8,-59
-            3502: 4,-59
+            1118: -26,-18
+            1119: -26,-16
+            1122: 28,-30
+            1123: 28,-29
+            1124: 34,-30
+            1125: 34,-29
+            1126: 35,-27
+            1127: 36,-27
+            1128: 25,-27
+            1129: 26,-27
+            1130: 23,-26
+            1131: 23,-25
+            1132: 39,-38
+            1133: 40,-38
+            1134: 41,-38
+            2139: 14,-24
+            2140: 15,-24
+            2141: 16,-24
+            2142: 16,-11
+            2143: 15,-11
+            2144: 14,-11
+            2145: -10,-32
+            2146: -10,-31
+            2147: -10,-30
+            2148: -16,-21
+            2149: -17,-21
+            2150: -7,-3
+            2151: -7,-2
+            2152: -7,-1
+            2153: 5,-3
+            2154: 5,-2
+            2155: 5,-1
+            2328: -18,-21
+            2434: 30,-33
+            2435: 32,-33
+            2478: 0,-51
+            2479: -1,-51
+            2480: -2,-51
+            2491: 0,-34
+            2492: -1,-34
+            2493: -2,-34
+            2515: 3,-51
+            2516: 2,-57
+            2562: 3,-46
+            2563: 4,-49
+            2564: 4,-48
+            2602: -9,-71
+            2603: -9,-70
+            2604: -9,-69
+            2605: -19,-70
+            2632: -9,-75
+            2633: -8,-72
+            2634: -7,-72
+            2635: -6,-72
+            2636: -5,-72
+            2684: 8,-72
+            2685: 9,-72
+            2686: 4,-72
+            2687: 3,-72
+            2951: -1,-62
+            3033: 67,-54
+            3036: 70,-44
+            3037: 78,-42
+            3038: 78,-40
+            3226: -38,-20
+            3227: -37,-20
+            3228: -36,-20
+            3229: -35,-20
+            3243: -40,-27
+            3244: -40,-25
+            3245: -40,-23
+            3246: -38,-31
+            3247: -39,-31
+            3248: -40,-31
+            3260: -26,-39
+            3261: -27,-39
+            3262: -28,-39
+            3395: 87,-6
+            3396: 87,-4
+            3397: 87,-12
+            3398: 87,-14
+            3399: 83,-14
+            3400: 83,-12
+            3401: 83,-6
+            3402: 83,-4
+            3406: 9,-32
+            3407: 9,-31
+            3408: 9,-30
+            3475: 3,-65
+            3476: 8,-65
+            3477: 8,-59
+            3478: 4,-59
+            3651: 57,-44
+            3652: 58,-44
+            3653: 59,-44
+            3654: 60,-44
+            3658: 58,-51
         - node:
             cleanable: True
             color: '#474F52FF'
@@ -2261,34 +2272,59 @@ entities:
             color: '#D4D4D4A4'
             id: Dirt
           decals:
-            2554: 0,-57
-            2555: -1,-57
-            2556: -2,-55
-            2557: 0,-53
-            2558: 0,-54
-            2559: -2,-53
-            2560: 0,-52
-            2561: -2,-50
-            2562: -1,-49
-            2563: 0,-48
-            2564: -2,-47
-            2565: -1,-46
-            2566: -1,-45
+            2530: 0,-57
+            2531: -1,-57
+            2532: -2,-55
+            2533: 0,-53
+            2534: 0,-54
+            2535: -2,-53
+            2536: 0,-52
+            2537: -2,-50
+            2538: -1,-49
+            2539: 0,-48
+            2540: -2,-47
+            2541: -1,-46
+            2542: -1,-45
         - node:
             cleanable: True
             color: '#FFFFFFFF'
             id: Dirt
           decals:
-            3503: 3,-63
-            3504: 3,-62
-            3505: 4,-61
-            3506: 7,-61
-            3507: 8,-61
-            3508: 8,-60
-            3509: 8,-56
-            3510: 8,-55
-            3511: 6,-54
-            3512: 4,-53
+            3479: 3,-63
+            3480: 3,-62
+            3481: 4,-61
+            3482: 7,-61
+            3483: 8,-61
+            3484: 8,-60
+            3485: 8,-56
+            3486: 8,-55
+            3487: 6,-54
+            3488: 4,-53
+            3624: 55,-53
+            3625: 53,-55
+            3626: 60,-55
+            3627: 61,-56
+            3628: 65,-56
+            3629: 51,-56
+            3630: 50,-55
+            3631: 44,-50
+            3632: 43,-50
+            3633: 51,-49
+            3634: 50,-48
+            3635: 47,-42
+            3636: 48,-43
+            3637: 44,-43
+            3638: 51,-46
+            3639: 57,-51
+            3640: 57,-52
+            3641: 61,-53
+            3642: 63,-52
+            3643: 60,-51
+            3646: 60,-48
+            3647: 53,-50
+            3648: 55,-49
+            3649: 57,-45
+            3650: 58,-46
         - node:
             color: '#FFFFFFFF'
             id: DirtHeavy
@@ -2299,39 +2335,43 @@ entities:
             color: '#FFFFFFFF'
             id: DirtHeavy
           decals:
-            2553: -1,-55
-            2779: 5,-69
-            2780: 6,-69
-            2781: 0,-70
-            2938: -7,-71
-            2939: -8,-71
-            2940: -7,-72
-            2941: -7,-73
-            2942: -6,-73
-            2943: -1,-72
-            2944: 0,-72
-            3307: -32,-22
-            3308: -36,-22
-            3309: -38,-24
-            3310: -36,-26
-            3311: -36,-29
-            3342: -27,-38
-            3343: -28,-36
-            3344: -28,-35
-            3345: -28,-34
-            3346: -25,-33
-            3513: 3,-61
-            3514: 8,-62
-            3515: 8,-57
+            2529: -1,-55
+            2755: 5,-69
+            2756: 6,-69
+            2757: 0,-70
+            2914: -7,-71
+            2915: -8,-71
+            2916: -7,-72
+            2917: -7,-73
+            2918: -6,-73
+            2919: -1,-72
+            2920: 0,-72
+            3283: -32,-22
+            3284: -36,-22
+            3285: -38,-24
+            3286: -36,-26
+            3287: -36,-29
+            3318: -27,-38
+            3319: -28,-36
+            3320: -28,-35
+            3321: -28,-34
+            3322: -25,-33
+            3489: 3,-61
+            3490: 8,-62
+            3491: 8,-57
+            3616: 63,-56
+            3617: 58,-56
         - node:
             cleanable: True
             color: '#FFFFFFFF'
             id: DirtHeavyMonotile
           decals:
-            2945: 1,-72
-            2946: 1,-71
-            2947: 4,-71
-            2948: 3,-66
+            2921: 1,-72
+            2922: 1,-71
+            2923: 4,-71
+            2924: 3,-66
+            3611: 51,-56
+            3612: 51,-48
         - node:
             cleanable: True
             color: '#474F52FF'
@@ -2382,16 +2422,16 @@ entities:
             466: -32,-19
             467: -31,-20
             468: -25,-20
-            2132: -6,24
-            2133: -5,23
-            2134: -6,25
-            2135: -2,25
-            2136: -3,23
-            2137: -3,24
-            2138: -11,24
-            2139: -10,25
-            2140: -10,23
-            2141: -9,23
+            2108: -6,24
+            2109: -5,23
+            2110: -6,25
+            2111: -2,25
+            2112: -3,23
+            2113: -3,24
+            2114: -11,24
+            2115: -10,25
+            2116: -10,23
+            2117: -9,23
         - node:
             cleanable: True
             color: '#FFFFFFFF'
@@ -2432,168 +2472,175 @@ entities:
             1052: -40,-31
             1053: -41,-30
             1054: -42,-25
-            1271: 11,-53
-            1272: 6,-49
-            1273: 7,-48
-            1274: -1,-42
-            1275: -2,-44
-            1276: 0,-45
-            1277: 0,-49
-            1278: 1,-45
-            1279: 0,-42
-            1280: -1,-38
-            1281: -2,-35
-            1282: -1,-35
-            1283: 0,-33
-            1284: 1,-32
-            1285: -2,-32
-            1432: -6,47
-            1433: -6,47
-            1434: -9,49
-            1435: -8,48
-            1436: -5,50
-            1437: -3,50
-            1438: 0,49
-            1439: 1,48
-            1440: 2,50
-            1441: 3,50
-            1442: -10,50
-            1443: -12,49
-            1444: -16,43
-            1445: -14,43
-            1446: -11,41
-            1447: -6,35
-            1448: -8,35
-            1449: -6,39
-            1451: -10,49
-            1452: -7,51
-            1453: -10,52
-            1454: 3,49
-            2541: -1,-50
-            2542: 0,-50
-            2543: -1,-51
-            2544: -1,-52
-            2545: -1,-53
-            2546: -1,-54
-            2547: 0,-56
-            2548: 1,-57
-            2549: 2,-57
-            2749: 4,-68
-            2750: 8,-68
-            2751: 8,-73
-            2752: 8,-75
-            2753: 9,-73
-            2754: 11,-74
-            2755: 11,-73
-            2756: 4,-74
-            2757: 3,-73
-            2758: 1,-74
-            2759: 0,-74
-            2760: -1,-73
-            2761: -3,-75
-            2762: -4,-74
-            2763: -4,-75
-            2764: -5,-74
-            2765: -6,-73
-            2766: -5,-69
-            2767: -4,-68
-            2768: -10,-70
-            2769: -11,-69
-            2770: -13,-70
-            2771: -15,-70
-            2772: -17,-69
-            2773: -10,-75
-            2774: -11,-76
-            2775: -13,-77
-            2776: 0,-70
-            2777: 1,-69
-            2778: 7,-68
-            2789: 7,-70
-            2790: 0,-69
-            2791: -1,-69
-            2792: -2,-70
-            2793: -7,-69
-            2794: -6,-68
-            2795: -5,-68
-            2796: -4,-69
-            2797: -4,-70
-            2949: 2,-67
-            2950: 3,-67
-            2951: 2,-66
-            2952: 5,-67
-            2953: 5,-67
-            2954: 4,-67
-            2955: 9,-70
-            2956: 9,-71
-            2957: 8,-71
-            2958: -4,-71
-            2959: -6,-71
-            2960: -8,-70
-            2961: -8,-69
-            2962: -7,-70
-            2963: -10,-71
-            2964: -12,-71
-            3291: -40,-30
-            3292: -41,-31
-            3293: -38,-30
-            3294: -38,-31
-            3295: -36,-31
-            3296: -38,-28
-            3297: -41,-27
-            3298: -38,-25
-            3299: -36,-26
-            3300: -39,-24
-            3301: -37,-22
-            3302: -35,-21
-            3303: -33,-21
-            3304: -33,-21
-            3305: -31,-22
-            3306: -29,-23
-            3352: -26,-35
-            3353: -26,-35
-            3354: -25,-35
-            3355: -27,-35
-            3356: -26,-33
-            3357: -27,-33
-            3358: -27,-31
-            3359: -28,-31
-            3360: -28,-32
-            3361: -29,-32
-            3362: -31,-31
-            3363: -30,-31
-            3364: -35,-31
-            3365: -26,-29
-            3366: -25,-30
-            3367: -25,-28
-            3368: -26,-28
-            3369: -28,-28
-            3370: -28,-27
-            3371: -28,-26
-            3372: -26,-25
-            3373: -25,-27
-            3374: -25,-27
-            3375: -23,-27
-            3376: -22,-27
-            3377: -21,-25
-            3516: 8,-58
-            3517: 7,-57
-            3518: 8,-54
-            3519: 7,-54
-            3520: 4,-54
-            3521: 5,-53
-            3522: 3,-53
-            3523: 3,-64
-            3524: 2,-63
-            3525: 5,-61
-            3526: 6,-61
-            3527: 4,-60
-            3528: 8,-64
-            3529: 6,-57
-            3530: 5,-57
-            3531: 5,-57
-            3532: 3,-57
-            3533: 4,-58
-            3534: 4,-56
+            1249: 11,-53
+            1250: 6,-49
+            1251: 7,-48
+            1252: -1,-42
+            1253: -2,-44
+            1254: 0,-45
+            1255: 0,-49
+            1256: 1,-45
+            1257: 0,-42
+            1258: -1,-38
+            1259: -2,-35
+            1260: -1,-35
+            1261: 0,-33
+            1262: 1,-32
+            1263: -2,-32
+            1410: -6,47
+            1411: -6,47
+            1412: -9,49
+            1413: -8,48
+            1414: -5,50
+            1415: -3,50
+            1416: 0,49
+            1417: 1,48
+            1418: 2,50
+            1419: 3,50
+            1420: -10,50
+            1421: -12,49
+            1422: -16,43
+            1423: -14,43
+            1424: -11,41
+            1425: -6,35
+            1426: -8,35
+            1427: -6,39
+            1429: -10,49
+            1430: -7,51
+            1431: -10,52
+            1432: 3,49
+            2517: -1,-50
+            2518: 0,-50
+            2519: -1,-51
+            2520: -1,-52
+            2521: -1,-53
+            2522: -1,-54
+            2523: 0,-56
+            2524: 1,-57
+            2525: 2,-57
+            2725: 4,-68
+            2726: 8,-68
+            2727: 8,-73
+            2728: 8,-75
+            2729: 9,-73
+            2730: 11,-74
+            2731: 11,-73
+            2732: 4,-74
+            2733: 3,-73
+            2734: 1,-74
+            2735: 0,-74
+            2736: -1,-73
+            2737: -3,-75
+            2738: -4,-74
+            2739: -4,-75
+            2740: -5,-74
+            2741: -6,-73
+            2742: -5,-69
+            2743: -4,-68
+            2744: -10,-70
+            2745: -11,-69
+            2746: -13,-70
+            2747: -15,-70
+            2748: -17,-69
+            2749: -10,-75
+            2750: -11,-76
+            2751: -13,-77
+            2752: 0,-70
+            2753: 1,-69
+            2754: 7,-68
+            2765: 7,-70
+            2766: 0,-69
+            2767: -1,-69
+            2768: -2,-70
+            2769: -7,-69
+            2770: -6,-68
+            2771: -5,-68
+            2772: -4,-69
+            2773: -4,-70
+            2925: 2,-67
+            2926: 3,-67
+            2927: 2,-66
+            2928: 5,-67
+            2929: 5,-67
+            2930: 4,-67
+            2931: 9,-70
+            2932: 9,-71
+            2933: 8,-71
+            2934: -4,-71
+            2935: -6,-71
+            2936: -8,-70
+            2937: -8,-69
+            2938: -7,-70
+            2939: -10,-71
+            2940: -12,-71
+            3267: -40,-30
+            3268: -41,-31
+            3269: -38,-30
+            3270: -38,-31
+            3271: -36,-31
+            3272: -38,-28
+            3273: -41,-27
+            3274: -38,-25
+            3275: -36,-26
+            3276: -39,-24
+            3277: -37,-22
+            3278: -35,-21
+            3279: -33,-21
+            3280: -33,-21
+            3281: -31,-22
+            3282: -29,-23
+            3328: -26,-35
+            3329: -26,-35
+            3330: -25,-35
+            3331: -27,-35
+            3332: -26,-33
+            3333: -27,-33
+            3334: -27,-31
+            3335: -28,-31
+            3336: -28,-32
+            3337: -29,-32
+            3338: -31,-31
+            3339: -30,-31
+            3340: -35,-31
+            3341: -26,-29
+            3342: -25,-30
+            3343: -25,-28
+            3344: -26,-28
+            3345: -28,-28
+            3346: -28,-27
+            3347: -28,-26
+            3348: -26,-25
+            3349: -25,-27
+            3350: -25,-27
+            3351: -23,-27
+            3352: -22,-27
+            3353: -21,-25
+            3492: 8,-58
+            3493: 7,-57
+            3494: 8,-54
+            3495: 7,-54
+            3496: 4,-54
+            3497: 5,-53
+            3498: 3,-53
+            3499: 3,-64
+            3500: 2,-63
+            3501: 5,-61
+            3502: 6,-61
+            3503: 4,-60
+            3504: 8,-64
+            3505: 6,-57
+            3506: 5,-57
+            3507: 5,-57
+            3508: 3,-57
+            3509: 4,-58
+            3510: 4,-56
+            3610: 53,-55
+            3618: 62,-56
+            3619: 58,-55
+            3620: 57,-56
+            3621: 59,-56
+            3622: 60,-56
+            3623: 54,-55
         - node:
             cleanable: True
             zIndex: 1
@@ -2621,62 +2668,65 @@ entities:
             color: '#FFFFFFFF'
             id: DirtMedium
           decals:
-            1450: -8,50
-            2550: 0,-58
-            2551: -1,-58
-            2552: -1,-56
-            2782: -5,-70
-            2783: -6,-69
-            2784: -7,-68
-            2785: -1,-70
-            2786: 6,-70
-            2787: 6,-68
-            2788: 7,-69
-            3312: -37,-29
-            3313: -36,-28
-            3314: -36,-30
-            3315: -36,-27
-            3316: -37,-26
-            3317: -36,-25
-            3318: -36,-24
-            3319: -37,-24
-            3320: -36,-23
-            3321: -39,-22
-            3322: -41,-24
-            3323: -40,-24
-            3324: -41,-25
-            3325: -41,-26
-            3326: -32,-20
-            3327: -32,-19
-            3328: -34,-20
-            3329: -33,-20
-            3330: -28,-21
-            3331: -27,-23
-            3332: -26,-24
-            3333: -26,-26
-            3334: -27,-26
-            3335: -27,-27
-            3336: -27,-28
-            3337: -29,-37
-            3338: -29,-38
-            3339: -28,-38
-            3340: -26,-38
-            3341: -25,-36
-            3347: -28,-33
-            3348: -26,-36
-            3349: -27,-36
-            3350: -27,-33
-            3351: -28,-32
+            1428: -8,50
+            2526: 0,-58
+            2527: -1,-58
+            2528: -1,-56
+            2758: -5,-70
+            2759: -6,-69
+            2760: -7,-68
+            2761: -1,-70
+            2762: 6,-70
+            2763: 6,-68
+            2764: 7,-69
+            3288: -37,-29
+            3289: -36,-28
+            3290: -36,-30
+            3291: -36,-27
+            3292: -37,-26
+            3293: -36,-25
+            3294: -36,-24
+            3295: -37,-24
+            3296: -36,-23
+            3297: -39,-22
+            3298: -41,-24
+            3299: -40,-24
+            3300: -41,-25
+            3301: -41,-26
+            3302: -32,-20
+            3303: -32,-19
+            3304: -34,-20
+            3305: -33,-20
+            3306: -28,-21
+            3307: -27,-23
+            3308: -26,-24
+            3309: -26,-26
+            3310: -27,-26
+            3311: -27,-27
+            3312: -27,-28
+            3313: -29,-37
+            3314: -29,-38
+            3315: -28,-38
+            3316: -26,-38
+            3317: -25,-36
+            3323: -28,-33
+            3324: -26,-36
+            3325: -27,-36
+            3326: -27,-33
+            3327: -28,-32
+            3613: 55,-53
+            3614: 64,-56
+            3615: 62,-55
         - node:
             color: '#FFFFFFFF'
             id: Flowersbr3
           decals:
-            1364: 7.3655357,-24.02947
+            1342: 7.3655357,-24.02947
         - node:
             color: '#FFFFFFFF'
             id: Flowerspv2
           decals:
-            1163: 43.154446,-52.983627
+            1141: 43.154446,-52.983627
         - node:
             color: '#FFFFFFFF'
             id: Flowersy1
@@ -2686,44 +2736,44 @@ entities:
             color: '#FFFFFFFF'
             id: Flowersy3
           decals:
-            1162: 43.85757,-52.030502
+            1140: 43.85757,-52.030502
         - node:
             color: '#FFFFFFFF'
             id: Flowersy4
           decals:
             502: -15.026416,-24.599382
-            1161: 46.216946,-53.983627
-            1363: 6.2405357,-24.09197
+            1139: 46.216946,-53.983627
+            1341: 6.2405357,-24.09197
         - node:
             color: '#334E6D5A'
             id: FullTileOverlayGreyscale
           decals:
-            2250: -1,-5
+            2226: -1,-5
         - node:
             color: '#52B4E931'
             id: FullTileOverlayGreyscale
           decals:
-            2259: 2,-5
+            2235: 2,-5
         - node:
             color: '#52B4E937'
             id: FullTileOverlayGreyscale
           decals:
-            3028: 42,-29
-            3029: 42,-28
-            3030: 43,-29
-            3031: 43,-28
-            3032: 44,-29
-            3033: 44,-28
-            3034: 45,-29
-            3035: 45,-28
-            3036: 46,-29
-            3037: 46,-28
-            3038: 45,-27
-            3039: 45,-26
-            3040: 45,-25
-            3041: 45,-24
-            3042: 44,-24
-            3043: 46,-24
+            3004: 42,-29
+            3005: 42,-28
+            3006: 43,-29
+            3007: 43,-28
+            3008: 44,-29
+            3009: 44,-28
+            3010: 45,-29
+            3011: 45,-28
+            3012: 46,-29
+            3013: 46,-28
+            3014: 45,-27
+            3015: 45,-26
+            3016: 45,-25
+            3017: 45,-24
+            3018: 44,-24
+            3019: 46,-24
         - node:
             color: '#52B4E996'
             id: FullTileOverlayGreyscale
@@ -2743,103 +2793,103 @@ entities:
             901: 27,-16
             902: 26,-16
             903: 25,-16
-            2094: -10,25
+            2070: -10,25
         - node:
             color: '#9FED5896'
             id: FullTileOverlayGreyscale
           decals:
-            2093: -6,25
+            2069: -6,25
         - node:
             color: '#A4610696'
             id: FullTileOverlayGreyscale
           decals:
             433: -30,-31
-            1169: -21,-31
-            1170: -22,-31
+            1147: -21,-31
+            1148: -22,-31
         - node:
             color: '#D381C934'
             id: FullTileOverlayGreyscale
           decals:
-            2262: 6,-7
+            2238: 6,-7
         - node:
             color: '#D381C996'
             id: FullTileOverlayGreyscale
           decals:
-            1699: 65,-22
-            1700: 66,-22
-            1701: 67,-22
-            1749: 61,-41
-            1750: 59,-41
-            1751: 57,-41
-            1752: 55,-41
-            1753: 53,-41
-            3195: 5,-33
+            1677: 65,-22
+            1678: 66,-22
+            1679: 67,-22
+            1725: 61,-41
+            1726: 59,-41
+            1727: 57,-41
+            1728: 55,-41
+            1729: 53,-41
+            3171: 5,-33
         - node:
             color: '#DE3A3A2B'
             id: FullTileOverlayGreyscale
           decals:
-            2240: -8,-7
+            2216: -8,-7
         - node:
             color: '#DE3A3A96'
             id: FullTileOverlayGreyscale
           decals:
             1001: 77,-5
-            1121: 58,-16
-            1377: -8,37
-            1378: -7,37
-            1379: -5,37
+            1099: 58,-16
+            1355: -8,37
+            1356: -7,37
+            1357: -5,37
         - node:
             color: '#EFB34131'
             id: FullTileOverlayGreyscale
           decals:
-            2241: -4,-5
+            2217: -4,-5
         - node:
             color: '#EFB34196'
             id: FullTileOverlayGreyscale
           decals:
-            2092: -2,25
-            2917: 1,-72
-            2918: 0,-72
-            2919: -1,-72
-            2920: -2,-72
-            2921: -3,-72
+            2068: -2,25
+            2893: 1,-72
+            2894: 0,-72
+            2895: -1,-72
+            2896: -2,-72
+            2897: -3,-72
         - node:
             color: '#EFCF412B'
             id: FullTileOverlayGreyscale
           decals:
-            2538: 2,-57
+            2514: 2,-57
         - node:
             color: '#FFFFFFFF'
             id: Grassa1
           decals:
-            1361: 7.2717857,-23.90447
-            1362: 6.2249107,-24.045095
-            1467: -3,48
+            1339: 7.2717857,-23.90447
+            1340: 6.2249107,-24.045095
+            1445: -3,48
         - node:
             color: '#FFFFFFFF'
             id: Grassa2
           decals:
-            1462: 2,47
-            1463: 4,48
-            1474: -1,47
+            1440: 2,47
+            1441: 4,48
+            1452: -1,47
         - node:
             color: '#FFFFFFFF'
             id: Grassa3
           decals:
-            1468: 2,48
+            1446: 2,48
         - node:
             color: '#FFFFFFFF'
             id: Grassa5
           decals:
-            1464: 4,47
-            1465: -1,48
-            1466: -3,47
+            1442: 4,47
+            1443: -1,48
+            1444: -3,47
         - node:
             color: '#FFFFFFFF'
             id: Grassb1
           decals:
             494: -14.995166,-26.943132
-            1167: 47.091946,-51.921127
+            1145: 47.091946,-51.921127
         - node:
             color: '#FFFFFFFF'
             id: Grassb2
@@ -2849,58 +2899,58 @@ entities:
             color: '#FFFFFFFF'
             id: Grassb5
           decals:
-            1168: 42.85757,-51.827377
+            1146: 42.85757,-51.827377
         - node:
             color: '#FFFFFFFF'
             id: Grassd1
           decals:
-            1160: 46.57632,-52.483627
-            3385: 42,0
+            1138: 46.57632,-52.483627
+            3361: 42,0
         - node:
             color: '#FFFFFFFF'
             id: Grassd2
           decals:
-            1159: 44.04507,-52.733627
-            3384: 44,0
+            1137: 44.04507,-52.733627
+            3360: 44,0
         - node:
             color: '#FFFFFFFF'
             id: Grassd3
           decals:
             491: -14.979541,-25.083757
-            1460: 2,48
-            3386: 43,0
+            1438: 2,48
+            3362: 43,0
         - node:
             color: '#FFFFFFFF'
             id: Grasse1
           decals:
             490: -14.995166,-24.161882
-            1157: 46.42007,-53.327377
-            1158: 43.29507,-52.358627
-            1459: 2,47
-            1461: -3,48
-            3382: 43,-1
+            1135: 46.42007,-53.327377
+            1136: 43.29507,-52.358627
+            1437: 2,47
+            1439: -3,48
+            3358: 43,-1
         - node:
             color: '#FFFFFFFF'
             id: Grasse2
           decals:
             489: -15.010791,-27.036882
-            1356: 6,-24
-            1357: 7,-24
-            1358: 8,-24
-            1456: 4,47
-            1457: -1,48
-            1473: -1,47
-            3383: 42,-1
+            1334: 6,-24
+            1335: 7,-24
+            1336: 8,-24
+            1434: 4,47
+            1435: -1,48
+            1451: -1,47
+            3359: 42,-1
         - node:
             color: '#FFFFFFFF'
             id: Grasse3
           decals:
             492: -14.995166,-25.786882
-            1359: 8,-24
-            1360: 6.3967857,-23.96697
-            1455: 4,48
-            1458: -3,47
-            3381: 44,-1
+            1337: 8,-24
+            1338: 6.3967857,-23.96697
+            1433: 4,48
+            1436: -3,47
+            3357: 44,-1
         - node:
             color: '#52B4E996'
             id: HalfTileOverlayGreyscale
@@ -2925,19 +2975,19 @@ entities:
             797: 29,-24
             798: 27,-24
             813: 23,-25
-            1559: 49,-27
-            1586: 40,-23
-            2089: -4,28
-            2452: 34,-35
-            3008: 22,-35
-            3009: 21,-35
-            3010: 18,-35
-            3011: 19,-35
+            1537: 49,-27
+            1564: 40,-23
+            2065: -4,28
+            2428: 34,-35
+            2984: 22,-35
+            2985: 21,-35
+            2986: 18,-35
+            2987: 19,-35
         - node:
             color: '#9D9D97FF'
             id: HalfTileOverlayGreyscale
           decals:
-            1127: 62,-27
+            1105: 62,-27
         - node:
             color: '#9FED5896'
             id: HalfTileOverlayGreyscale
@@ -2950,43 +3000,43 @@ entities:
             754: 39,-56
             976: 35,-52
             977: 36,-52
-            2090: -3,28
+            2066: -3,28
         - node:
             color: '#A4610696'
             id: HalfTileOverlayGreyscale
           decals:
             198: -32,-11
-            1128: -24,-16
-            1129: -23,-16
-            1130: -22,-16
-            1131: -21,-16
-            2342: 5,28
-            2343: 28,-24
-            2344: 69,-18
-            3210: -32,-29
-            3211: -33,-29
+            1106: -24,-16
+            1107: -23,-16
+            1108: -22,-16
+            1109: -21,-16
+            2318: 5,28
+            2319: 28,-24
+            2320: 69,-18
+            3186: -32,-29
+            3187: -33,-29
         - node:
             color: '#D381C996'
             id: HalfTileOverlayGreyscale
           decals:
             877: 70,-18
             878: 71,-18
-            1723: 63,-40
-            1724: 62,-40
-            1725: 61,-40
-            1726: 60,-40
-            1727: 59,-40
-            1728: 58,-40
-            1729: 57,-40
-            1730: 56,-40
-            1731: 55,-40
-            1732: 53,-40
-            1733: 52,-40
-            1734: 51,-40
-            3181: 6,-34
-            3182: 5,-34
-            3183: 4,-34
-            3184: 3,-34
+            1701: 63,-40
+            1702: 62,-40
+            1703: 61,-40
+            1704: 60,-40
+            1705: 59,-40
+            1706: 58,-40
+            1707: 57,-40
+            1708: 56,-40
+            1709: 55,-40
+            1710: 53,-40
+            1711: 52,-40
+            1712: 51,-40
+            3157: 6,-34
+            3158: 5,-34
+            3159: 4,-34
+            3160: 3,-34
         - node:
             color: '#DE3A3A96'
             id: HalfTileOverlayGreyscale
@@ -3018,30 +3068,30 @@ entities:
             991: 79,-2
             992: 80,-2
             993: 81,-2
-            1120: 58,-17
-            1124: 60,-18
-            1125: 61,-18
-            1126: 62,-18
-            2120: 14,32
-            3589: -5,36
-            3590: -7,36
-            3591: -8,36
-            3592: -9,36
-            3593: -10,36
+            1098: 58,-17
+            1102: 60,-18
+            1103: 61,-18
+            1104: 62,-18
+            2096: 14,32
+            3565: -5,36
+            3566: -7,36
+            3567: -8,36
+            3568: -9,36
+            3569: -10,36
         - node:
             color: '#EFB34196'
             id: HalfTileOverlayGreyscale
           decals:
-            2091: -2,28
-            2610: 5,-42
-            2611: 5,-44
-            2612: 5,-43
+            2067: -2,28
+            2586: 5,-42
+            2587: 5,-44
+            2588: 5,-43
         - node:
             color: '#F5DB9E96'
             id: HalfTileOverlayGreyscale
           decals:
-            1657: 20,-25
-            1658: 22,-25
+            1635: 20,-25
+            1636: 22,-25
         - node:
             color: '#52B4E996'
             id: HalfTileOverlayGreyscale180
@@ -3072,18 +3122,18 @@ entities:
             789: 29,-19
             790: 28,-19
             791: 27,-19
-            1560: 49,-29
-            1578: 37,-25
-            1579: 38,-25
-            1580: 41,-25
-            2436: 29,-37
-            2437: 30,-37
-            2438: 31,-37
-            2439: 32,-37
-            2440: 33,-37
-            2441: 34,-37
-            2442: 35,-37
-            2443: 36,-37
+            1538: 49,-29
+            1556: 37,-25
+            1557: 38,-25
+            1558: 41,-25
+            2412: 29,-37
+            2413: 30,-37
+            2414: 31,-37
+            2415: 32,-37
+            2416: 33,-37
+            2417: 34,-37
+            2418: 35,-37
+            2419: 36,-37
         - node:
             color: '#9D9D97FF'
             id: HalfTileOverlayGreyscale180
@@ -3095,10 +3145,10 @@ entities:
             color: '#9FED5828'
             id: HalfTileOverlayGreyscale180
           decals:
-            1469: 3,47
-            1470: 1,47
-            1471: 0,47
-            1472: -2,47
+            1447: 3,47
+            1448: 1,47
+            1449: 0,47
+            1450: -2,47
         - node:
             color: '#9FED5896'
             id: HalfTileOverlayGreyscale180
@@ -3109,8 +3159,8 @@ entities:
             color: '#A4610696'
             id: HalfTileOverlayGreyscale180
           decals:
-            3212: -33,-32
-            3213: -32,-32
+            3188: -33,-32
+            3189: -32,-32
         - node:
             color: '#D381C996'
             id: HalfTileOverlayGreyscale180
@@ -3123,24 +3173,26 @@ entities:
             889: 64,-16
             890: 63,-16
             891: 62,-16
-            1691: 51,-15
-            1692: 55,-15
-            1735: 51,-42
-            1736: 52,-42
-            1737: 53,-42
-            1738: 54,-42
-            1739: 55,-42
-            1740: 57,-42
-            1741: 59,-42
-            1742: 60,-42
-            1743: 62,-42
-            1744: 63,-42
-            1745: 61,-42
-            3173: 5,-32
-            3187: 3,-37
-            3188: 4,-37
-            3189: 6,-37
-            3190: 5,-37
+            1669: 51,-15
+            1670: 55,-15
+            1713: 51,-42
+            1714: 52,-42
+            1715: 53,-42
+            1716: 54,-42
+            1717: 55,-42
+            1718: 57,-42
+            1719: 59,-42
+            1720: 60,-42
+            1721: 62,-42
+            1722: 63,-42
+            1723: 61,-42
+            3149: 5,-32
+            3163: 3,-37
+            3164: 4,-37
+            3165: 6,-37
+            3166: 5,-37
+            3644: 56,-42
+            3645: 58,-42
         - node:
             color: '#DE3A3A96'
             id: HalfTileOverlayGreyscale180
@@ -3168,28 +3220,28 @@ entities:
             998: 79,-4
             999: 80,-4
             1000: 81,-4
-            2118: 14,34
-            2123: 14,31
-            3596: -10,34
+            2094: 14,34
+            2099: 14,31
+            3572: -10,34
         - node:
             color: '#EFB34196'
             id: HalfTileOverlayGreyscale180
           decals:
             347: -2,23
-            2724: -2,-68
-            2725: -2,-69
-            2736: 2,-68
-            2737: 2,-70
+            2700: -2,-68
+            2701: -2,-69
+            2712: 2,-68
+            2713: 2,-70
         - node:
             color: '#334E6D5A'
             id: HalfTileOverlayGreyscale270
           decals:
-            2248: -2,-6
+            2224: -2,-6
         - node:
             color: '#52B4E931'
             id: HalfTileOverlayGreyscale270
           decals:
-            2261: 1,-6
+            2237: 1,-6
         - node:
             color: '#52B4E996'
             id: HalfTileOverlayGreyscale270
@@ -3216,17 +3268,17 @@ entities:
             784: 34,-20
             793: 34,-23
             812: 18,-26
-            1110: 56,-24
-            1562: 48,-28
-            2432: 28,-33
-            2433: 28,-35
-            2434: 28,-36
-            2449: 35,-32
-            2450: 35,-33
-            2451: 35,-34
-            3100: 39,-49
-            3101: 39,-47
-            3102: 39,-46
+            1088: 56,-24
+            1540: 48,-28
+            2408: 28,-33
+            2409: 28,-35
+            2410: 28,-36
+            2425: 35,-32
+            2426: 35,-33
+            2427: 35,-34
+            3076: 39,-49
+            3077: 39,-47
+            3078: 39,-46
         - node:
             color: '#9FED5896'
             id: HalfTileOverlayGreyscale270
@@ -3256,7 +3308,7 @@ entities:
             443: -42,-25
             444: -42,-26
             445: -42,-27
-            3204: -34,-30
+            3180: -34,-30
         - node:
             color: '#D381C996'
             id: HalfTileOverlayGreyscale270
@@ -3264,9 +3316,9 @@ entities:
             263: 65,-18
             264: 65,-19
             265: 65,-20
-            1755: 63,-41
-            3185: 2,-35
-            3186: 2,-36
+            1731: 63,-41
+            3161: 2,-35
+            3162: 2,-36
         - node:
             color: '#DE3A3A96'
             id: HalfTileOverlayGreyscale270
@@ -3276,19 +3328,19 @@ entities:
             46: 11,34
             402: -62,4
             995: 76,-3
-            1113: 57,-20
-            1114: 57,-19
-            1115: 57,-18
-            1421: -12,38
-            1422: -12,39
-            1423: -12,40
-            1424: -12,41
-            3597: -11,35
+            1091: 57,-20
+            1092: 57,-19
+            1093: 57,-18
+            1399: -12,38
+            1400: -12,39
+            1401: -12,40
+            1402: -12,41
+            3573: -11,35
         - node:
             color: '#EFB34131'
             id: HalfTileOverlayGreyscale270
           decals:
-            2247: -5,-6
+            2223: -5,-6
         - node:
             color: '#EFB34196'
             id: HalfTileOverlayGreyscale270
@@ -3299,7 +3351,7 @@ entities:
             color: '#334E6D5A'
             id: HalfTileOverlayGreyscale90
           decals:
-            2249: 0,-6
+            2225: 0,-6
         - node:
             color: '#334E6DC8'
             id: HalfTileOverlayGreyscale90
@@ -3313,7 +3365,7 @@ entities:
             color: '#52B4E931'
             id: HalfTileOverlayGreyscale90
           decals:
-            2260: 3,-6
+            2236: 3,-6
         - node:
             color: '#52B4E996'
             id: HalfTileOverlayGreyscale90
@@ -3337,9 +3389,9 @@ entities:
             781: 26,-21
             782: 26,-20
             792: 26,-23
-            1561: 50,-28
-            2447: 37,-36
-            2448: 36,-34
+            1539: 50,-28
+            2423: 37,-36
+            2424: 36,-34
         - node:
             color: '#9FED5896'
             id: HalfTileOverlayGreyscale90
@@ -3356,19 +3408,19 @@ entities:
             202: -30,-14
             203: -30,-13
             204: -30,-12
-            1133: -20,-17
-            1134: -20,-18
-            1135: -20,-19
-            1136: -20,-20
-            3205: -31,-30
-            3232: -36,-32
-            3233: -36,-30
-            3234: -36,-29
-            3235: -36,-28
-            3236: -36,-27
-            3237: -36,-26
-            3238: -36,-25
-            3239: -36,-24
+            1111: -20,-17
+            1112: -20,-18
+            1113: -20,-19
+            1114: -20,-20
+            3181: -31,-30
+            3208: -36,-32
+            3209: -36,-30
+            3210: -36,-29
+            3211: -36,-28
+            3212: -36,-27
+            3213: -36,-26
+            3214: -36,-25
+            3215: -36,-24
         - node:
             color: '#D381C996'
             id: HalfTileOverlayGreyscale90
@@ -3379,9 +3431,9 @@ entities:
             267: 63,-20
             268: 63,-21
             269: 63,-22
-            1754: 51,-41
-            3179: 7,-36
-            3180: 7,-35
+            1730: 51,-41
+            3155: 7,-36
+            3156: 7,-35
         - node:
             color: '#DE3A3A96'
             id: HalfTileOverlayGreyscale90
@@ -3395,35 +3447,35 @@ entities:
             186: -20,-31
             401: -57,4
             994: 82,-3
-            1116: 63,-19
-            1425: -10,38
-            1426: -10,39
-            1427: -10,40
-            1428: -10,41
-            2119: 13,33
+            1094: 63,-19
+            1403: -10,38
+            1404: -10,39
+            1405: -10,40
+            1406: -10,41
+            2095: 13,33
         - node:
             color: '#EFB34131'
             id: HalfTileOverlayGreyscale90
           decals:
-            2246: -3,-6
+            2222: -3,-6
         - node:
             color: '#EFB34196'
             id: HalfTileOverlayGreyscale90
           decals:
             1068: 0,-27
-            2608: 4,-43
-            2609: 4,-42
-            2721: -3,-70
-            2722: -3,-69
-            2726: -1,-69
-            2727: -1,-70
-            2728: 0,-70
-            2729: 0,-69
-            2733: 1,-70
-            2734: 1,-69
-            2738: 3,-70
-            2739: 3,-69
-            2748: 5,-69
+            2584: 4,-43
+            2585: 4,-42
+            2697: -3,-70
+            2698: -3,-69
+            2702: -1,-69
+            2703: -1,-70
+            2704: 0,-70
+            2705: 0,-69
+            2709: 1,-70
+            2710: 1,-69
+            2714: 3,-70
+            2715: 3,-69
+            2724: 5,-69
         - node:
             angle: -1.5707963267948966 rad
             color: '#FFFFFFFF'
@@ -3432,6 +3484,11 @@ entities:
             434: -37,-32
             488: -15,-23
             984: 1,-43
+        - node:
+            color: '#FFFFFFFF'
+            id: LoadingArea
+          decals:
+            3655: 57,-52
         - node:
             angle: 1.5707963267948966 rad
             color: '#FFFFFFFF'
@@ -3449,7 +3506,7 @@ entities:
             color: '#334E6DC8'
             id: MiniTileWhiteLineW
           decals:
-            2147: -11,-15
+            2123: -11,-15
         - node:
             color: '#334E6DC8'
             id: QuarterTileOverlayGreyscale
@@ -3457,15 +3514,15 @@ entities:
             536: 11,-8
             537: 12,-8
             538: 13,-8
-            2041: 27,-90
-            2042: 27,-91
-            2047: 31,-91
+            2017: 27,-90
+            2018: 27,-91
+            2023: 31,-91
         - node:
             color: '#5299B43A'
             id: QuarterTileOverlayGreyscale
           decals:
-            3067: 36,-43
-            3068: 37,-42
+            3043: 36,-43
+            3044: 37,-42
         - node:
             color: '#52B4E996'
             id: QuarterTileOverlayGreyscale
@@ -3475,46 +3532,46 @@ entities:
             149: 35,-28
             158: 29,-29
             811: 18,-27
-            1111: 56,-25
-            1588: 37,-23
-            1854: -77,10
-            1855: -76,10
-            1856: -75,10
-            1857: -74,10
-            1858: -72,10
-            1859: -73,10
-            1860: -71,10
-            1861: -70,10
-            1862: -69,10
-            1863: -68,10
-            1864: -66,10
-            1865: -65,10
-            1878: -77,-14
-            1879: -76,-14
-            1880: -75,-14
-            1881: -74,-14
-            1882: -73,-14
-            1883: -72,-14
-            1884: -71,-14
-            1885: -70,-14
-            1886: -69,-14
-            1887: -68,-14
-            1888: -67,-14
-            1889: -66,-14
-            2308: -78,10
-            2309: -79,10
-            2453: 35,-35
+            1089: 56,-25
+            1566: 37,-23
+            1830: -77,10
+            1831: -76,10
+            1832: -75,10
+            1833: -74,10
+            1834: -72,10
+            1835: -73,10
+            1836: -71,10
+            1837: -70,10
+            1838: -69,10
+            1839: -68,10
+            1840: -66,10
+            1841: -65,10
+            1854: -77,-14
+            1855: -76,-14
+            1856: -75,-14
+            1857: -74,-14
+            1858: -73,-14
+            1859: -72,-14
+            1860: -71,-14
+            1861: -70,-14
+            1862: -69,-14
+            1863: -68,-14
+            1864: -67,-14
+            1865: -66,-14
+            2284: -78,10
+            2285: -79,10
+            2429: 35,-35
         - node:
             color: '#79150096'
             id: QuarterTileOverlayGreyscale
           decals:
-            1934: 75,-6
-            1935: 75,-7
-            1936: 75,-8
-            1937: 75,-9
-            1938: 75,-10
-            1939: 75,-11
-            1940: 75,-12
+            1910: 75,-6
+            1911: 75,-7
+            1912: 75,-8
+            1913: 75,-9
+            1914: 75,-10
+            1915: 75,-11
+            1916: 75,-12
         - node:
             color: '#9D9D97FF'
             id: QuarterTileOverlayGreyscale
@@ -3526,157 +3583,157 @@ entities:
           decals:
             187: -31,-11
             426: -29,-23
-            2353: -18,-22
-            2354: -18,-23
+            2329: -18,-22
+            2330: -18,-23
         - node:
             color: '#D381C996'
             id: QuarterTileOverlayGreyscale
           decals:
             879: 72,-18
-            2379: -29,-35
-            2380: -29,-34
-            2381: -29,-33
-            2382: -29,-32
-            2383: -29,-31
-            2384: -29,-30
-            2385: -28,-30
-            2386: -27,-30
-            2402: -29,-36
+            2355: -29,-35
+            2356: -29,-34
+            2357: -29,-33
+            2358: -29,-32
+            2359: -29,-31
+            2360: -29,-30
+            2361: -28,-30
+            2362: -27,-30
+            2378: -29,-36
         - node:
             color: '#D4D4D428'
             id: QuarterTileOverlayGreyscale
           decals:
-            1785: 14,-4
-            1786: 14,-5
-            1787: 14,-6
-            1788: 14,-7
-            1795: -3,1
-            1796: -4,1
-            1797: -4,0
-            1798: -4,-1
-            1799: -5,-1
-            1800: -6,-1
-            1801: -8,-1
-            1802: -9,-1
-            1803: -10,-1
-            1817: -2,10
-            1818: -2,9
-            1819: -2,8
-            1820: -2,7
-            1821: -2,6
-            1822: -2,5
-            1823: -2,4
-            1824: -2,3
-            1956: 18,-13
-            1957: 19,-13
-            1958: 20,-13
-            1959: 21,-13
-            1960: 23,-13
-            1961: 22,-13
-            1962: 24,-13
-            1963: 25,-13
-            1964: 26,-13
-            1965: 27,-13
-            1966: 28,-13
-            1967: 29,-13
-            1968: 30,-13
-            1969: 31,-13
-            1970: 32,-13
-            1971: 73,-13
-            1972: 72,-13
-            1973: 71,-13
-            1974: 70,-13
-            1975: 69,-13
-            1976: 68,-13
-            1977: 67,-13
-            1978: 66,-13
-            1979: 65,-13
-            1980: 64,-13
-            1981: 63,-13
-            1982: 62,-13
-            1983: 61,-13
-            1984: 60,-13
-            1985: 59,-13
-            1986: 58,-13
-            1987: 57,-13
-            1988: 56,-13
-            1989: 55,-13
-            1990: 54,-13
-            1991: -21,-1
-            1992: -22,-1
-            1993: -23,-1
-            1994: -24,-1
-            1995: -25,-1
-            1996: -28,-1
-            1997: -29,-1
-            1998: -27,-1
-            1999: -30,-1
-            2000: -31,-1
-            2007: -40,-1
-            2008: -41,-1
-            2011: -48,-1
-            2012: -49,-1
-            2013: -50,-1
-            2014: -51,-1
-            2015: -52,-1
-            2016: -62,1
-            2017: -61,1
-            2018: -60,1
-            2019: -59,1
-            2020: -58,1
-            2021: -57,1
-            2022: -56,1
-            2023: -55,1
-            2024: -54,1
-            2204: -18,-9
-            2205: -18,-8
-            2206: -18,-7
-            2207: -18,-6
-            2208: -18,-5
-            2209: -18,-4
-            2798: 19,12
-            2799: 19,13
-            2800: 19,14
-            2801: 19,15
-            2802: 20,15
-            2803: 21,15
-            2804: 22,15
-            2805: 23,15
-            2832: 8,17
-            2833: 8,16
-            2834: 8,15
-            2835: 8,14
-            2836: 8,13
-            2837: 8,12
-            2838: 8,10
-            2839: 8,11
-            2840: 8,9
-            2841: 8,8
-            2842: 8,7
-            2843: 8,6
-            2844: 8,5
-            2845: 8,4
-            2846: 8,3
-            3140: -47,-9
-            3141: -47,-8
-            3142: -47,-7
-            3143: -47,-6
-            3144: -46,-6
-            3145: -45,-6
-            3146: -44,-6
-            3147: -43,-6
+            1761: 14,-4
+            1762: 14,-5
+            1763: 14,-6
+            1764: 14,-7
+            1771: -3,1
+            1772: -4,1
+            1773: -4,0
+            1774: -4,-1
+            1775: -5,-1
+            1776: -6,-1
+            1777: -8,-1
+            1778: -9,-1
+            1779: -10,-1
+            1793: -2,10
+            1794: -2,9
+            1795: -2,8
+            1796: -2,7
+            1797: -2,6
+            1798: -2,5
+            1799: -2,4
+            1800: -2,3
+            1932: 18,-13
+            1933: 19,-13
+            1934: 20,-13
+            1935: 21,-13
+            1936: 23,-13
+            1937: 22,-13
+            1938: 24,-13
+            1939: 25,-13
+            1940: 26,-13
+            1941: 27,-13
+            1942: 28,-13
+            1943: 29,-13
+            1944: 30,-13
+            1945: 31,-13
+            1946: 32,-13
+            1947: 73,-13
+            1948: 72,-13
+            1949: 71,-13
+            1950: 70,-13
+            1951: 69,-13
+            1952: 68,-13
+            1953: 67,-13
+            1954: 66,-13
+            1955: 65,-13
+            1956: 64,-13
+            1957: 63,-13
+            1958: 62,-13
+            1959: 61,-13
+            1960: 60,-13
+            1961: 59,-13
+            1962: 58,-13
+            1963: 57,-13
+            1964: 56,-13
+            1965: 55,-13
+            1966: 54,-13
+            1967: -21,-1
+            1968: -22,-1
+            1969: -23,-1
+            1970: -24,-1
+            1971: -25,-1
+            1972: -28,-1
+            1973: -29,-1
+            1974: -27,-1
+            1975: -30,-1
+            1976: -31,-1
+            1983: -40,-1
+            1984: -41,-1
+            1987: -48,-1
+            1988: -49,-1
+            1989: -50,-1
+            1990: -51,-1
+            1991: -52,-1
+            1992: -62,1
+            1993: -61,1
+            1994: -60,1
+            1995: -59,1
+            1996: -58,1
+            1997: -57,1
+            1998: -56,1
+            1999: -55,1
+            2000: -54,1
+            2180: -18,-9
+            2181: -18,-8
+            2182: -18,-7
+            2183: -18,-6
+            2184: -18,-5
+            2185: -18,-4
+            2774: 19,12
+            2775: 19,13
+            2776: 19,14
+            2777: 19,15
+            2778: 20,15
+            2779: 21,15
+            2780: 22,15
+            2781: 23,15
+            2808: 8,17
+            2809: 8,16
+            2810: 8,15
+            2811: 8,14
+            2812: 8,13
+            2813: 8,12
+            2814: 8,10
+            2815: 8,11
+            2816: 8,9
+            2817: 8,8
+            2818: 8,7
+            2819: 8,6
+            2820: 8,5
+            2821: 8,4
+            2822: 8,3
+            3116: -47,-9
+            3117: -47,-8
+            3118: -47,-7
+            3119: -47,-6
+            3120: -46,-6
+            3121: -45,-6
+            3122: -44,-6
+            3123: -43,-6
         - node:
             color: '#D4D4D496'
             id: QuarterTileOverlayGreyscale
           decals:
-            1926: 33,-12
-            1927: 34,-12
-            1928: 35,-12
-            1929: 36,-12
-            1930: 37,-12
-            1931: 38,-12
-            1932: 39,-12
-            1933: 40,-12
+            1902: 33,-12
+            1903: 34,-12
+            1904: 35,-12
+            1905: 36,-12
+            1906: 37,-12
+            1907: 38,-12
+            1908: 39,-12
+            1909: 40,-12
         - node:
             color: '#DE3A3A96'
             id: QuarterTileOverlayGreyscale
@@ -3725,9 +3782,9 @@ entities:
             608: -2,14
             609: -2,13
             610: -2,12
-            1122: 57,-21
-            2122: 15,31
-            2124: 15,33
+            1100: 57,-21
+            2098: 15,31
+            2100: 15,33
         - node:
             color: '#EFB34196'
             id: QuarterTileOverlayGreyscale
@@ -3742,51 +3799,51 @@ entities:
             968: 12,-43
             969: 12,-42
             970: 12,-41
-            2518: -4,-52
-            2519: -4,-53
-            2520: -4,-54
-            2521: -4,-55
-            2522: -4,-56
-            2523: -2,-52
-            2524: -3,-52
-            2614: 6,-44
-            2615: 6,-42
-            2616: 6,-43
-            2690: -18,-69
-            2691: -17,-69
-            2692: -16,-69
-            2693: -15,-69
-            2694: -14,-69
-            2695: -13,-69
-            2696: -12,-69
-            2697: -11,-69
-            2698: -10,-69
-            3455: 1,-64
-            3456: 1,-63
-            3457: 1,-62
-            3458: 1,-61
-            3459: 1,-60
-            3460: 2,-60
-            3461: 3,-60
-            3479: 2,-52
-            3480: 2,-53
-            3481: 2,-54
-            3482: 3,-56
-            3483: 3,-55
+            2494: -4,-52
+            2495: -4,-53
+            2496: -4,-54
+            2497: -4,-55
+            2498: -4,-56
+            2499: -2,-52
+            2500: -3,-52
+            2590: 6,-44
+            2591: 6,-42
+            2592: 6,-43
+            2666: -18,-69
+            2667: -17,-69
+            2668: -16,-69
+            2669: -15,-69
+            2670: -14,-69
+            2671: -13,-69
+            2672: -12,-69
+            2673: -11,-69
+            2674: -10,-69
+            3431: 1,-64
+            3432: 1,-63
+            3433: 1,-62
+            3434: 1,-61
+            3435: 1,-60
+            3436: 2,-60
+            3437: 3,-60
+            3455: 2,-52
+            3456: 2,-53
+            3457: 2,-54
+            3458: 3,-56
+            3459: 3,-55
         - node:
             color: '#F5DB9E96'
             id: QuarterTileOverlayGreyscale
           decals:
-            1647: 24,-17
-            1648: 24,-18
-            1649: 24,-19
-            1650: 24,-20
-            1651: 24,-21
+            1625: 24,-17
+            1626: 24,-18
+            1627: 24,-19
+            1628: 24,-20
+            1629: 24,-21
         - node:
             color: '#FFEBAE96'
             id: QuarterTileOverlayGreyscale
           decals:
-            1625: 18,-20
+            1603: 18,-20
         - node:
             color: '#334E6DC8'
             id: QuarterTileOverlayGreyscale180
@@ -3805,19 +3862,19 @@ entities:
             553: -16,-14
             554: -16,-13
             555: -16,-12
-            2045: 29,-94
-            2046: 29,-93
-            2050: 25,-94
-            2051: 25,-93
-            2076: -9,-10
-            2077: -8,-10
-            2078: -7,-10
-            2079: -6,-10
-            2080: -6,-9
-            2081: -5,-9
-            2082: -4,-9
-            2083: -3,-9
-            2084: -2,-9
+            2021: 29,-94
+            2022: 29,-93
+            2026: 25,-94
+            2027: 25,-93
+            2052: -9,-10
+            2053: -8,-10
+            2054: -7,-10
+            2055: -6,-10
+            2056: -6,-9
+            2057: -5,-9
+            2058: -4,-9
+            2059: -3,-9
+            2060: -2,-9
         - node:
             color: '#474F52FF'
             id: QuarterTileOverlayGreyscale180
@@ -3829,8 +3886,8 @@ entities:
             color: '#5299B43A'
             id: QuarterTileOverlayGreyscale180
           decals:
-            3069: 34,-41
-            3070: 35,-40
+            3045: 34,-41
+            3046: 35,-40
         - node:
             color: '#52B4E996'
             id: QuarterTileOverlayGreyscale180
@@ -3852,9 +3909,9 @@ entities:
             917: 42,-15
             918: 43,-15
             919: 41,-15
-            1577: 36,-25
-            1659: 39,-15
-            2984: 38,-15
+            1555: 36,-25
+            1637: 39,-15
+            2960: 38,-15
         - node:
             color: '#9D9D97FF'
             id: QuarterTileOverlayGreyscale180
@@ -3894,94 +3951,94 @@ entities:
             color: '#9FED5896'
             id: QuarterTileOverlayGreyscale180
           decals:
-            3177: 3,-32
-            3178: 2,-32
+            3153: 3,-32
+            3154: 2,-32
         - node:
             color: '#A4610696'
             id: QuarterTileOverlayGreyscale180
           decals:
             188: -31,-17
             428: -27,-28
-            3240: -36,-23
-            3241: -35,-23
-            3242: -34,-23
-            3243: -32,-23
-            3244: -31,-23
-            3245: -33,-23
+            3216: -36,-23
+            3217: -35,-23
+            3218: -34,-23
+            3219: -32,-23
+            3220: -31,-23
+            3221: -33,-23
         - node:
             color: '#D381C996'
             id: QuarterTileOverlayGreyscale180
           decals:
-            1694: 50,-15
-            1695: 57,-15
-            2396: -24,-34
-            2397: -24,-35
-            2398: -24,-36
-            2399: -24,-37
-            2400: -24,-38
-            2401: -24,-39
-            2403: -25,-39
-            2404: -26,-39
-            2405: -27,-39
-            2406: -28,-39
-            2407: -29,-39
-            3174: 4,-32
+            1672: 50,-15
+            1673: 57,-15
+            2372: -24,-34
+            2373: -24,-35
+            2374: -24,-36
+            2375: -24,-37
+            2376: -24,-38
+            2377: -24,-39
+            2379: -25,-39
+            2380: -26,-39
+            2381: -27,-39
+            2382: -28,-39
+            2383: -29,-39
+            3150: 4,-32
         - node:
             color: '#D4D4D428'
             id: QuarterTileOverlayGreyscale180
           decals:
             1055: 59,-27
-            1772: 1,-3
-            1773: 2,-3
-            1774: 3,-3
-            1775: 4,-3
-            1776: 5,-3
-            1777: 6,-3
-            1778: 7,-3
-            1779: 8,-3
-            1780: 9,-3
-            1781: 10,-3
-            1782: 11,-3
-            1783: 12,-3
-            1784: 13,-3
-            2025: -54,1
-            2026: -54,0
-            2148: 16,-15
-            2149: 16,-16
-            2150: 16,-17
-            2151: 16,-19
-            2152: 16,-20
-            2153: 16,-18
-            2154: 16,-21
-            2155: 16,-22
-            2156: 16,-23
-            2200: 0,-32
-            2201: 1,-32
-            2203: 7,-32
-            2810: 27,8
-            2811: 27,9
+            1748: 1,-3
+            1749: 2,-3
+            1750: 3,-3
+            1751: 4,-3
+            1752: 5,-3
+            1753: 6,-3
+            1754: 7,-3
+            1755: 8,-3
+            1756: 9,-3
+            1757: 10,-3
+            1758: 11,-3
+            1759: 12,-3
+            1760: 13,-3
+            2001: -54,1
+            2002: -54,0
+            2124: 16,-15
+            2125: 16,-16
+            2126: 16,-17
+            2127: 16,-19
+            2128: 16,-20
+            2129: 16,-18
+            2130: 16,-21
+            2131: 16,-22
+            2132: 16,-23
+            2176: 0,-32
+            2177: 1,-32
+            2179: 7,-32
+            2786: 27,8
+            2787: 27,9
         - node:
             color: '#D4D4D496'
             id: QuarterTileOverlayGreyscale180
           decals:
-            1914: -77,-6
-            1915: -76,-6
-            1916: -75,-6
-            1917: -74,-6
-            1918: -73,-6
-            1919: -72,-6
-            1920: -71,-6
-            1921: -70,-6
-            1922: -69,-6
-            1923: -68,-6
-            1924: -67,-6
-            1925: -66,-6
-            1952: 76,-16
-            1953: 77,-16
-            1954: 78,-16
-            1955: 79,-16
-            2304: -78,-6
-            2305: -79,-6
+            1890: -77,-6
+            1891: -76,-6
+            1892: -75,-6
+            1893: -74,-6
+            1894: -73,-6
+            1895: -72,-6
+            1896: -71,-6
+            1897: -70,-6
+            1898: -69,-6
+            1899: -68,-6
+            1900: -67,-6
+            1901: -66,-6
+            1928: 76,-16
+            1929: 77,-16
+            1930: 78,-16
+            1931: 79,-16
+            2280: -78,-6
+            2281: -79,-6
         - node:
             color: '#DE3A3A96'
             id: QuarterTileOverlayGreyscale180
@@ -4013,40 +4070,31 @@ entities:
             931: 0,-38
             932: 0,-39
             933: 0,-40
-            1092: 63,-58
-            1093: 62,-58
-            1094: 61,-58
-            1095: 60,-58
-            1096: 57,-58
-            1097: 59,-58
-            1098: 58,-58
-            1099: 56,-58
-            1100: 55,-58
-            2528: 0,-58
-            2529: 1,-58
-            2699: -10,-71
-            2700: -11,-71
-            2701: -12,-71
-            2702: -13,-71
-            2703: -14,-71
-            2704: -15,-71
-            2705: -16,-71
-            2706: -17,-71
-            2707: -18,-71
-            2723: -3,-68
-            2730: -1,-68
-            2731: 0,-68
-            2735: 1,-68
-            2740: 3,-68
-            2744: 4,-70
-            2745: 4,-68
-            2746: 5,-70
-            2747: 5,-68
-            3462: 9,-64
-            3463: 9,-63
-            3464: 9,-62
-            3465: 9,-61
-            3466: 9,-60
+            2504: 0,-58
+            2505: 1,-58
+            2675: -10,-71
+            2676: -11,-71
+            2677: -12,-71
+            2678: -13,-71
+            2679: -14,-71
+            2680: -15,-71
+            2681: -16,-71
+            2682: -17,-71
+            2683: -18,-71
+            2699: -3,-68
+            2706: -1,-68
+            2707: 0,-68
+            2711: 1,-68
+            2716: 3,-68
+            2720: 4,-70
+            2721: 4,-68
+            2722: 5,-70
+            2723: 5,-68
+            3438: 9,-64
+            3439: 9,-63
+            3440: 9,-62
+            3441: 9,-61
+            3442: 9,-60
         - node:
             color: '#334E6DC8'
             id: QuarterTileOverlayGreyscale270
@@ -4062,25 +4110,25 @@ entities:
             561: 14,-18
             562: 14,-17
             563: 14,-16
-            2043: 27,-94
-            2044: 27,-93
-            2048: 31,-94
-            2049: 31,-93
-            2067: 7,-10
-            2068: 6,-10
-            2069: 5,-10
-            2070: 4,-10
-            2071: 4,-9
-            2072: 3,-9
-            2073: 2,-9
-            2074: 1,-9
-            2075: 0,-9
+            2019: 27,-94
+            2020: 27,-93
+            2024: 31,-94
+            2025: 31,-93
+            2043: 7,-10
+            2044: 6,-10
+            2045: 5,-10
+            2046: 4,-10
+            2047: 4,-9
+            2048: 3,-9
+            2049: 2,-9
+            2050: 1,-9
+            2051: 0,-9
         - node:
             color: '#5299B43A'
             id: QuarterTileOverlayGreyscale270
           decals:
-            3071: 36,-40
-            3072: 37,-41
+            3047: 36,-40
+            3048: 37,-41
         - node:
             color: '#52B4E996'
             id: QuarterTileOverlayGreyscale270
@@ -4100,42 +4148,33 @@ entities:
             925: 23,-15
             926: 22,-15
             927: 18,-15
-            1101: 63,-58
-            1102: 62,-58
-            1103: 61,-58
-            1104: 60,-58
-            1105: 59,-58
-            1106: 58,-58
-            1107: 57,-58
-            1108: 56,-58
-            1109: 55,-58
-            1112: 56,-23
-            1645: 26,-18
-            1866: -77,-6
-            1867: -76,-6
-            1868: -75,-6
-            1869: -74,-6
-            1870: -73,-6
-            1871: -72,-6
-            1872: -71,-6
-            1873: -70,-6
-            1874: -69,-6
-            1875: -68,-6
-            1876: -67,-6
-            1877: -66,-6
-            2302: -78,-6
-            2303: -79,-6
-            3378: 12,-32
-            3379: 11,-32
-            3380: 10,-32
+            1090: 56,-23
+            1623: 26,-18
+            1842: -77,-6
+            1843: -76,-6
+            1844: -75,-6
+            1845: -74,-6
+            1846: -73,-6
+            1847: -72,-6
+            1848: -71,-6
+            1849: -70,-6
+            1850: -69,-6
+            1851: -68,-6
+            1852: -67,-6
+            1853: -66,-6
+            2278: -78,-6
+            2279: -79,-6
+            3354: 12,-32
+            3355: 11,-32
+            3356: 10,-32
         - node:
             color: '#79150096'
             id: QuarterTileOverlayGreyscale270
           decals:
-            1948: 76,-16
-            1949: 77,-16
-            1950: 78,-16
-            1951: 79,-16
+            1924: 76,-16
+            1925: 77,-16
+            1926: 78,-16
+            1927: 79,-16
         - node:
             color: '#9D9D97FF'
             id: QuarterTileOverlayGreyscale270
@@ -4176,8 +4215,8 @@ entities:
             732: 38,-59
             733: 38,-58
             734: 38,-57
-            3176: 7,-32
-            3434: 8,-32
+            3152: 7,-32
+            3410: 8,-32
         - node:
             color: '#A4610696'
             id: QuarterTileOverlayGreyscale270
@@ -4197,106 +4236,106 @@ entities:
             478: -18,-30
             479: -18,-31
             480: -18,-32
-            2350: -18,-15
-            2373: -29,-35
-            2374: -29,-34
-            2375: -29,-33
-            2376: -29,-32
-            2377: -29,-31
-            2378: -29,-30
-            2408: -29,-39
-            2409: -28,-39
-            2410: -27,-39
-            2411: -26,-39
-            2412: -25,-39
-            2413: -24,-39
+            2326: -18,-15
+            2349: -29,-35
+            2350: -29,-34
+            2351: -29,-33
+            2352: -29,-32
+            2353: -29,-31
+            2354: -29,-30
+            2384: -29,-39
+            2385: -28,-39
+            2386: -27,-39
+            2387: -26,-39
+            2388: -25,-39
+            2389: -24,-39
         - node:
             color: '#D381C996'
             id: QuarterTileOverlayGreyscale270
           decals:
-            1568: 50,-28
-            1569: 49,-27
-            1572: 50,-27
-            1693: 56,-15
-            1696: 59,-15
-            3175: 6,-32
+            1546: 50,-28
+            1547: 49,-27
+            1550: 50,-27
+            1671: 56,-15
+            1674: 59,-15
+            3151: 6,-32
         - node:
             color: '#D4D4D428'
             id: QuarterTileOverlayGreyscale270
           decals:
-            1756: -3,-3
-            1757: -4,-3
-            1758: -5,-3
-            1759: -6,-3
-            1760: -8,-3
-            1761: -9,-3
-            1762: -10,-3
-            1763: -12,-3
-            1764: -11,-3
-            1765: -13,-3
-            1766: -15,-3
-            1767: -14,-3
-            1825: 14,-20
-            1826: 14,-21
-            1827: 14,-22
-            1828: 14,-23
-            1829: 14,-28
-            1830: 14,-29
-            2027: -62,-6
-            2028: -61,-6
-            2029: -60,-6
-            2030: -59,-6
-            2031: -58,-6
-            2032: -57,-6
-            2033: -56,-6
-            2034: -55,-6
-            2035: -54,-6
-            2180: 13,-32
-            2181: 14,-32
-            2182: 15,-32
-            2183: 16,-32
-            2184: -17,-32
-            2185: -16,-32
-            2186: -15,-32
-            2187: -14,-32
-            2188: -13,-32
-            2189: -12,-32
-            2190: -11,-32
-            2191: -10,-32
-            2192: -9,-32
-            2193: -8,-32
-            2194: -7,-32
-            2195: -6,-32
-            2196: -5,-32
-            2197: -4,-32
-            2198: -3,-32
-            2199: -2,-32
-            2202: 2,-32
-            2361: 51,-12
-            2362: 51,-11
-            2363: 51,-10
-            2364: 51,-9
-            2368: 46,-12
-            2812: 23,8
-            2813: 22,8
-            2814: 21,8
-            2815: 20,8
-            2816: 20,9
-            2817: 19,9
-            3427: 14,-27
-            3428: 14,-26
-            3429: 14,-25
+            1732: -3,-3
+            1733: -4,-3
+            1734: -5,-3
+            1735: -6,-3
+            1736: -8,-3
+            1737: -9,-3
+            1738: -10,-3
+            1739: -12,-3
+            1740: -11,-3
+            1741: -13,-3
+            1742: -15,-3
+            1743: -14,-3
+            1801: 14,-20
+            1802: 14,-21
+            1803: 14,-22
+            1804: 14,-23
+            1805: 14,-28
+            1806: 14,-29
+            2003: -62,-6
+            2004: -61,-6
+            2005: -60,-6
+            2006: -59,-6
+            2007: -58,-6
+            2008: -57,-6
+            2009: -56,-6
+            2010: -55,-6
+            2011: -54,-6
+            2156: 13,-32
+            2157: 14,-32
+            2158: 15,-32
+            2159: 16,-32
+            2160: -17,-32
+            2161: -16,-32
+            2162: -15,-32
+            2163: -14,-32
+            2164: -13,-32
+            2165: -12,-32
+            2166: -11,-32
+            2167: -10,-32
+            2168: -9,-32
+            2169: -8,-32
+            2170: -7,-32
+            2171: -6,-32
+            2172: -5,-32
+            2173: -4,-32
+            2174: -3,-32
+            2175: -2,-32
+            2178: 2,-32
+            2337: 51,-12
+            2338: 51,-11
+            2339: 51,-10
+            2340: 51,-9
+            2344: 46,-12
+            2788: 23,8
+            2789: 22,8
+            2790: 21,8
+            2791: 20,8
+            2792: 20,9
+            2793: 19,9
+            3403: 14,-27
+            3404: 14,-26
+            3405: 14,-25
         - node:
             color: '#D4D4D496'
             id: QuarterTileOverlayGreyscale270
           decals:
-            1941: 75,-12
-            1942: 75,-11
-            1943: 75,-10
-            1944: 75,-9
-            1945: 75,-8
-            1946: 75,-7
-            1947: 75,-6
+            1917: 75,-12
+            1918: 75,-11
+            1919: 75,-10
+            1920: 75,-9
+            1921: 75,-8
+            1922: 75,-7
+            1923: 75,-6
         - node:
             color: '#DE3A3A96'
             id: QuarterTileOverlayGreyscale270
@@ -4334,7 +4373,7 @@ entities:
             630: 7,35
             631: 8,35
             632: 9,35
-            2121: 15,32
+            2097: 15,32
         - node:
             color: '#EFB34196'
             id: QuarterTileOverlayGreyscale270
@@ -4355,18 +4394,18 @@ entities:
             947: -2,-37
             948: -2,-36
             949: -2,-35
-            2525: -4,-58
-            2526: -3,-58
-            2527: -2,-58
-            2732: 0,-70
-            2741: 4,-69
+            2501: -4,-58
+            2502: -3,-58
+            2503: -2,-58
+            2708: 0,-70
+            2717: 4,-69
         - node:
             color: '#F5DB9E96'
             id: QuarterTileOverlayGreyscale270
           decals:
-            1652: 21,-15
-            1653: 20,-15
-            1654: 19,-15
+            1630: 21,-15
+            1631: 20,-15
+            1632: 19,-15
         - node:
             color: '#334E6DC8'
             id: QuarterTileOverlayGreyscale90
@@ -4380,15 +4419,15 @@ entities:
             814: -9,-30
             815: -8,-30
             816: -7,-30
-            2039: 29,-90
-            2040: 29,-91
-            2052: 25,-91
+            2015: 29,-90
+            2016: 29,-91
+            2028: 25,-91
         - node:
             color: '#5299B43A'
             id: QuarterTileOverlayGreyscale90
           decals:
-            3073: 35,-43
-            3074: 34,-42
+            3049: 35,-43
+            3050: 34,-42
         - node:
             color: '#52B4E996'
             id: QuarterTileOverlayGreyscale90
@@ -4400,12 +4439,12 @@ entities:
             132: 41,-42
             157: 27,-29
             165: 29,-28
-            1171: 16,-28
-            1172: 16,-27
-            1587: 39,-23
-            1589: 36,-23
-            1646: 25,-19
-            2446: 36,-35
+            1149: 16,-28
+            1150: 16,-27
+            1565: 39,-23
+            1567: 36,-23
+            1624: 25,-19
+            2422: 36,-35
         - node:
             color: '#9D9D97FF'
             id: QuarterTileOverlayGreyscale90
@@ -4416,192 +4455,192 @@ entities:
             id: QuarterTileOverlayGreyscale90
           decals:
             197: -33,-11
-            2387: -29,-30
-            2388: -28,-30
-            2389: -27,-30
-            2390: -24,-34
-            2391: -24,-35
-            2392: -24,-36
-            2393: -24,-37
-            2394: -24,-38
-            2395: -24,-39
-            3246: -31,-19
-            3247: -32,-19
-            3248: -33,-19
-            3249: -34,-19
+            2363: -29,-30
+            2364: -28,-30
+            2365: -27,-30
+            2366: -24,-34
+            2367: -24,-35
+            2368: -24,-36
+            2369: -24,-37
+            2370: -24,-38
+            2371: -24,-39
+            3222: -31,-19
+            3223: -32,-19
+            3224: -33,-19
+            3225: -34,-19
         - node:
             color: '#D381C996'
             id: QuarterTileOverlayGreyscale90
           decals:
             270: 63,-23
-            1570: 48,-28
-            1571: 49,-29
-            1573: 48,-29
+            1548: 48,-28
+            1549: 49,-29
+            1551: 48,-29
         - node:
             color: '#D4D4D428'
             id: QuarterTileOverlayGreyscale90
           decals:
-            1768: -16,-4
-            1769: -16,-5
-            1770: -16,-6
-            1771: -16,-7
-            1789: 4,-1
-            1790: 3,-1
-            1791: 2,-1
-            1792: 2,0
-            1793: 2,1
-            1794: 1,1
-            1804: -14,-1
-            1805: -15,-1
-            1806: -16,-1
-            1807: -17,-1
-            1808: -18,-1
-            1809: 0,3
-            1810: 0,4
-            1811: 0,5
-            1812: 0,6
-            1813: 0,7
-            1814: 0,8
-            1815: 0,9
-            1816: 0,10
-            1831: 13,-30
-            1832: 12,-30
-            1833: 11,-30
-            1834: 10,-30
-            1835: 7,-30
-            1836: 6,-30
-            1837: 5,-30
-            1838: 4,-30
-            1839: 3,-30
-            1840: 2,-30
-            1841: 1,-30
-            1842: -6,-30
-            1843: -5,-30
-            1844: -4,-30
-            1845: -11,-30
-            1846: -12,-30
-            1847: -13,-30
-            1848: -14,-30
-            1849: -15,-30
-            2001: -33,-1
-            2002: -34,-1
-            2003: -35,-1
-            2004: -37,-1
-            2005: -36,-1
-            2006: -38,-1
-            2009: -43,-1
-            2010: -44,-1
-            2036: -54,-6
-            2037: -54,-5
-            2038: -54,-4
-            2157: 16,-25
-            2158: 16,-26
-            2159: 16,-29
-            2160: 16,-30
-            2161: 16,-31
-            2162: 16,-32
-            2210: 10,-1
-            2211: 11,-1
-            2212: 12,-1
-            2213: 13,-1
-            2214: 14,-1
-            2215: 15,-1
-            2216: 16,-1
-            2217: 16,-2
-            2218: 16,-3
-            2219: 16,-4
-            2220: 16,-5
-            2221: 16,-6
-            2222: 16,-7
-            2223: 16,-8
-            2224: 16,-9
-            2225: 16,-10
-            2226: 16,-12
-            2227: 16,-13
-            2228: 9,-1
-            2229: 9,0
-            2230: 9,1
-            2231: 9,2
-            2232: 9,3
-            2233: 9,4
-            2234: 9,5
-            2235: 9,6
-            2355: 46,-12
-            2356: 47,-12
-            2357: 48,-12
-            2358: 49,-12
-            2359: 49,-13
-            2360: 50,-13
-            2365: 51,-9
-            2366: 52,-9
-            2367: 53,-9
-            2369: 45,-13
-            2370: 44,-13
-            2371: 43,-13
-            2372: 42,-13
-            2806: 25,15
-            2807: 26,15
-            2808: 27,15
-            2809: 27,14
-            2818: 17,12
-            2819: 16,12
-            2820: 15,12
-            2821: 14,12
-            2822: 13,12
-            2823: 12,12
-            2824: 11,12
-            2825: 10,12
-            2826: 9,12
-            2827: 9,13
-            2828: 9,14
-            2829: 9,15
-            2830: 9,16
-            2831: 9,17
-            3148: -42,-6
-            3149: -41,-6
-            3150: -40,-6
-            3151: -40,-6
-            3152: -39,-6
-            3153: -38,-6
-            3154: -38,-7
-            3155: -38,-8
-            3156: -38,-9
-            3157: -38,-10
-            3158: -38,-11
-            3159: -38,-12
-            3160: -38,-13
-            3161: -38,-14
-            3433: 8,-30
+            1744: -16,-4
+            1745: -16,-5
+            1746: -16,-6
+            1747: -16,-7
+            1765: 4,-1
+            1766: 3,-1
+            1767: 2,-1
+            1768: 2,0
+            1769: 2,1
+            1770: 1,1
+            1780: -14,-1
+            1781: -15,-1
+            1782: -16,-1
+            1783: -17,-1
+            1784: -18,-1
+            1785: 0,3
+            1786: 0,4
+            1787: 0,5
+            1788: 0,6
+            1789: 0,7
+            1790: 0,8
+            1791: 0,9
+            1792: 0,10
+            1807: 13,-30
+            1808: 12,-30
+            1809: 11,-30
+            1810: 10,-30
+            1811: 7,-30
+            1812: 6,-30
+            1813: 5,-30
+            1814: 4,-30
+            1815: 3,-30
+            1816: 2,-30
+            1817: 1,-30
+            1818: -6,-30
+            1819: -5,-30
+            1820: -4,-30
+            1821: -11,-30
+            1822: -12,-30
+            1823: -13,-30
+            1824: -14,-30
+            1825: -15,-30
+            1977: -33,-1
+            1978: -34,-1
+            1979: -35,-1
+            1980: -37,-1
+            1981: -36,-1
+            1982: -38,-1
+            1985: -43,-1
+            1986: -44,-1
+            2012: -54,-6
+            2013: -54,-5
+            2014: -54,-4
+            2133: 16,-25
+            2134: 16,-26
+            2135: 16,-29
+            2136: 16,-30
+            2137: 16,-31
+            2138: 16,-32
+            2186: 10,-1
+            2187: 11,-1
+            2188: 12,-1
+            2189: 13,-1
+            2190: 14,-1
+            2191: 15,-1
+            2192: 16,-1
+            2193: 16,-2
+            2194: 16,-3
+            2195: 16,-4
+            2196: 16,-5
+            2197: 16,-6
+            2198: 16,-7
+            2199: 16,-8
+            2200: 16,-9
+            2201: 16,-10
+            2202: 16,-12
+            2203: 16,-13
+            2204: 9,-1
+            2205: 9,0
+            2206: 9,1
+            2207: 9,2
+            2208: 9,3
+            2209: 9,4
+            2210: 9,5
+            2211: 9,6
+            2331: 46,-12
+            2332: 47,-12
+            2333: 48,-12
+            2334: 49,-12
+            2335: 49,-13
+            2336: 50,-13
+            2341: 51,-9
+            2342: 52,-9
+            2343: 53,-9
+            2345: 45,-13
+            2346: 44,-13
+            2347: 43,-13
+            2348: 42,-13
+            2782: 25,15
+            2783: 26,15
+            2784: 27,15
+            2785: 27,14
+            2794: 17,12
+            2795: 16,12
+            2796: 15,12
+            2797: 14,12
+            2798: 13,12
+            2799: 12,12
+            2800: 11,12
+            2801: 10,12
+            2802: 9,12
+            2803: 9,13
+            2804: 9,14
+            2805: 9,15
+            2806: 9,16
+            2807: 9,17
+            3124: -42,-6
+            3125: -41,-6
+            3126: -40,-6
+            3127: -40,-6
+            3128: -39,-6
+            3129: -38,-6
+            3130: -38,-7
+            3131: -38,-8
+            3132: -38,-9
+            3133: -38,-10
+            3134: -38,-11
+            3135: -38,-12
+            3136: -38,-13
+            3137: -38,-14
+            3409: 8,-30
         - node:
             color: '#D4D4D496'
             id: QuarterTileOverlayGreyscale90
           decals:
-            1890: -66,-14
-            1891: -67,-14
-            1892: -68,-14
-            1893: -69,-14
-            1894: -70,-14
-            1895: -71,-14
-            1896: -72,-14
-            1897: -73,-14
-            1898: -74,-14
-            1899: -75,-14
-            1900: -76,-14
-            1901: -77,-14
-            1902: -77,10
-            1903: -76,10
-            1904: -75,10
-            1905: -74,10
-            1906: -73,10
-            1907: -72,10
-            1908: -71,10
-            1909: -70,10
-            1910: -69,10
-            1911: -68,10
-            1912: -66,10
-            1913: -65,10
-            2306: -78,10
-            2307: -79,10
+            1866: -66,-14
+            1867: -67,-14
+            1868: -68,-14
+            1869: -69,-14
+            1870: -70,-14
+            1871: -71,-14
+            1872: -72,-14
+            1873: -73,-14
+            1874: -74,-14
+            1875: -75,-14
+            1876: -76,-14
+            1877: -77,-14
+            1878: -77,10
+            1879: -76,10
+            1880: -75,10
+            1881: -74,10
+            1882: -73,10
+            1883: -72,10
+            1884: -71,10
+            1885: -70,10
+            1886: -69,10
+            1887: -68,10
+            1888: -66,10
+            1889: -65,10
+            2282: -78,10
+            2283: -79,10
         - node:
             color: '#DE3A3A96'
             id: QuarterTileOverlayGreyscale90
@@ -4635,8 +4674,8 @@ entities:
             615: 0,16
             616: 0,17
             617: 0,18
-            1123: 59,-18
-            2125: 13,31
+            1101: 59,-18
+            2101: 13,31
         - node:
             color: '#EFB34196'
             id: QuarterTileOverlayGreyscale90
@@ -4656,27 +4695,27 @@ entities:
             963: 14,-43
             964: 14,-42
             965: 14,-41
-            2530: 1,-56
-            2531: 0,-56
-            2532: 0,-55
-            2533: 0,-54
-            2534: 0,-53
-            2535: 0,-52
-            2613: 4,-44
-            2742: 4,-69
-            2743: 4,-70
-            3467: 9,-58
-            3468: 9,-57
-            3469: 9,-56
-            3470: 9,-55
-            3471: 9,-54
-            3472: 9,-53
-            3473: 9,-52
-            3474: 8,-52
-            3475: 7,-52
-            3476: 6,-52
-            3477: 5,-52
-            3478: 4,-52
+            2506: 1,-56
+            2507: 0,-56
+            2508: 0,-55
+            2509: 0,-54
+            2510: 0,-53
+            2511: 0,-52
+            2589: 4,-44
+            2718: 4,-69
+            2719: 4,-70
+            3443: 9,-58
+            3444: 9,-57
+            3445: 9,-56
+            3446: 9,-55
+            3447: 9,-54
+            3448: 9,-53
+            3449: 9,-52
+            3450: 8,-52
+            3451: 7,-52
+            3452: 6,-52
+            3453: 5,-52
+            3454: 4,-52
         - node:
             color: '#F9FFFEFF'
             id: Remains
@@ -4721,32 +4760,32 @@ entities:
             color: '#FFFFFFFF'
             id: StandClear
           decals:
-            2418: -32,-38
+            2394: -32,-38
         - node:
             color: '#334E6D5A'
             id: ThreeQuarterTileOverlayGreyscale
           decals:
-            2253: 0,-7
-            2254: -2,-5
+            2229: 0,-7
+            2230: -2,-5
         - node:
             color: '#5299B43A'
             id: ThreeQuarterTileOverlayGreyscale
           decals:
-            3066: 36,-42
+            3042: 36,-42
         - node:
             color: '#52B4E931'
             id: ThreeQuarterTileOverlayGreyscale
           decals:
-            2255: 3,-7
-            2258: 1,-5
+            2231: 3,-7
+            2234: 1,-5
         - node:
             color: '#52B4E996'
             id: ThreeQuarterTileOverlayGreyscale
           decals:
             334: -11,24
             809: 18,-25
-            1563: 48,-27
-            1590: 37,-22
+            1541: 48,-27
+            1568: 37,-22
         - node:
             color: '#9FED5896'
             id: ThreeQuarterTileOverlayGreyscale
@@ -4758,36 +4797,36 @@ entities:
             id: ThreeQuarterTileOverlayGreyscale
           decals:
             430: -30,-36
-            3207: -34,-29
+            3183: -34,-29
         - node:
             color: '#D381C934'
             id: ThreeQuarterTileOverlayGreyscale
           decals:
-            2263: 5,-7
+            2239: 5,-7
         - node:
             color: '#D381C996'
             id: ThreeQuarterTileOverlayGreyscale
           decals:
-            3194: 2,-34
+            3170: 2,-34
         - node:
             color: '#DE3A3A2B'
             id: ThreeQuarterTileOverlayGreyscale
           decals:
-            2238: -9,-7
+            2214: -9,-7
         - node:
             color: '#DE3A3A96'
             id: ThreeQuarterTileOverlayGreyscale
           decals:
             396: -62,5
             985: 76,-2
-            1118: 57,-17
-            3594: -11,36
+            1096: 57,-17
+            3570: -11,36
         - node:
             color: '#EFB34131'
             id: ThreeQuarterTileOverlayGreyscale
           decals:
-            2242: -3,-7
-            2243: -5,-5
+            2218: -3,-7
+            2219: -5,-5
         - node:
             color: '#EFB34196'
             id: ThreeQuarterTileOverlayGreyscale
@@ -4797,17 +4836,17 @@ entities:
             color: '#5299B43A'
             id: ThreeQuarterTileOverlayGreyscale180
           decals:
-            3065: 35,-41
+            3041: 35,-41
         - node:
             color: '#52B4E996'
             id: ThreeQuarterTileOverlayGreyscale180
           decals:
             336: -9,23
             765: 22,-28
-            1564: 50,-29
-            1581: 42,-25
-            1644: 25,-18
-            2444: 37,-37
+            1542: 50,-29
+            1559: 42,-25
+            1622: 25,-18
+            2420: 37,-37
         - node:
             color: '#9FED5896'
             id: ThreeQuarterTileOverlayGreyscale180
@@ -4820,23 +4859,23 @@ entities:
             color: '#A4610696'
             id: ThreeQuarterTileOverlayGreyscale180
           decals:
-            3209: -31,-32
+            3185: -31,-32
         - node:
             color: '#D381C934'
             id: ThreeQuarterTileOverlayGreyscale180
           decals:
-            2264: 7,-8
+            2240: 7,-8
         - node:
             color: '#D381C996'
             id: ThreeQuarterTileOverlayGreyscale180
           decals:
             883: 71,-16
-            3193: 7,-37
+            3169: 7,-37
         - node:
             color: '#DE3A3A2B'
             id: ThreeQuarterTileOverlayGreyscale180
           decals:
-            2237: -7,-8
+            2213: -7,-8
         - node:
             color: '#DE3A3A96'
             id: ThreeQuarterTileOverlayGreyscale180
@@ -4849,20 +4888,20 @@ entities:
           decals:
             343: -1,23
             1065: 0,-28
-            3453: 1,-26
+            3429: 1,-26
         - node:
             color: '#5299B43A'
             id: ThreeQuarterTileOverlayGreyscale270
           decals:
-            3063: 36,-41
+            3039: 36,-41
         - node:
             color: '#52B4E996'
             id: ThreeQuarterTileOverlayGreyscale270
           decals:
             335: -11,23
-            1565: 48,-29
-            2435: 28,-37
-            3099: 39,-50
+            1543: 48,-29
+            2411: 28,-37
+            3075: 39,-50
         - node:
             color: '#9FED5896'
             id: ThreeQuarterTileOverlayGreyscale270
@@ -4874,63 +4913,63 @@ entities:
             id: ThreeQuarterTileOverlayGreyscale270
           decals:
             429: -30,-39
-            3208: -34,-32
+            3184: -34,-32
         - node:
             color: '#D381C934'
             id: ThreeQuarterTileOverlayGreyscale270
           decals:
-            2266: 5,-8
+            2242: 5,-8
         - node:
             color: '#D381C996'
             id: ThreeQuarterTileOverlayGreyscale270
           decals:
             882: 61,-16
-            3192: 2,-37
+            3168: 2,-37
         - node:
             color: '#DE3A3A2B'
             id: ThreeQuarterTileOverlayGreyscale270
           decals:
-            2236: -9,-8
+            2212: -9,-8
         - node:
             color: '#DE3A3A96'
             id: ThreeQuarterTileOverlayGreyscale270
           decals:
             393: -62,3
             988: 76,-4
-            3595: -11,34
+            3571: -11,34
         - node:
             color: '#EFB34196'
             id: ThreeQuarterTileOverlayGreyscale270
           decals:
             344: -3,23
             1066: -2,-28
-            3454: -3,-26
+            3430: -3,-26
         - node:
             color: '#334E6D5A'
             id: ThreeQuarterTileOverlayGreyscale90
           decals:
-            2251: -2,-7
-            2252: 0,-5
+            2227: -2,-7
+            2228: 0,-5
         - node:
             color: '#5299B43A'
             id: ThreeQuarterTileOverlayGreyscale90
           decals:
-            3064: 35,-42
+            3040: 35,-42
         - node:
             color: '#52B4E931'
             id: ThreeQuarterTileOverlayGreyscale90
           decals:
-            2256: 1,-7
-            2257: 3,-5
+            2232: 1,-7
+            2233: 3,-5
         - node:
             color: '#52B4E996'
             id: ThreeQuarterTileOverlayGreyscale90
           decals:
             333: -9,24
-            1566: 50,-27
-            1582: 42,-23
-            1591: 39,-22
-            2445: 37,-35
+            1544: 50,-27
+            1560: 42,-23
+            1569: 39,-22
+            2421: 37,-35
         - node:
             color: '#9FED5896'
             id: ThreeQuarterTileOverlayGreyscale90
@@ -4942,37 +4981,37 @@ entities:
             color: '#A4610696'
             id: ThreeQuarterTileOverlayGreyscale90
           decals:
-            1132: -20,-16
-            3206: -31,-29
+            1110: -20,-16
+            3182: -31,-29
         - node:
             color: '#D381C934'
             id: ThreeQuarterTileOverlayGreyscale90
           decals:
-            2265: 7,-7
+            2241: 7,-7
         - node:
             color: '#D381C996'
             id: ThreeQuarterTileOverlayGreyscale90
           decals:
-            3191: 7,-34
+            3167: 7,-34
         - node:
             color: '#DE3A3A2B'
             id: ThreeQuarterTileOverlayGreyscale90
           decals:
-            2239: -7,-7
+            2215: -7,-7
         - node:
             color: '#DE3A3A96'
             id: ThreeQuarterTileOverlayGreyscale90
           decals:
             395: -57,5
             986: 82,-2
-            1117: 63,-18
-            1119: 59,-17
+            1095: 63,-18
+            1097: 59,-17
         - node:
             color: '#EFB34131'
             id: ThreeQuarterTileOverlayGreyscale90
           decals:
-            2244: -5,-7
-            2245: -3,-5
+            2220: -5,-7
+            2221: -3,-5
         - node:
             color: '#EFB34196'
             id: ThreeQuarterTileOverlayGreyscale90
@@ -4982,7 +5021,7 @@ entities:
             color: '#FFFFFFFF'
             id: VentSmall
           decals:
-            2461: 31,-35
+            2437: 31,-35
         - node:
             color: '#FED83DFF'
             id: WarnBox
@@ -5019,85 +5058,85 @@ entities:
             color: '#FFFFFFFF'
             id: WarnCornerGreyscaleNE
           decals:
-            2988: 42,-18
+            2964: 42,-18
         - node:
             color: '#FFFFFFFF'
             id: WarnCornerGreyscaleSE
           decals:
-            2931: 9,-71
+            2907: 9,-71
         - node:
             color: '#FFFFFFFF'
             id: WarnCornerGreyscaleSW
           decals:
-            2932: -8,-71
+            2908: -8,-71
         - node:
             color: '#FFFFFFFF'
             id: WarnCornerNE
           decals:
-            3556: 23,19
+            3532: 23,19
         - node:
             color: '#FFFFFFFF'
             id: WarnCornerNW
           decals:
-            3557: 25,19
+            3533: 25,19
         - node:
             color: '#FFFFFFFF'
             id: WarnCornerSE
           decals:
-            1630: 19,-19
-            3554: 23,17
+            1608: 19,-19
+            3530: 23,17
         - node:
             color: '#FFFFFFFF'
             id: WarnCornerSW
           decals:
-            1637: 21,-21
-            3558: 25,17
+            1615: 21,-21
+            3534: 25,17
         - node:
             color: '#FFFFFFFF'
             id: WarnCornerSmallGreyscaleNE
           decals:
-            1304: 44,-21
-            1305: 46,-21
-            2990: 42,-21
+            1282: 44,-21
+            1283: 46,-21
+            2966: 42,-21
         - node:
             color: '#FFFFFFFF'
             id: WarnCornerSmallGreyscaleNW
           decals:
-            1302: 46,-21
-            1303: 44,-21
+            1280: 46,-21
+            1281: 44,-21
         - node:
             color: '#FFFFFFFF'
             id: WarnCornerSmallNE
           decals:
             1073: -3,-30
-            1687: 51,-21
-            2338: -73,-4
-            3133: 13,-77
-            3553: -13,-63
+            1665: 51,-21
+            2314: -73,-4
+            3109: 13,-77
+            3529: -13,-63
         - node:
             color: '#FFFFFFFF'
             id: WarnCornerSmallNW
           decals:
             682: 76,-42
             1072: 1,-30
-            1196: 72,-22
-            1686: 55,-21
-            2312: -79,8
-            2315: -79,-6
-            2336: -69,-4
-            2337: -76,-4
-            3132: 17,-77
-            3552: -11,-63
+            1174: 72,-22
+            1664: 55,-21
+            2288: -79,8
+            2291: -79,-6
+            2312: -69,-4
+            2313: -76,-4
+            3108: 17,-77
+            3528: -11,-63
         - node:
             color: '#FFFFFFFF'
             id: WarnCornerSmallSE
           decals:
             422: -41,-10
-            1558: -13,6
-            1685: 51,-17
-            2065: 22,-90
-            2341: -73,8
-            3131: 13,-75
+            1536: -13,6
+            1663: 51,-17
+            2041: 22,-90
+            2317: -73,8
+            3107: 13,-75
         - node:
             color: '#FFFFFFFF'
             id: WarnCornerSmallSW
@@ -5106,29 +5145,29 @@ entities:
             421: -38,-10
             681: 76,-40
             710: 72,-19
-            1557: -11,6
-            1684: 55,-17
-            2066: 34,-90
-            2311: -79,10
-            2314: -79,-4
-            2339: -69,8
-            2340: -76,8
-            3134: 17,-75
+            1535: -11,6
+            1662: 55,-17
+            2042: 34,-90
+            2287: -79,10
+            2290: -79,-4
+            2315: -69,8
+            2316: -76,8
+            3110: 17,-75
         - node:
             color: '#FFFFFFFF'
             id: WarnEndGreyscaleN
           decals:
-            3387: 46,-17
+            3363: 46,-17
         - node:
             color: '#DE3A3A96'
             id: WarnFullGreyscale
           decals:
-            2126: -2,41
-            2127: -1,41
-            2128: 0,41
-            2129: 1,41
-            2130: 2,41
-            2131: 3,41
+            2102: -2,41
+            2103: -1,41
+            2104: 0,41
+            2105: 1,41
+            2106: 2,41
+            2107: 3,41
         - node:
             color: '#FFFFFFFF'
             id: WarnLineE
@@ -5150,212 +5189,210 @@ entities:
             895: 67,-20
             896: 67,-19
             897: 67,-18
-            1631: 19,-18
-            1632: 19,-17
-            1675: 51,-20
-            1676: 51,-19
-            1677: 51,-18
-            1711: 60,-32
-            1712: 60,-31
-            1713: 60,-30
-            2062: 22,-93
-            2063: 22,-92
-            2064: 22,-91
-            2500: 8,-49
-            2501: 8,-48
-            3129: 13,-76
-            3551: -13,-62
-            3555: 23,18
+            1609: 19,-18
+            1610: 19,-17
+            1653: 51,-20
+            1654: 51,-19
+            1655: 51,-18
+            1689: 60,-32
+            1690: 60,-31
+            1691: 60,-30
+            2038: 22,-93
+            2039: 22,-92
+            2040: 22,-91
+            2476: 8,-49
+            2477: 8,-48
+            3105: 13,-76
+            3527: -13,-62
+            3531: 23,18
         - node:
             color: '#334E6DC8'
             id: WarnLineGreyscaleE
           decals:
-            1354: -7,-17
-            1532: -9,8
+            1332: -7,-17
+            1510: -9,8
         - node:
             color: '#52B4E996'
             id: WarnLineGreyscaleE
           decals:
-            3044: 42,-24
+            3020: 42,-24
         - node:
             color: '#FFFFFFFF'
             id: WarnLineGreyscaleE
           decals:
-            1293: 46,-20
-            1294: 46,-19
-            1295: 46,-18
-            1296: 44,-20
-            1297: 44,-19
-            1298: 44,-18
-            1299: 44,-17
-            2689: -10,-75
-            2986: 42,-20
-            2987: 42,-19
+            1271: 46,-20
+            1272: 46,-19
+            1273: 46,-18
+            1274: 44,-20
+            1275: 44,-19
+            1276: 44,-18
+            1277: 44,-17
+            2665: -10,-75
+            2962: 42,-20
+            2963: 42,-19
         - node:
             color: '#334E6DC8'
             id: WarnLineGreyscaleN
           decals:
-            1355: -8,-12
+            1333: -8,-12
         - node:
             color: '#52B4E996'
             id: WarnLineGreyscaleN
           decals:
-            1585: 41,-23
-            2985: 38,-22
+            1563: 41,-23
+            2961: 38,-22
         - node:
             color: '#A4610696'
             id: WarnLineGreyscaleN
           decals:
-            2347: -27,-16
+            2323: -27,-16
         - node:
             color: '#D381C996'
             id: WarnLineGreyscaleN
           decals:
-            1483: 66,-51
-            1748: 54,-40
+            1461: 66,-51
+            1724: 54,-40
         - node:
             color: '#DE3A3A96'
             id: WarnLineGreyscaleN
           decals:
-            1376: -6,36
-            1416: -8,45
-            1417: -14,45
-            1418: -18,45
-            1419: -21,45
-            1420: -24,45
-            2267: -8,27
-            2268: -9,27
-            3572: -12,27
+            1354: -6,36
+            1394: -8,45
+            1395: -14,45
+            1396: -18,45
+            1397: -21,45
+            1398: -24,45
+            2243: -8,27
+            2244: -9,27
+            3548: -12,27
         - node:
             color: '#EFB34196'
             id: WarnLineGreyscaleN
           decals:
-            2922: -7,-68
+            2898: -7,-68
         - node:
             color: '#F5DB9E96'
             id: WarnLineGreyscaleN
           decals:
-            1655: 19,-25
-            1656: 21,-25
+            1633: 19,-25
+            1634: 21,-25
         - node:
             color: '#FFFFFFFF'
             id: WarnLineGreyscaleN
           decals:
-            1300: 43,-21
-            1301: 45,-21
-            2508: -1,-52
-            2509: 0,-35
-            2510: -1,-35
-            2511: -2,-35
-            2536: 0,-52
-            2537: -2,-52
-            2716: 9,-73
-            2717: 8,-73
-            2718: 3,-73
-            2719: 4,-73
-            2847: 8,16
-            2848: 9,16
-            2926: 3,-66
-            2927: 8,-66
-            2989: 41,-18
+            1278: 43,-21
+            1279: 45,-21
+            2484: -1,-52
+            2485: 0,-35
+            2486: -1,-35
+            2487: -2,-35
+            2512: 0,-52
+            2513: -2,-52
+            2692: 9,-73
+            2693: 8,-73
+            2694: 3,-73
+            2695: 4,-73
+            2823: 8,16
+            2824: 9,16
+            2902: 3,-66
+            2903: 8,-66
+            2965: 41,-18
         - node:
             color: '#334E6DC8'
             id: WarnLineGreyscaleS
           decals:
-            1352: -14,-18
-            1353: -8,-20
-            2085: -1,-9
+            1330: -14,-18
+            1331: -8,-20
+            2061: -1,-9
         - node:
             color: '#52B4E996'
             id: WarnLineGreyscaleS
           decals:
-            1583: 40,-25
-            1584: 39,-25
+            1561: 40,-25
+            1562: 39,-25
         - node:
             color: '#A4610696'
             id: WarnLineGreyscaleS
           decals:
-            2346: -27,-18
+            2322: -27,-18
         - node:
             color: '#D381C996'
             id: WarnLineGreyscaleS
           decals:
-            1688: 54,-15
-            1689: 53,-15
-            1690: 52,-15
-            1697: 58,-15
-            1698: 66,-16
-            1746: 58,-42
-            1747: 56,-42
+            1666: 54,-15
+            1667: 53,-15
+            1668: 52,-15
+            1675: 58,-15
+            1676: 66,-16
         - node:
             color: '#DE3A3A96'
             id: WarnLineGreyscaleS
           decals:
-            1375: -11,43
-            1411: -19,43
-            1412: -22,43
-            1413: -24,43
-            1414: -15,43
-            1415: -6,43
-            2116: 6,26
-            2117: 4,26
-            3562: -9,34
-            3563: -8,34
-            3571: -14,26
-            3607: -15,34
+            1353: -11,43
+            1389: -19,43
+            1390: -22,43
+            1391: -24,43
+            1392: -15,43
+            1393: -6,43
+            2092: 6,26
+            2093: 4,26
+            3538: -9,34
+            3539: -8,34
+            3547: -14,26
+            3583: -15,34
         - node:
             color: '#EFB34196'
             id: WarnLineGreyscaleS
           decals:
-            1515: -6,6
-            1516: -4,6
+            1493: -6,6
+            1494: -4,6
         - node:
             color: '#FFFFFFFF'
             id: WarnLineGreyscaleS
           decals:
-            2505: 0,-50
-            2506: -1,-50
-            2507: -2,-50
-            2512: 0,-33
-            2513: -1,-33
-            2514: -2,-33
-            2712: 9,-76
-            2713: 5,-76
-            2714: 4,-76
-            2715: 3,-76
-            2928: 3,-71
-            2929: 4,-71
-            2930: 8,-71
-            2935: -7,-71
-            2936: -6,-71
-            2937: -5,-71
-            3388: 46,-21
-            3389: 45,-21
-            3390: 44,-21
-            3391: 43,-21
-            3392: 42,-21
+            2481: 0,-50
+            2482: -1,-50
+            2483: -2,-50
+            2488: 0,-33
+            2489: -1,-33
+            2490: -2,-33
+            2688: 9,-76
+            2689: 5,-76
+            2690: 4,-76
+            2691: 3,-76
+            2904: 3,-71
+            2905: 4,-71
+            2906: 8,-71
+            2911: -7,-71
+            2912: -6,-71
+            2913: -5,-71
+            3364: 46,-21
+            3365: 45,-21
+            3366: 44,-21
+            3367: 43,-21
+            3368: 42,-21
         - node:
             color: '#EFB34196'
             id: WarnLineGreyscaleW
           decals:
-            1517: -7,8
+            1495: -7,8
         - node:
             color: '#FFFFFFFF'
             id: WarnLineGreyscaleW
           decals:
-            1286: 44,-20
-            1287: 44,-19
-            1288: 44,-18
-            1289: 44,-17
-            1290: 46,-20
-            1291: 46,-19
-            1292: 46,-18
-            2419: 75,-15
-            2420: 75,-14
-            2421: 75,-13
-            2688: -8,-75
-            2933: -8,-69
-            2934: -8,-70
+            1264: 44,-20
+            1265: 44,-19
+            1266: 44,-18
+            1267: 44,-17
+            1268: 46,-20
+            1269: 46,-19
+            1270: 46,-18
+            2395: 75,-15
+            2396: 75,-14
+            2397: 75,-13
+            2664: -8,-75
+            2909: -8,-69
+            2910: -8,-70
         - node:
             color: '#FFFFFFFF'
             id: WarnLineN
@@ -5394,50 +5431,50 @@ entities:
             1011: -74,-17
             1012: -72,-17
             1013: -71,-17
-            1556: -12,6
-            1574: 50,-29
-            1575: 49,-29
-            1576: 48,-29
-            1626: 22,-21
-            1627: 21,-21
-            1628: 19,-19
-            1629: 18,-19
-            1681: 52,-17
-            1682: 53,-17
-            1683: 54,-17
-            2056: 33,-90
-            2057: 32,-90
-            2058: 31,-90
-            2059: 25,-90
-            2060: 24,-90
-            2061: 23,-90
-            2322: -70,8
-            2323: -71,8
-            2324: -72,8
-            2325: -77,8
-            2326: -78,8
-            2327: -79,8
-            2486: 14,-46
-            2487: 13,-46
-            2488: 12,-46
-            2489: 11,-46
-            2490: 10,-46
-            2491: 9,-46
-            2630: 1,-79
-            2631: 0,-79
-            2632: -1,-79
-            2633: -2,-79
-            2634: -3,-79
-            2849: 18,-87
-            2850: 17,-87
-            2851: 16,-87
-            2852: 15,-87
-            2853: 14,-87
-            2854: 13,-87
-            2855: 12,-87
-            3126: 14,-75
-            3127: 15,-75
-            3128: 16,-75
+            1534: -12,6
+            1552: 50,-29
+            1553: 49,-29
+            1554: 48,-29
+            1604: 22,-21
+            1605: 21,-21
+            1606: 19,-19
+            1607: 18,-19
+            1659: 52,-17
+            1660: 53,-17
+            1661: 54,-17
+            2032: 33,-90
+            2033: 32,-90
+            2034: 31,-90
+            2035: 25,-90
+            2036: 24,-90
+            2037: 23,-90
+            2298: -70,8
+            2299: -71,8
+            2300: -72,8
+            2301: -77,8
+            2302: -78,8
+            2303: -79,8
+            2462: 14,-46
+            2463: 13,-46
+            2464: 12,-46
+            2465: 11,-46
+            2466: 10,-46
+            2467: 9,-46
+            2606: 1,-79
+            2607: 0,-79
+            2608: -1,-79
+            2609: -2,-79
+            2610: -3,-79
+            2825: 18,-87
+            2826: 17,-87
+            2827: 16,-87
+            2828: 15,-87
+            2829: 14,-87
+            2830: 13,-87
+            2831: 12,-87
+            3102: 14,-75
+            3103: 15,-75
+            3104: 16,-75
         - node:
             color: '#FFFFFFFF'
             id: WarnLineS
@@ -5477,33 +5514,33 @@ entities:
             892: 65,-20
             893: 65,-19
             894: 65,-18
-            1215: 53,-28
-            1633: 21,-17
-            1634: 21,-18
-            1635: 21,-19
-            1636: 21,-20
-            1672: 55,-20
-            1673: 55,-19
-            1674: 55,-18
-            1704: 53,-27
-            2053: 34,-93
-            2054: 34,-92
-            2055: 34,-91
-            2285: -8,-54
-            2310: -79,9
-            2313: -79,-5
-            2414: -30,-38
-            2415: -30,-37
-            2416: -30,-36
-            2417: -30,-39
-            2498: 8,-49
-            2499: 8,-48
-            3130: 17,-76
-            3550: -11,-62
-            3559: 25,18
-            3608: -11,34
-            3609: -11,35
-            3610: -11,36
+            1193: 53,-28
+            1611: 21,-17
+            1612: 21,-18
+            1613: 21,-19
+            1614: 21,-20
+            1650: 55,-20
+            1651: 55,-19
+            1652: 55,-18
+            1682: 53,-27
+            2029: 34,-93
+            2030: 34,-92
+            2031: 34,-91
+            2261: -8,-54
+            2286: -79,9
+            2289: -79,-5
+            2390: -30,-38
+            2391: -30,-37
+            2392: -30,-36
+            2393: -30,-39
+            2474: 8,-49
+            2475: 8,-48
+            3106: 17,-76
+            3526: -11,-62
+            3535: 25,18
+            3584: -11,34
+            3585: -11,35
+            3586: -11,36
         - node:
             color: '#FFFFFFFF'
             id: WarnLineW
@@ -5556,184 +5593,184 @@ entities:
             1076: -2,-25
             1077: -3,-25
             1078: 1,-25
-            1174: 76,-26
-            1175: 77,-26
-            1176: 78,-26
-            1177: 79,-26
-            1178: 80,-26
-            1179: 82,-26
-            1180: 81,-26
-            1195: 71,-22
-            1678: 54,-21
-            1679: 53,-21
-            1680: 52,-21
-            2316: -71,-4
-            2317: -72,-4
-            2318: -70,-4
-            2319: -78,-4
-            2320: -79,-4
-            2321: -77,-4
-            2492: 14,-46
-            2493: 13,-46
-            2494: 12,-46
-            2495: 11,-46
-            2496: 10,-46
-            2497: 9,-46
-            2856: 13,-84
-            2857: 14,-84
-            2858: 15,-84
-            2859: 16,-84
-            2860: 17,-84
-            2861: 18,-84
-            3123: 14,-77
-            3124: 15,-77
-            3125: 16,-77
-            3549: -12,-63
+            1152: 76,-26
+            1153: 77,-26
+            1154: 78,-26
+            1155: 79,-26
+            1156: 80,-26
+            1157: 82,-26
+            1158: 81,-26
+            1173: 71,-22
+            1656: 54,-21
+            1657: 53,-21
+            1658: 52,-21
+            2292: -71,-4
+            2293: -72,-4
+            2294: -70,-4
+            2295: -78,-4
+            2296: -79,-4
+            2297: -77,-4
+            2468: 14,-46
+            2469: 13,-46
+            2470: 12,-46
+            2471: 11,-46
+            2472: 10,-46
+            2473: 9,-46
+            2832: 13,-84
+            2833: 14,-84
+            2834: 15,-84
+            2835: 16,-84
+            2836: 17,-84
+            2837: 18,-84
+            3099: 14,-77
+            3100: 15,-77
+            3101: 16,-77
+            3525: -12,-63
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinCornerNe
           decals:
-            3225: -31,-25
-            3439: 12,-26
+            3201: -31,-25
+            3415: 12,-26
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinCornerNw
           decals:
-            3228: -34,-25
-            3446: 6,-26
+            3204: -34,-25
+            3422: 6,-26
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinCornerSe
           decals:
-            2467: 12,-37
-            3440: 12,-27
+            2443: 12,-37
+            3416: 12,-27
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinCornerSw
           decals:
-            2468: 10,-37
-            3445: 6,-27
+            2444: 10,-37
+            3421: 6,-27
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinEndN
           decals:
-            3436: 9,-25
+            3412: 9,-25
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinEndS
           decals:
-            3435: 9,-28
+            3411: 9,-28
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinInnerNe
           decals:
-            3452: 9,-26
+            3428: 9,-26
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinInnerNw
           decals:
-            3451: 9,-26
+            3427: 9,-26
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinInnerSe
           decals:
-            3450: 9,-27
+            3426: 9,-27
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinInnerSw
           decals:
-            3449: 9,-27
+            3425: 9,-27
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinLineE
           decals:
-            1241: -8,15
-            1251: 11,-19
-            1252: 11,-18
-            1253: 11,-17
-            1254: 11,-16
-            1255: 11,-15
-            1256: 11,-14
-            1257: 11,-13
-            2995: 12,-36
-            3222: -31,-28
-            3223: -31,-27
-            3224: -31,-26
-            3542: -12,-28
-            3543: -12,-27
-            3544: -12,-26
-            3545: -12,-25
-            3546: -12,-24
-            3547: -12,-23
-            3548: -12,-22
+            1219: -8,15
+            1229: 11,-19
+            1230: 11,-18
+            1231: 11,-17
+            1232: 11,-16
+            1233: 11,-15
+            1234: 11,-14
+            1235: 11,-13
+            2971: 12,-36
+            3198: -31,-28
+            3199: -31,-27
+            3200: -31,-26
+            3518: -12,-28
+            3519: -12,-27
+            3520: -12,-26
+            3521: -12,-25
+            3522: -12,-24
+            3523: -12,-23
+            3524: -12,-22
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinLineN
           decals:
-            1246: 16,37
-            1247: 15,37
-            1248: 14,37
-            1249: 13,37
-            1250: 12,37
-            1258: 11,-13
-            1259: 10,-13
-            1260: 9,-13
-            1261: 8,-13
-            1262: 7,-13
-            1263: 6,-13
-            1264: 5,-13
-            1660: 51,-38
-            1661: 52,-38
-            1662: 53,-38
-            1663: 54,-38
-            1664: 55,-38
-            1665: 56,-38
-            1666: 57,-38
-            3218: -34,-29
-            3219: -33,-29
-            3220: -32,-29
-            3221: -31,-29
-            3226: -32,-25
-            3227: -33,-25
-            3437: 10,-26
-            3438: 11,-26
-            3447: 7,-26
-            3448: 8,-26
+            1224: 16,37
+            1225: 15,37
+            1226: 14,37
+            1227: 13,37
+            1228: 12,37
+            1236: 11,-13
+            1237: 10,-13
+            1238: 9,-13
+            1239: 8,-13
+            1240: 7,-13
+            1241: 6,-13
+            1242: 5,-13
+            1638: 51,-38
+            1639: 52,-38
+            1640: 53,-38
+            1641: 54,-38
+            1642: 55,-38
+            1643: 56,-38
+            1644: 57,-38
+            3194: -34,-29
+            3195: -33,-29
+            3196: -32,-29
+            3197: -31,-29
+            3202: -32,-25
+            3203: -33,-25
+            3413: 10,-26
+            3414: 11,-26
+            3423: 7,-26
+            3424: 8,-26
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinLineS
           decals:
-            1242: -7,16
-            1243: -6,16
-            1244: -5,16
-            1245: -4,16
-            1370: -12,53
-            1371: -13,53
-            1372: -14,53
-            1373: -15,53
-            1374: -16,53
-            2469: 11,-37
-            3441: 11,-27
-            3442: 10,-27
-            3443: 8,-27
-            3444: 7,-27
+            1220: -7,16
+            1221: -6,16
+            1222: -5,16
+            1223: -4,16
+            1348: -12,53
+            1349: -13,53
+            1350: -14,53
+            1351: -15,53
+            1352: -16,53
+            2445: 11,-37
+            3417: 11,-27
+            3418: 10,-27
+            3419: 8,-27
+            3420: 7,-27
         - node:
             color: '#FFFFFFFF'
             id: WoodTrimThinLineW
           decals:
-            2862: 32,-1
-            2863: 32,0
-            2996: 10,-36
-            3229: -34,-28
-            3230: -34,-27
-            3231: -34,-26
-            3535: -8,-28
-            3536: -8,-27
-            3537: -8,-26
-            3538: -8,-25
-            3539: -8,-24
-            3540: -8,-23
-            3541: -8,-22
+            2838: 32,-1
+            2839: 32,0
+            2972: 10,-36
+            3205: -34,-28
+            3206: -34,-27
+            3207: -34,-26
+            3511: -8,-28
+            3512: -8,-27
+            3513: -8,-26
+            3514: -8,-25
+            3515: -8,-24
+            3516: -8,-23
+            3517: -8,-22
         - node:
             color: '#FFFFFFFF'
             id: bushsnowa2
@@ -5753,7 +5790,7 @@ entities:
             color: '#A4610606'
             id: splatter
           decals:
-            1173: 34.46607,8.395077
+            1151: 34.46607,8.395077
     - type: GridAtmosphere
       version: 2
       data:
@@ -7530,11 +7567,11 @@ entities:
             0: 65535
           13,-15:
             0: 65522
+            2: 4
           13,-14:
             0: 65535
           13,-13:
-            0: 65501
-            2: 34
+            0: 65535
           14,-16:
             0: 65535
           14,-15:
@@ -7547,6 +7584,7 @@ entities:
             0: 65535
           15,-15:
             0: 65522
+            2: 5
           15,-14:
             0: 65535
           15,-13:
@@ -8483,8 +8521,8 @@ entities:
           id: docking46345
           localAnchorB: -0.5,-1
           localAnchorA: -66.5,22
-          damping: 42.400932
-          stiffness: 380.5899
+          damping: 42.400917
+          stiffness: 380.58975
     - type: OccluderTree
     - type: Shuttle
     - type: RadiationGridResistance
@@ -8538,8 +8576,8 @@ entities:
           id: docking46345
           localAnchorB: -0.5,-1
           localAnchorA: -66.5,22
-          damping: 42.400932
-          stiffness: 380.5899
+          damping: 42.400917
+          stiffness: 380.58975
     - type: OccluderTree
     - type: Shuttle
     - type: RadiationGridResistance
@@ -9478,9 +9516,7 @@ entities:
       parent: 8364
     - type: DeviceList
       devices:
-      - 25013
       - 22722
-      - 25012
     - type: AtmosDevice
       joinedGrid: 8364
   - uid: 22726
@@ -10410,22 +10446,8 @@ entities:
     - type: Transform
       pos: 4.5,-48.5
       parent: 8364
-  - uid: 20674
-    components:
-    - type: MetaData
-      name: Atmos Sci Test Room
-    - type: Transform
-      pos: 57.5,-54.5
-      parent: 8364
 - proto: AirlockAtmosphericsLocked
   entities:
-  - uid: 2016
-    components:
-    - type: MetaData
-      name: Sci Test Lab
-    - type: Transform
-      pos: 64.5,-56.5
-      parent: 8364
   - uid: 3665
     components:
     - type: Transform
@@ -11371,16 +11393,6 @@ entities:
       linkedPorts:
         19989:
         - DoorStatus: DoorBolt
-  - uid: 20641
-    components:
-    - type: Transform
-      pos: 54.5,-56.5
-      parent: 8364
-  - uid: 21367
-    components:
-    - type: Transform
-      pos: 53.5,-54.5
-      parent: 8364
 - proto: AirlockExternalGlassShuttleArrivals
   entities:
   - uid: 606
@@ -12442,6 +12454,16 @@ entities:
     - type: Transform
       pos: -57.5,-12.5
       parent: 8364
+  - uid: 1997
+    components:
+    - type: Transform
+      pos: 51.5,-46.5
+      parent: 8364
+  - uid: 2025
+    components:
+    - type: Transform
+      pos: 56.5,-46.5
+      parent: 8364
   - uid: 2641
     components:
     - type: Transform
@@ -12633,6 +12655,13 @@ entities:
     - type: Transform
       pos: 1.5,-38.5
       parent: 8364
+  - uid: 18695
+    components:
+    - type: MetaData
+      name: Bungle Town
+    - type: Transform
+      pos: 56.5,-52.5
+      parent: 8364
   - uid: 19012
     components:
     - type: Transform
@@ -13014,13 +13043,6 @@ entities:
     - type: Transform
       pos: 51.5,-27.5
       parent: 8364
-  - uid: 2265
-    components:
-    - type: MetaData
-      name: Atmos Sci Test Lab
-    - type: Transform
-      pos: 56.5,-42.5
-      parent: 8364
   - uid: 2293
     components:
     - type: MetaData
@@ -13111,13 +13133,6 @@ entities:
     - type: Transform
       pos: 82.5,-27.5
       parent: 8364
-  - uid: 20672
-    components:
-    - type: MetaData
-      name: Atmos Sci Test Lab
-    - type: Transform
-      pos: 58.5,-42.5
-      parent: 8364
   - uid: 21140
     components:
     - type: Transform
@@ -14002,6 +14017,13 @@ entities:
     - type: PowerNetworkBattery
       loadingNetworkDemand: 85
       supplyRampPosition: 53.91901
+  - uid: 2016
+    components:
+    - type: MetaData
+      name: South Maint APC
+    - type: Transform
+      pos: 46.5,-64.5
+      parent: 8364
   - uid: 3714
     components:
     - type: MetaData
@@ -14646,13 +14668,6 @@ entities:
       loadingNetworkDemand: 10
       currentReceiving: 10.019571
       currentSupply: 10
-  - uid: 21352
-    components:
-    - type: MetaData
-      name: Sci Atmos Research APC
-    - type: Transform
-      pos: 60.5,-42.5
-      parent: 8364
   - uid: 21491
     components:
     - type: MetaData
@@ -15052,11 +15067,6 @@ entities:
     - type: Transform
       pos: 15.5,-50.5
       parent: 8364
-  - uid: 2537
-    components:
-    - type: Transform
-      pos: 53.5,-51.5
-      parent: 8364
   - uid: 9355
     components:
     - type: Transform
@@ -15207,11 +15217,6 @@ entities:
     - type: Transform
       pos: 16.5,-52.5
       parent: 8364
-  - uid: 20699
-    components:
-    - type: Transform
-      pos: 53.5,-50.5
-      parent: 8364
   - uid: 21772
     components:
     - type: Transform
@@ -15552,11 +15557,6 @@ entities:
       parent: 8364
 - proto: BagpipeInstrument
   entities:
-  - uid: 21343
-    components:
-    - type: Transform
-      pos: 57.44085,-57.432228
-      parent: 8364
   - uid: 26004
     components:
     - type: Transform
@@ -15820,6 +15820,11 @@ entities:
     - type: Transform
       pos: -31.5,-24.5
       parent: 8364
+  - uid: 2008
+    components:
+    - type: Transform
+      pos: 55.5,-49.5
+      parent: 8364
   - uid: 2037
     components:
     - type: Transform
@@ -16106,6 +16111,11 @@ entities:
     - type: Transform
       pos: 6.5,15.5
       parent: 8364
+  - uid: 6461
+    components:
+    - type: Transform
+      pos: 55.5,-49.5
+      parent: 8364
   - uid: 6465
     components:
     - type: Transform
@@ -16167,6 +16177,11 @@ entities:
       parent: 8364
 - proto: BigBox
   entities:
+  - uid: 2277
+    components:
+    - type: Transform
+      pos: 46.455715,-47.446358
+      parent: 8364
   - uid: 25967
     components:
     - type: Transform
@@ -16398,14 +16413,6 @@ entities:
     - type: Transform
       pos: 87.5,-38.5
       parent: 8364
-  - uid: 20667
-    components:
-    - type: Transform
-      pos: 53.5,-52.5
-      parent: 8364
-    - type: DeviceLinkSink
-      links:
-      - 20866
   - uid: 22831
     components:
     - type: Transform
@@ -16847,6 +16854,11 @@ entities:
       unspawnedCount: 12
 - proto: BoxBodyBag
   entities:
+  - uid: 2276
+    components:
+    - type: Transform
+      pos: 46.455715,-46.540108
+      parent: 8364
   - uid: 19315
     components:
     - type: Transform
@@ -17165,6 +17177,11 @@ entities:
       unspawnedCount: 12
 - proto: BoxLightbulb
   entities:
+  - uid: 1999
+    components:
+    - type: Transform
+      pos: 55.44968,-51.427322
+      parent: 8364
   - uid: 14437
     components:
     - type: Transform
@@ -17172,6 +17189,11 @@ entities:
       parent: 8364
 - proto: BoxLightMixed
   entities:
+  - uid: 2271
+    components:
+    - type: Transform
+      pos: 45.65884,-47.633858
+      parent: 8364
   - uid: 3686
     components:
     - type: Transform
@@ -17264,6 +17286,13 @@ entities:
     - type: Transform
       pos: -11.524348,-21.41842
       parent: 8364
+- proto: BriefcaseBrown
+  entities:
+  - uid: 2580
+    components:
+    - type: Transform
+      pos: 57.77009,-49.405586
+      parent: 8364
 - proto: BriefcaseBrownFilled
   entities:
   - uid: 6289
@@ -17567,11 +17596,6 @@ entities:
     - type: Transform
       pos: -78.5,-4.5
       parent: 8364
-  - uid: 916
-    components:
-    - type: Transform
-      pos: 58.5,-56.5
-      parent: 8364
   - uid: 1107
     components:
     - type: Transform
@@ -17702,85 +17726,100 @@ entities:
     - type: Transform
       pos: 45.5,-25.5
       parent: 8364
-  - uid: 2264
+  - uid: 2015
     components:
     - type: Transform
-      pos: 53.5,-53.5
+      pos: 46.5,-64.5
       parent: 8364
-  - uid: 2266
+  - uid: 2020
     components:
     - type: Transform
-      pos: 59.5,-47.5
+      pos: 25.5,-36.5
       parent: 8364
-  - uid: 2267
+  - uid: 2021
     components:
     - type: Transform
-      pos: 56.5,-44.5
+      pos: 25.5,-37.5
       parent: 8364
-  - uid: 2269
+  - uid: 2023
     components:
     - type: Transform
-      pos: 63.5,-56.5
+      pos: 34.5,-47.5
       parent: 8364
-  - uid: 2270
+  - uid: 2029
     components:
     - type: Transform
-      pos: 62.5,-56.5
+      pos: 35.5,-47.5
       parent: 8364
-  - uid: 2271
+  - uid: 2244
     components:
     - type: Transform
-      pos: 61.5,-56.5
+      pos: 55.5,-46.5
       parent: 8364
-  - uid: 2272
+  - uid: 2251
     components:
     - type: Transform
-      pos: 60.5,-56.5
+      pos: 58.5,-46.5
       parent: 8364
-  - uid: 2273
+  - uid: 2255
     components:
     - type: Transform
-      pos: 59.5,-56.5
+      pos: 58.5,-45.5
       parent: 8364
-  - uid: 2274
+  - uid: 2256
     components:
     - type: Transform
-      pos: 54.5,-56.5
+      pos: 58.5,-47.5
       parent: 8364
-  - uid: 2289
+  - uid: 2259
     components:
     - type: Transform
-      pos: 58.5,-44.5
+      pos: 56.5,-46.5
       parent: 8364
-  - uid: 2290
+  - uid: 2260
     components:
     - type: Transform
-      pos: 58.5,-50.5
+      pos: 33.5,-47.5
       parent: 8364
-  - uid: 2516
+  - uid: 2265
     components:
     - type: Transform
-      pos: 39.5,-48.5
+      pos: 54.5,-46.5
       parent: 8364
-  - uid: 2576
+  - uid: 2268
     components:
     - type: Transform
-      pos: 63.5,-44.5
+      pos: 25.5,-35.5
       parent: 8364
-  - uid: 2577
+  - uid: 2272
     components:
     - type: Transform
-      pos: 52.5,-44.5
+      pos: 50.5,-47.5
       parent: 8364
-  - uid: 2613
+  - uid: 2273
     components:
     - type: Transform
-      pos: 55.5,-56.5
+      pos: 51.5,-47.5
       parent: 8364
-  - uid: 2616
+  - uid: 2274
     components:
     - type: Transform
-      pos: 53.5,-56.5
+      pos: 58.5,-48.5
+      parent: 8364
+  - uid: 2275
+    components:
+    - type: Transform
+      pos: 57.5,-46.5
+      parent: 8364
+  - uid: 2516
+    components:
+    - type: Transform
+      pos: 39.5,-48.5
+      parent: 8364
+  - uid: 2578
+    components:
+    - type: Transform
+      pos: 25.5,-34.5
       parent: 8364
   - uid: 2934
     components:
@@ -27332,11 +27371,6 @@ entities:
     - type: Transform
       pos: -32.5,19.5
       parent: 8364
-  - uid: 13349
-    components:
-    - type: Transform
-      pos: 57.5,-47.5
-      parent: 8364
   - uid: 13387
     components:
     - type: Transform
@@ -35102,16 +35136,6 @@ entities:
     - type: Transform
       pos: 49.5,-60.5
       parent: 8364
-  - uid: 18472
-    components:
-    - type: Transform
-      pos: 49.5,-61.5
-      parent: 8364
-  - uid: 18473
-    components:
-    - type: Transform
-      pos: 49.5,-62.5
-      parent: 8364
   - uid: 18474
     components:
     - type: Transform
@@ -35272,16 +35296,6 @@ entities:
     - type: Transform
       pos: 33.5,-57.5
       parent: 8364
-  - uid: 18506
-    components:
-    - type: Transform
-      pos: 32.5,-57.5
-      parent: 8364
-  - uid: 18507
-    components:
-    - type: Transform
-      pos: 32.5,-56.5
-      parent: 8364
   - uid: 18508
     components:
     - type: Transform
@@ -35367,11 +35381,6 @@ entities:
     - type: Transform
       pos: 32.5,-39.5
       parent: 8364
-  - uid: 18525
-    components:
-    - type: Transform
-      pos: 32.5,-38.5
-      parent: 8364
   - uid: 18526
     components:
     - type: Transform
@@ -35437,16 +35446,6 @@ entities:
     - type: Transform
       pos: 19.5,-38.5
       parent: 8364
-  - uid: 18539
-    components:
-    - type: Transform
-      pos: 18.5,-38.5
-      parent: 8364
-  - uid: 18540
-    components:
-    - type: Transform
-      pos: 17.5,-38.5
-      parent: 8364
   - uid: 18541
     components:
     - type: Transform
@@ -35567,11 +35566,6 @@ entities:
     - type: Transform
       pos: -9.5,44.5
       parent: 8364
-  - uid: 18572
-    components:
-    - type: Transform
-      pos: 57.5,-53.5
-      parent: 8364
   - uid: 18679
     components:
     - type: Transform
@@ -36867,11 +36861,6 @@ entities:
     - type: Transform
       pos: 89.5,-30.5
       parent: 8364
-  - uid: 19866
-    components:
-    - type: Transform
-      pos: 57.5,-46.5
-      parent: 8364
   - uid: 19893
     components:
     - type: Transform
@@ -36992,16 +36981,6 @@ entities:
     - type: Transform
       pos: 82.5,-68.5
       parent: 8364
-  - uid: 20187
-    components:
-    - type: Transform
-      pos: 57.5,-52.5
-      parent: 8364
-  - uid: 20273
-    components:
-    - type: Transform
-      pos: 60.5,-41.5
-      parent: 8364
   - uid: 20394
     components:
     - type: Transform
@@ -38137,81 +38116,6 @@ entities:
     - type: Transform
       pos: 52.5,-37.5
       parent: 8364
-  - uid: 20627
-    components:
-    - type: Transform
-      pos: 54.5,-41.5
-      parent: 8364
-  - uid: 20628
-    components:
-    - type: Transform
-      pos: 57.5,-41.5
-      parent: 8364
-  - uid: 20629
-    components:
-    - type: Transform
-      pos: 57.5,-42.5
-      parent: 8364
-  - uid: 20630
-    components:
-    - type: Transform
-      pos: 57.5,-43.5
-      parent: 8364
-  - uid: 20642
-    components:
-    - type: Transform
-      pos: 61.5,-50.5
-      parent: 8364
-  - uid: 20643
-    components:
-    - type: Transform
-      pos: 62.5,-52.5
-      parent: 8364
-  - uid: 20645
-    components:
-    - type: Transform
-      pos: 57.5,-58.5
-      parent: 8364
-  - uid: 20646
-    components:
-    - type: Transform
-      pos: 56.5,-58.5
-      parent: 8364
-  - uid: 20647
-    components:
-    - type: Transform
-      pos: 58.5,-58.5
-      parent: 8364
-  - uid: 20648
-    components:
-    - type: Transform
-      pos: 53.5,-54.5
-      parent: 8364
-  - uid: 20650
-    components:
-    - type: Transform
-      pos: 57.5,-56.5
-      parent: 8364
-  - uid: 20651
-    components:
-    - type: Transform
-      pos: 59.5,-50.5
-      parent: 8364
-  - uid: 20652
-    components:
-    - type: Transform
-      pos: 62.5,-47.5
-      parent: 8364
-  - uid: 20654
-    components:
-    - type: Transform
-      pos: 52.5,-58.5
-      parent: 8364
-  - uid: 20655
-    components:
-    - type: Transform
-      pos: 53.5,-58.5
-      parent: 8364
   - uid: 20659
     components:
     - type: Transform
@@ -38222,71 +38126,6 @@ entities:
     - type: Transform
       pos: 71.5,-53.5
       parent: 8364
-  - uid: 20669
-    components:
-    - type: Transform
-      pos: 60.5,-42.5
-      parent: 8364
-  - uid: 20670
-    components:
-    - type: Transform
-      pos: 60.5,-44.5
-      parent: 8364
-  - uid: 20671
-    components:
-    - type: Transform
-      pos: 61.5,-47.5
-      parent: 8364
-  - uid: 20675
-    components:
-    - type: Transform
-      pos: 57.5,-49.5
-      parent: 8364
-  - uid: 20676
-    components:
-    - type: Transform
-      pos: 58.5,-47.5
-      parent: 8364
-  - uid: 20677
-    components:
-    - type: Transform
-      pos: 62.5,-51.5
-      parent: 8364
-  - uid: 20685
-    components:
-    - type: Transform
-      pos: 57.5,-45.5
-      parent: 8364
-  - uid: 20686
-    components:
-    - type: Transform
-      pos: 57.5,-51.5
-      parent: 8364
-  - uid: 20687
-    components:
-    - type: Transform
-      pos: 53.5,-44.5
-      parent: 8364
-  - uid: 20688
-    components:
-    - type: Transform
-      pos: 62.5,-44.5
-      parent: 8364
-  - uid: 20693
-    components:
-    - type: Transform
-      pos: 60.5,-50.5
-      parent: 8364
-  - uid: 20697
-    components:
-    - type: Transform
-      pos: 53.5,-55.5
-      parent: 8364
-  - uid: 20698
-    components:
-    - type: Transform
-      pos: 53.5,-52.5
-      parent: 8364
   - uid: 20700
     components:
     - type: Transform
@@ -38752,41 +38591,6 @@ entities:
     - type: Transform
       pos: 68.5,-35.5
       parent: 8364
-  - uid: 20799
-    components:
-    - type: Transform
-      pos: 64.5,-56.5
-      parent: 8364
-  - uid: 20825
-    components:
-    - type: Transform
-      pos: 57.5,-44.5
-      parent: 8364
-  - uid: 20854
-    components:
-    - type: Transform
-      pos: 57.5,-48.5
-      parent: 8364
-  - uid: 20855
-    components:
-    - type: Transform
-      pos: 57.5,-50.5
-      parent: 8364
-  - uid: 20856
-    components:
-    - type: Transform
-      pos: 54.5,-44.5
-      parent: 8364
-  - uid: 20857
-    components:
-    - type: Transform
-      pos: 59.5,-44.5
-      parent: 8364
-  - uid: 20858
-    components:
-    - type: Transform
-      pos: 61.5,-44.5
-      parent: 8364
   - uid: 21292
     components:
     - type: Transform
@@ -38807,31 +38611,6 @@ entities:
     - type: Transform
       pos: 12.5,-31.5
       parent: 8364
-  - uid: 21346
-    components:
-    - type: Transform
-      pos: 56.5,-56.5
-      parent: 8364
-  - uid: 21365
-    components:
-    - type: Transform
-      pos: 60.5,-47.5
-      parent: 8364
-  - uid: 21366
-    components:
-    - type: Transform
-      pos: 62.5,-50.5
-      parent: 8364
-  - uid: 21368
-    components:
-    - type: Transform
-      pos: 55.5,-44.5
-      parent: 8364
-  - uid: 21376
-    components:
-    - type: Transform
-      pos: 53.5,-51.5
-      parent: 8364
   - uid: 21452
     components:
     - type: Transform
@@ -38947,36 +38726,6 @@ entities:
     - type: Transform
       pos: 11.5,-8.5
       parent: 8364
-  - uid: 22536
-    components:
-    - type: Transform
-      pos: 62.5,-57.5
-      parent: 8364
-  - uid: 22537
-    components:
-    - type: Transform
-      pos: 57.5,-57.5
-      parent: 8364
-  - uid: 22538
-    components:
-    - type: Transform
-      pos: 62.5,-58.5
-      parent: 8364
-  - uid: 22539
-    components:
-    - type: Transform
-      pos: 61.5,-58.5
-      parent: 8364
-  - uid: 22540
-    components:
-    - type: Transform
-      pos: 63.5,-58.5
-      parent: 8364
-  - uid: 22541
-    components:
-    - type: Transform
-      pos: 53.5,-57.5
-      parent: 8364
   - uid: 22578
     components:
     - type: Transform
@@ -40194,6 +39943,11 @@ entities:
     - type: Transform
       pos: -51.663174,-6.0246577
       parent: 8364
+  - uid: 2284
+    components:
+    - type: Transform
+      pos: 60.473213,-49.45246
+      parent: 8364
   - uid: 11981
     components:
     - type: Transform
@@ -47368,6 +47122,11 @@ entities:
     - type: Transform
       pos: -17.5,-36.5
       parent: 8364
+  - uid: 2288
+    components:
+    - type: Transform
+      pos: 46.5,-64.5
+      parent: 8364
   - uid: 2864
     components:
     - type: Transform
@@ -54408,11 +54167,6 @@ entities:
     - type: Transform
       pos: 83.5,-64.5
       parent: 8364
-  - uid: 20217
-    components:
-    - type: Transform
-      pos: 60.5,-41.5
-      parent: 8364
   - uid: 20223
     components:
     - type: Transform
@@ -55068,11 +54822,6 @@ entities:
     - type: Transform
       pos: 55.5,-32.5
       parent: 8364
-  - uid: 20381
-    components:
-    - type: Transform
-      pos: 60.5,-42.5
-      parent: 8364
   - uid: 21580
     components:
     - type: Transform
@@ -59694,11 +59443,6 @@ entities:
     - type: Transform
       pos: 31.5,-38.5
       parent: 8364
-  - uid: 12191
-    components:
-    - type: Transform
-      pos: 32.5,-38.5
-      parent: 8364
   - uid: 12212
     components:
     - type: Transform
@@ -59784,11 +59528,6 @@ entities:
     - type: Transform
       pos: 32.5,-55.5
       parent: 8364
-  - uid: 12659
-    components:
-    - type: Transform
-      pos: 32.5,-57.5
-      parent: 8364
   - uid: 12660
     components:
     - type: Transform
@@ -59804,11 +59543,6 @@ entities:
     - type: Transform
       pos: 35.5,-57.5
       parent: 8364
-  - uid: 12676
-    components:
-    - type: Transform
-      pos: 36.5,-57.5
-      parent: 8364
   - uid: 12677
     components:
     - type: Transform
@@ -59829,11 +59563,6 @@ entities:
     - type: Transform
       pos: 36.5,-61.5
       parent: 8364
-  - uid: 12788
-    components:
-    - type: Transform
-      pos: 36.5,-62.5
-      parent: 8364
   - uid: 12873
     components:
     - type: Transform
@@ -59849,26 +59578,6 @@ entities:
     - type: Transform
       pos: 39.5,-62.5
       parent: 8364
-  - uid: 13065
-    components:
-    - type: Transform
-      pos: 40.5,-62.5
-      parent: 8364
-  - uid: 13081
-    components:
-    - type: Transform
-      pos: 40.5,-63.5
-      parent: 8364
-  - uid: 13082
-    components:
-    - type: Transform
-      pos: 40.5,-64.5
-      parent: 8364
-  - uid: 13083
-    components:
-    - type: Transform
-      pos: 40.5,-65.5
-      parent: 8364
   - uid: 13084
     components:
     - type: Transform
@@ -59899,11 +59608,6 @@ entities:
     - type: Transform
       pos: 46.5,-65.5
       parent: 8364
-  - uid: 13090
-    components:
-    - type: Transform
-      pos: 47.5,-65.5
-      parent: 8364
   - uid: 13091
     components:
     - type: Transform
@@ -62149,31 +61853,6 @@ entities:
     - type: Transform
       pos: 0.5,-77.5
       parent: 8364
-  - uid: 20219
-    components:
-    - type: Transform
-      pos: 55.5,-51.5
-      parent: 8364
-  - uid: 20274
-    components:
-    - type: Transform
-      pos: 55.5,-50.5
-      parent: 8364
-  - uid: 20378
-    components:
-    - type: Transform
-      pos: 53.5,-48.5
-      parent: 8364
-  - uid: 20859
-    components:
-    - type: Transform
-      pos: 53.5,-56.5
-      parent: 8364
-  - uid: 21356
-    components:
-    - type: Transform
-      pos: 53.5,-55.5
-      parent: 8364
   - uid: 21551
     components:
     - type: Transform
@@ -62964,6 +62643,16 @@ entities:
     - type: Transform
       pos: 28.5,-16.5
       parent: 8364
+  - uid: 2007
+    components:
+    - type: Transform
+      pos: 61.5,-50.5
+      parent: 8364
+  - uid: 2009
+    components:
+    - type: Transform
+      pos: 62.5,-50.5
+      parent: 8364
   - uid: 2202
     components:
     - type: Transform
@@ -64977,29 +64666,6 @@ entities:
         - 0
         - 0
         - 0
-  - uid: 2261
-    components:
-    - type: Transform
-      pos: 52.5,-55.5
-      parent: 8364
-    - type: EntityStorage
-      air:
-        volume: 200
-        immutable: False
-        temperature: 293.1496
-        moles:
-        - 5.001885
-        - 18.816614
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
   - uid: 2357
     components:
     - type: Transform
@@ -65028,29 +64694,6 @@ entities:
         - 0
         - 0
         - 0
-  - uid: 6461
-    components:
-    - type: Transform
-      pos: 50.5,-57.5
-      parent: 8364
-    - type: EntityStorage
-      air:
-        volume: 200
-        immutable: False
-        temperature: 293.1496
-        moles:
-        - 5.001885
-        - 18.816614
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
   - uid: 6518
     components:
     - type: Transform
@@ -66100,52 +65743,6 @@ entities:
         - 0
         - 0
         - 0
-  - uid: 2007
-    components:
-    - type: Transform
-      pos: 56.5,-55.5
-      parent: 8364
-    - type: EntityStorage
-      air:
-        volume: 200
-        immutable: False
-        temperature: 293.1496
-        moles:
-        - 5.001885
-        - 18.816614
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-  - uid: 2015
-    components:
-    - type: Transform
-      pos: 50.5,-56.5
-      parent: 8364
-    - type: EntityStorage
-      air:
-        volume: 200
-        immutable: False
-        temperature: 293.1496
-        moles:
-        - 5.001885
-        - 18.816614
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
   - uid: 5310
     components:
     - type: Transform
@@ -67204,6 +66801,11 @@ entities:
           showEnts: False
           occludes: True
           ent: null
+  - uid: 17722
+    components:
+    - type: Transform
+      pos: 55.5,-43.5
+      parent: 8364
   - uid: 18761
     components:
     - type: Transform
@@ -68342,6 +67944,11 @@ entities:
       parent: 8364
 - proto: ClothingBeltUtility
   entities:
+  - uid: 10603
+    components:
+    - type: Transform
+      pos: 60.05134,-49.51496
+      parent: 8364
   - uid: 12274
     components:
     - type: Transform
@@ -68415,6 +68022,11 @@ entities:
       parent: 8364
 - proto: ClothingEyesGlassesMeson
   entities:
+  - uid: 2018
+    components:
+    - type: Transform
+      pos: 60.02009,-49.311836
+      parent: 8364
   - uid: 16288
     components:
     - type: Transform
@@ -68425,13 +68037,6 @@ entities:
     - type: Transform
       pos: -3.3809297,-63.418907
       parent: 8364
-- proto: ClothingEyesGlassesSecurity
-  entities:
-  - uid: 9536
-    components:
-    - type: Transform
-      pos: 25.557201,35.620697
-      parent: 8364
 - proto: ClothingEyesGlassesSunglasses
   entities:
   - uid: 8478
@@ -68552,6 +68157,13 @@ entities:
     - type: Transform
       pos: 47.523952,-66.32047
       parent: 8364
+- proto: ClothingHandsGlovesFingerless
+  entities:
+  - uid: 2257
+    components:
+    - type: Transform
+      pos: 58.641335,-51.477516
+      parent: 8364
 - proto: ClothingHandsGlovesLatex
   entities:
   - uid: 21264
@@ -68796,11 +68408,6 @@ entities:
       parent: 8364
 - proto: ClothingHeadHatWelding
   entities:
-  - uid: 2005
-    components:
-    - type: Transform
-      pos: 59.576565,-55.586205
-      parent: 8364
   - uid: 21229
     components:
     - type: Transform
@@ -68903,16 +68510,6 @@ entities:
     - type: Transform
       pos: 65.5,-52.5
       parent: 8364
-  - uid: 22529
-    components:
-    - type: Transform
-      pos: 58.432278,-55.434486
-      parent: 8364
-  - uid: 22530
-    components:
-    - type: Transform
-      pos: 58.682278,-55.57511
-      parent: 8364
   - uid: 26839
     components:
     - type: Transform
@@ -69059,7 +68656,7 @@ entities:
   - uid: 7694
     components:
     - type: Transform
-      pos: 25.568052,35.594994
+      pos: 25.591892,35.701836
       parent: 8364
 - proto: ClothingNeckMantleRD
   entities:
@@ -69449,6 +69046,11 @@ entities:
       parent: 8364
 - proto: ClothingShoesSlippers
   entities:
+  - uid: 16364
+    components:
+    - type: Transform
+      pos: 54.483116,-49.66147
+      parent: 8364
   - uid: 26444
     components:
     - type: Transform
@@ -69504,6 +69106,21 @@ entities:
     - type: Transform
       pos: 15.5,-34.5
       parent: 8364
+  - uid: 2248
+    components:
+    - type: Transform
+      pos: 43.5,-44.5
+      parent: 8364
+  - uid: 2281
+    components:
+    - type: Transform
+      pos: 51.5,-43.5
+      parent: 8364
+  - uid: 20380
+    components:
+    - type: Transform
+      pos: 84.5,-35.5
+      parent: 8364
   - uid: 27747
     components:
     - type: Transform
@@ -69551,6 +69168,21 @@ entities:
     - type: Transform
       pos: 32.5,-38.5
       parent: 8364
+  - uid: 2254
+    components:
+    - type: Transform
+      pos: 70.5,-55.5
+      parent: 8364
+  - uid: 2266
+    components:
+    - type: Transform
+      pos: 46.5,-44.5
+      parent: 8364
+  - uid: 2282
+    components:
+    - type: Transform
+      pos: 86.5,-34.5
+      parent: 8364
   - uid: 27746
     components:
     - type: Transform
@@ -69591,6 +69223,13 @@ entities:
     - type: Transform
       pos: 26.5,29.5
       parent: 8364
+- proto: CockroachTimedSpawner
+  entities:
+  - uid: 2579
+    components:
+    - type: Transform
+      pos: 86.5,-34.5
+      parent: 8364
 - proto: ComfyChair
   entities:
   - uid: 460
@@ -69605,18 +69244,6 @@ entities:
       rot: -1.5707963267948966 rad
       pos: 7.5,-55.5
       parent: 8364
-  - uid: 2003
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 56.5,-57.5
-      parent: 8364
-  - uid: 2004
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 58.5,-57.5
-      parent: 8364
   - uid: 4611
     components:
     - type: Transform
@@ -70874,6 +70501,11 @@ entities:
         - 0
 - proto: CrateCoffin
   entities:
+  - uid: 11610
+    components:
+    - type: Transform
+      pos: 63.5,-43.5
+      parent: 8364
   - uid: 21986
     components:
     - type: Transform
@@ -70903,6 +70535,26 @@ entities:
       parent: 8364
 - proto: CrateEmptySpawner
   entities:
+  - uid: 2576
+    components:
+    - type: Transform
+      pos: 59.5,-43.5
+      parent: 8364
+  - uid: 2577
+    components:
+    - type: Transform
+      pos: 60.5,-43.5
+      parent: 8364
+  - uid: 2581
+    components:
+    - type: Transform
+      pos: 57.5,-43.5
+      parent: 8364
+  - uid: 12659
+    components:
+    - type: Transform
+      pos: 58.5,-43.5
+      parent: 8364
   - uid: 17774
     components:
     - type: Transform
@@ -71093,6 +70745,11 @@ entities:
       parent: 8364
 - proto: CrateGenericSteel
   entities:
+  - uid: 10005
+    components:
+    - type: Transform
+      pos: 60.5,-48.5
+      parent: 8364
   - uid: 13543
     components:
     - type: Transform
@@ -71899,6 +71556,11 @@ entities:
       rot: 3.141592653589793 rad
       pos: -24.5,43.5
       parent: 8364
+  - uid: 19979
+    components:
+    - type: Transform
+      pos: 27.5,-27.5
+      parent: 8364
 - proto: CryogenicSleepUnitSpawnerLateJoin
   entities:
   - uid: 15509
@@ -81215,6 +80877,11 @@ entities:
     - type: Transform
       pos: 14.5,30.5
       parent: 8364
+  - uid: 12191
+    components:
+    - type: Transform
+      pos: 60.5,-45.5
+      parent: 8364
   - uid: 17760
     components:
     - type: Transform
@@ -81392,15 +81059,6 @@ entities:
       parent: 8364
 - proto: EmergencyLight
   entities:
-  - uid: 2260
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 63.5,-48.5
-      parent: 8364
-    - type: PointLight
-      enabled: True
-    - type: ActiveEmergencyLight
   - uid: 21308
     components:
     - type: Transform
@@ -83396,6 +83054,11 @@ entities:
       parent: 8364
 - proto: FireExtinguisher
   entities:
+  - uid: 2019
+    components:
+    - type: Transform
+      pos: 59.55134,-49.311836
+      parent: 8364
   - uid: 6616
     components:
     - type: Transform
@@ -83676,26 +83339,6 @@ entities:
     - type: Transform
       pos: -4.5,40.5
       parent: 8364
-  - uid: 2253
-    components:
-    - type: Transform
-      pos: 56.5,-42.5
-      parent: 8364
-  - uid: 2254
-    components:
-    - type: Transform
-      pos: 58.5,-42.5
-      parent: 8364
-  - uid: 2255
-    components:
-    - type: Transform
-      pos: 57.5,-54.5
-      parent: 8364
-  - uid: 2256
-    components:
-    - type: Transform
-      pos: 64.5,-56.5
-      parent: 8364
   - uid: 2782
     components:
     - type: Transform
@@ -84933,6 +84576,11 @@ entities:
       parent: 8364
 - proto: FlashlightLantern
   entities:
+  - uid: 2017
+    components:
+    - type: Transform
+      pos: 53.45759,-48.32746
+      parent: 8364
   - uid: 11756
     components:
     - type: Transform
@@ -85635,13 +85283,6 @@ entities:
     - type: Transform
       pos: 34.5,-53.5
       parent: 8364
-- proto: FoodBoxDonkpocketGondola
-  entities:
-  - uid: 27155
-    components:
-    - type: Transform
-      pos: 26.502972,-87.37317
-      parent: 8364
 - proto: FoodBoxDonkpocketPizza
   entities:
   - uid: 21146
@@ -85649,6 +85290,11 @@ entities:
     - type: Transform
       pos: 51.57733,-33.333336
       parent: 8364
+  - uid: 27155
+    components:
+    - type: Transform
+      pos: 26.502972,-87.37317
+      parent: 8364
 - proto: FoodBoxDonut
   entities:
   - uid: 541
@@ -85828,16 +85474,6 @@ entities:
     - type: Transform
       pos: -46.50418,1.7327793
       parent: 8364
-  - uid: 20860
-    components:
-    - type: Transform
-      pos: 61.54493,-43.505928
-      parent: 8364
-  - uid: 20861
-    components:
-    - type: Transform
-      pos: 61.35743,-43.380928
-      parent: 8364
 - proto: GasFilter
   entities:
   - uid: 17247
@@ -85909,30 +85545,6 @@ entities:
       joinedGrid: 8364
     - type: AtmosPipeColor
       color: '#FF1212FF'
-  - uid: 21354
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 59.5,-51.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 21357
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 61.5,-51.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 22453
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 61.5,-46.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
 - proto: GasMinerCarbonDioxide
   entities:
   - uid: 16807
@@ -85985,20 +85597,6 @@ entities:
       joinedGrid: 8364
     - type: AtmosPipeColor
       color: '#03FCD3FF'
-  - uid: 20595
-    components:
-    - type: Transform
-      pos: 53.5,-44.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 20596
-    components:
-    - type: Transform
-      pos: 53.5,-45.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 24988
     components:
     - type: Transform
@@ -86023,23 +85621,8 @@ entities:
       parent: 8364
     - type: AtmosDevice
       joinedGrid: 8364
-  - uid: 26875
-    components:
-    - type: Transform
-      pos: 58.5,-48.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
 - proto: GasMixerFlipped
   entities:
-  - uid: 22454
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 61.5,-48.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 27555
     components:
     - type: Transform
@@ -86098,14 +85681,6 @@ entities:
       parent: 8364
     - type: AtmosDevice
       joinedGrid: 8364
-  - uid: 20656
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 53.5,-50.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 23110
     components:
     - type: Transform
@@ -86146,6 +85721,22 @@ entities:
       joinedGrid: 8364
     - type: AtmosPipeColor
       color: '#FF1212FF'
+  - uid: 12676
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 72.5,-41.5
+      parent: 8364
+    - type: AtmosDevice
+      joinedGrid: 8364
+  - uid: 12680
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 72.5,-39.5
+      parent: 8364
+    - type: AtmosDevice
+      joinedGrid: 8364
   - uid: 15517
     components:
     - type: Transform
@@ -86252,22 +85843,6 @@ entities:
       parent: 8364
     - type: AtmosDevice
       joinedGrid: 8364
-  - uid: 20663
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 55.5,-50.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 20664
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 53.5,-51.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 22844
     components:
     - type: Transform
@@ -86321,21 +85896,12 @@ entities:
       parent: 8364
     - type: AtmosPipeColor
       color: '#FF1212FF'
-  - uid: 2279
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 55.5,-44.5
-      parent: 8364
-    - type: AtmosPipeColor
-      color: '#0335FCFF'
-  - uid: 2536
+  - uid: 2004
     components:
     - type: Transform
-      pos: 59.5,-44.5
+      rot: 3.141592653589793 rad
+      pos: 56.5,-40.5
       parent: 8364
-    - type: AtmosPipeColor
-      color: '#FF1212FF'
   - uid: 3821
     components:
     - type: Transform
@@ -87210,33 +86776,11 @@ entities:
       parent: 8364
     - type: AtmosPipeColor
       color: '#0335FCFF'
-  - uid: 20366
-    components:
-    - type: Transform
-      pos: 62.5,-50.5
-      parent: 8364
-  - uid: 20383
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 62.5,-51.5
-      parent: 8364
-  - uid: 20388
-    components:
-    - type: Transform
-      pos: 53.5,-43.5
-      parent: 8364
-  - uid: 20640
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 63.5,-48.5
-      parent: 8364
-  - uid: 20649
+  - uid: 20368
     components:
     - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 63.5,-46.5
+      rot: 3.141592653589793 rad
+      pos: 58.5,-41.5
       parent: 8364
   - uid: 21770
     components:
@@ -87252,12 +86796,6 @@ entities:
       rot: -1.5707963267948966 rad
       pos: 30.5,-35.5
       parent: 8364
-  - uid: 22456
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 61.5,-49.5
-      parent: 8364
   - uid: 22545
     components:
     - type: Transform
@@ -91580,72 +91118,6 @@ entities:
       parent: 8364
     - type: AtmosPipeColor
       color: '#FF1212FF'
-  - uid: 20376
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 56.5,-51.5
-      parent: 8364
-  - uid: 20377
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 55.5,-51.5
-      parent: 8364
-  - uid: 20382
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 54.5,-51.5
-      parent: 8364
-  - uid: 20384
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 60.5,-51.5
-      parent: 8364
-  - uid: 20631
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 59.5,-52.5
-      parent: 8364
-  - uid: 20632
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 61.5,-52.5
-      parent: 8364
-  - uid: 20657
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 58.5,-51.5
-      parent: 8364
-  - uid: 20678
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 59.5,-50.5
-      parent: 8364
-  - uid: 20801
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 53.5,-48.5
-      parent: 8364
-  - uid: 21144
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 53.5,-47.5
-      parent: 8364
-  - uid: 21377
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 53.5,-49.5
-      parent: 8364
   - uid: 21382
     components:
     - type: Transform
@@ -91662,17 +91134,6 @@ entities:
       parent: 8364
     - type: AtmosPipeColor
       color: '#0335FCFF'
-  - uid: 21385
-    components:
-    - type: Transform
-      pos: 62.5,-47.5
-      parent: 8364
-  - uid: 21386
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 61.5,-50.5
-      parent: 8364
   - uid: 21742
     components:
     - type: Transform
@@ -91689,35 +91150,6 @@ entities:
       parent: 8364
     - type: AtmosPipeColor
       color: '#0335FCFF'
-  - uid: 22450
-    components:
-    - type: Transform
-      pos: 61.5,-47.5
-      parent: 8364
-  - uid: 22451
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 60.5,-50.5
-      parent: 8364
-  - uid: 22452
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 58.5,-50.5
-      parent: 8364
-  - uid: 22455
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 57.5,-50.5
-      parent: 8364
-  - uid: 22457
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 56.5,-50.5
-      parent: 8364
   - uid: 22735
     components:
     - type: Transform
@@ -103976,41 +103408,6 @@ entities:
       parent: 8364
     - type: AtmosPipeColor
       color: '#FF1212FF'
-  - uid: 25228
-    components:
-    - type: Transform
-      pos: 56.5,-41.5
-      parent: 8364
-    - type: AtmosPipeColor
-      color: '#0335FCFF'
-  - uid: 25229
-    components:
-    - type: Transform
-      pos: 56.5,-42.5
-      parent: 8364
-    - type: AtmosPipeColor
-      color: '#0335FCFF'
-  - uid: 25230
-    components:
-    - type: Transform
-      pos: 56.5,-43.5
-      parent: 8364
-    - type: AtmosPipeColor
-      color: '#0335FCFF'
-  - uid: 25231
-    components:
-    - type: Transform
-      pos: 58.5,-42.5
-      parent: 8364
-    - type: AtmosPipeColor
-      color: '#FF1212FF'
-  - uid: 25232
-    components:
-    - type: Transform
-      pos: 58.5,-43.5
-      parent: 8364
-    - type: AtmosPipeColor
-      color: '#FF1212FF'
   - uid: 25245
     components:
     - type: Transform
@@ -107741,34 +107138,6 @@ entities:
       parent: 8364
     - type: AtmosPipeColor
       color: '#0335FCFF'
-  - uid: 20636
-    components:
-    - type: Transform
-      pos: 60.5,-46.5
-      parent: 8364
-  - uid: 20637
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 60.5,-47.5
-      parent: 8364
-  - uid: 20638
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 60.5,-49.5
-      parent: 8364
-  - uid: 20639
-    components:
-    - type: Transform
-      pos: 62.5,-46.5
-      parent: 8364
-  - uid: 20673
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 62.5,-48.5
-      parent: 8364
   - uid: 20884
     components:
     - type: Transform
@@ -107784,22 +107153,6 @@ entities:
       parent: 8364
     - type: AtmosPipeColor
       color: '#0335FCFF'
-  - uid: 21351
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 56.5,-44.5
-      parent: 8364
-    - type: AtmosPipeColor
-      color: '#0335FCFF'
-  - uid: 21358
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 58.5,-44.5
-      parent: 8364
-    - type: AtmosPipeColor
-      color: '#FF1212FF'
   - uid: 21383
     components:
     - type: Transform
@@ -109554,22 +108907,6 @@ entities:
       parent: 8364
     - type: AtmosPipeColor
       color: '#0335FCFF'
-  - uid: 25225
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 58.5,-41.5
-      parent: 8364
-    - type: AtmosPipeColor
-      color: '#FF1212FF'
-  - uid: 25226
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 56.5,-40.5
-      parent: 8364
-    - type: AtmosPipeColor
-      color: '#0335FCFF'
   - uid: 25344
     components:
     - type: Transform
@@ -109880,22 +109217,6 @@ entities:
       parent: 8364
     - type: AtmosDevice
       joinedGrid: 8364
-  - uid: 2251
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 51.5,-45.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 2281
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 61.5,-53.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 3798
     components:
     - type: Transform
@@ -110094,38 +109415,6 @@ entities:
       parent: 8364
     - type: AtmosDevice
       joinedGrid: 8364
-  - uid: 20597
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 59.5,-53.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 20633
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 59.5,-46.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 20634
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 59.5,-47.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 20635
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 59.5,-49.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 20802
     components:
     - type: Transform
@@ -110141,22 +109430,6 @@ entities:
       parent: 8364
     - type: AtmosDevice
       joinedGrid: 8364
-  - uid: 21350
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 51.5,-43.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 21359
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 51.5,-44.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 24990
     components:
     - type: Transform
@@ -110240,29 +109513,6 @@ entities:
       parent: 8364
     - type: AtmosDevice
       joinedGrid: 8364
-  - uid: 26876
-    components:
-    - type: Transform
-      pos: 58.5,-47.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 26877
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 58.5,-49.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 26878
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 57.5,-48.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 27178
     components:
     - type: Transform
@@ -110511,45 +109761,6 @@ entities:
       joinedGrid: 8364
     - type: AtmosPipeColor
       color: '#03FCD3FF'
-  - uid: 20367
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 57.5,-51.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 20371
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 52.5,-43.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 20372
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 52.5,-44.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 20387
-    components:
-    - type: Transform
-      pos: 53.5,-46.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 20679
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 52.5,-45.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 22840
     components:
     - type: Transform
@@ -110635,13 +109846,6 @@ entities:
       parent: 8364
     - type: AtmosDevice
       joinedGrid: 8364
-  - uid: 21349
-    components:
-    - type: Transform
-      pos: 63.5,-45.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 21406
     components:
     - type: Transform
@@ -110695,13 +109899,6 @@ entities:
       parent: 8364
     - type: AtmosDevice
       joinedGrid: 8364
-  - uid: 21360
-    components:
-    - type: Transform
-      pos: 63.5,-47.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 21405
     components:
     - type: Transform
@@ -110773,15 +109970,6 @@ entities:
       open: False
     - type: AtmosDevice
       joinedGrid: 8364
-  - uid: 20668
-    components:
-    - type: Transform
-      pos: 60.5,-48.5
-      parent: 8364
-    - type: GasValve
-      open: False
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 22843
     components:
     - type: MetaData
@@ -110812,16 +110000,6 @@ entities:
       joinedGrid: 8364
 - proto: GasVentPump
   entities:
-  - uid: 2252
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 56.5,-45.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-    - type: AtmosPipeColor
-      color: '#0335FCFF'
   - uid: 4546
     components:
     - type: Transform
@@ -111017,16 +110195,6 @@ entities:
       joinedGrid: 8364
     - type: AtmosPipeColor
       color: '#0335FCFF'
-  - uid: 20368
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 55.5,-45.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-    - type: AtmosPipeColor
-      color: '#0335FCFF'
   - uid: 22458
     components:
     - type: Transform
@@ -111968,14 +111136,6 @@ entities:
       joinedGrid: 8364
     - type: AtmosPipeColor
       color: '#0335FCFF'
-  - uid: 25013
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 72.5,-41.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 25069
     components:
     - type: Transform
@@ -112813,26 +111973,6 @@ entities:
       joinedGrid: 8364
     - type: AtmosPipeColor
       color: '#FF1212FF'
-  - uid: 20658
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 59.5,-45.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-    - type: AtmosPipeColor
-      color: '#FF1212FF'
-  - uid: 20865
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 58.5,-45.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-    - type: AtmosPipeColor
-      color: '#FF1212FF'
   - uid: 22459
     components:
     - type: Transform
@@ -113785,14 +112925,6 @@ entities:
       joinedGrid: 8364
     - type: AtmosPipeColor
       color: '#FF1212FF'
-  - uid: 25012
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 72.5,-39.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 25035
     components:
     - type: Transform
@@ -114467,6 +113599,16 @@ entities:
     - type: Transform
       pos: 70.5,9.5
       parent: 8364
+  - uid: 1998
+    components:
+    - type: Transform
+      pos: 51.5,-50.5
+      parent: 8364
+  - uid: 2000
+    components:
+    - type: Transform
+      pos: 50.5,-55.5
+      parent: 8364
   - uid: 3226
     components:
     - type: Transform
@@ -114477,6 +113619,11 @@ entities:
     - type: Transform
       pos: -18.5,-42.5
       parent: 8364
+  - uid: 14696
+    components:
+    - type: Transform
+      pos: 55.5,-53.5
+      parent: 8364
 - proto: GravityGenerator
   entities:
   - uid: 17040
@@ -115711,56 +114858,6 @@ entities:
     - type: Transform
       pos: 42.5,-60.5
       parent: 8364
-  - uid: 2244
-    components:
-    - type: Transform
-      pos: 52.5,-58.5
-      parent: 8364
-  - uid: 2245
-    components:
-    - type: Transform
-      pos: 53.5,-58.5
-      parent: 8364
-  - uid: 2246
-    components:
-    - type: Transform
-      pos: 56.5,-58.5
-      parent: 8364
-  - uid: 2247
-    components:
-    - type: Transform
-      pos: 57.5,-58.5
-      parent: 8364
-  - uid: 2248
-    components:
-    - type: Transform
-      pos: 58.5,-58.5
-      parent: 8364
-  - uid: 2275
-    components:
-    - type: Transform
-      pos: 62.5,-58.5
-      parent: 8364
-  - uid: 2282
-    components:
-    - type: Transform
-      pos: 52.5,-47.5
-      parent: 8364
-  - uid: 2283
-    components:
-    - type: Transform
-      pos: 52.5,-51.5
-      parent: 8364
-  - uid: 2285
-    components:
-    - type: Transform
-      pos: 53.5,-47.5
-      parent: 8364
-  - uid: 2286
-    components:
-    - type: Transform
-      pos: 56.5,-51.5
-      parent: 8364
   - uid: 2305
     components:
     - type: Transform
@@ -115988,16 +115085,6 @@ entities:
     - type: Transform
       pos: 30.5,-15.5
       parent: 8364
-  - uid: 2580
-    components:
-    - type: Transform
-      pos: 56.5,-52.5
-      parent: 8364
-  - uid: 2581
-    components:
-    - type: Transform
-      pos: 54.5,-47.5
-      parent: 8364
   - uid: 2592
     components:
     - type: Transform
@@ -120234,6 +119321,26 @@ entities:
       rot: 1.5707963267948966 rad
       pos: -66.5,7.5
       parent: 8364
+  - uid: 13082
+    components:
+    - type: Transform
+      pos: 51.5,-56.5
+      parent: 8364
+  - uid: 13083
+    components:
+    - type: Transform
+      pos: 52.5,-56.5
+      parent: 8364
+  - uid: 13349
+    components:
+    - type: Transform
+      pos: 53.5,-56.5
+      parent: 8364
+  - uid: 13431
+    components:
+    - type: Transform
+      pos: 56.5,-56.5
+      parent: 8364
   - uid: 13491
     components:
     - type: Transform
@@ -121054,6 +120161,21 @@ entities:
     - type: Transform
       pos: 42.5,-46.5
       parent: 8364
+  - uid: 18570
+    components:
+    - type: Transform
+      pos: 58.5,-56.5
+      parent: 8364
+  - uid: 18572
+    components:
+    - type: Transform
+      pos: 57.5,-56.5
+      parent: 8364
+  - uid: 18573
+    components:
+    - type: Transform
+      pos: 62.5,-56.5
+      parent: 8364
   - uid: 18588
     components:
     - type: Transform
@@ -121065,6 +120187,16 @@ entities:
       rot: 3.141592653589793 rad
       pos: 10.5,-32.5
       parent: 8364
+  - uid: 18649
+    components:
+    - type: Transform
+      pos: 61.5,-56.5
+      parent: 8364
+  - uid: 18694
+    components:
+    - type: Transform
+      pos: 63.5,-56.5
+      parent: 8364
   - uid: 18787
     components:
     - type: Transform
@@ -121205,60 +120337,15 @@ entities:
     - type: Transform
       pos: 16.5,-49.5
       parent: 8364
-  - uid: 20393
-    components:
-    - type: Transform
-      pos: 23.5,-34.5
-      parent: 8364
-  - uid: 20644
-    components:
-    - type: Transform
-      pos: 57.5,-42.5
-      parent: 8364
-  - uid: 20661
-    components:
-    - type: Transform
-      pos: 53.5,-49.5
-      parent: 8364
-  - uid: 20665
-    components:
-    - type: Transform
-      pos: 56.5,-49.5
-      parent: 8364
-  - uid: 20666
-    components:
-    - type: Transform
-      pos: 54.5,-50.5
-      parent: 8364
-  - uid: 20689
-    components:
-    - type: Transform
-      pos: 56.5,-53.5
-      parent: 8364
-  - uid: 20690
-    components:
-    - type: Transform
-      pos: 55.5,-47.5
-      parent: 8364
-  - uid: 20695
-    components:
-    - type: Transform
-      pos: 61.5,-58.5
-      parent: 8364
-  - uid: 20696
-    components:
-    - type: Transform
-      pos: 63.5,-58.5
-      parent: 8364
-  - uid: 20867
+  - uid: 20386
     components:
     - type: Transform
-      pos: 56.5,-48.5
+      pos: 51.5,-60.5
       parent: 8364
-  - uid: 20868
+  - uid: 20393
     components:
     - type: Transform
-      pos: 56.5,-50.5
+      pos: 23.5,-34.5
       parent: 8364
   - uid: 21110
     components:
@@ -121295,21 +120382,6 @@ entities:
     - type: Transform
       pos: 51.5,-38.5
       parent: 8364
-  - uid: 21363
-    components:
-    - type: Transform
-      pos: 54.5,-51.5
-      parent: 8364
-  - uid: 21364
-    components:
-    - type: Transform
-      pos: 52.5,-50.5
-      parent: 8364
-  - uid: 21370
-    components:
-    - type: Transform
-      pos: 51.5,-47.5
-      parent: 8364
   - uid: 21375
     components:
     - type: Transform
@@ -125216,6 +124288,13 @@ entities:
     - type: Transform
       pos: -27.5,-15.5
       parent: 8364
+- proto: MaterialWoodPlank
+  entities:
+  - uid: 2613
+    components:
+    - type: Transform
+      pos: 62.54538,-43.95337
+      parent: 8364
 - proto: MaterialWoodPlank1
   entities:
   - uid: 13234
@@ -125525,6 +124604,11 @@ entities:
       parent: 8364
 - proto: MopItem
   entities:
+  - uid: 2283
+    components:
+    - type: Transform
+      pos: 57.61384,-49.32746
+      parent: 8364
   - uid: 14460
     components:
     - type: Transform
@@ -126360,6 +125444,43 @@ entities:
       parent: 8364
     - type: AtmosDevice
       joinedGrid: 8364
+- proto: OxygenTank
+  entities:
+  - uid: 21419
+    components:
+    - type: MetaData
+      name: empty tank
+    - type: Transform
+      pos: 79.5,-43.5
+      parent: 8364
+  - uid: 21420
+    components:
+    - type: MetaData
+      name: empty tank
+    - type: Transform
+      pos: 79.5,-43.5
+      parent: 8364
+  - uid: 21421
+    components:
+    - type: MetaData
+      name: empty tank
+    - type: Transform
+      pos: 79.5,-43.5
+      parent: 8364
+  - uid: 21422
+    components:
+    - type: MetaData
+      name: empty tank
+    - type: Transform
+      pos: 79.5,-43.5
+      parent: 8364
+  - uid: 21423
+    components:
+    - type: MetaData
+      name: empty tank
+    - type: Transform
+      pos: 79.5,-43.5
+      parent: 8364
 - proto: OxygenTankFilled
   entities:
   - uid: 20121
@@ -127736,16 +126857,6 @@ entities:
     - type: Transform
       pos: 14.5,-41.5
       parent: 8364
-  - uid: 20862
-    components:
-    - type: Transform
-      pos: 60.5,-55.5
-      parent: 8364
-  - uid: 20863
-    components:
-    - type: Transform
-      pos: 61.5,-55.5
-      parent: 8364
   - uid: 22577
     components:
     - type: Transform
@@ -128801,14 +127912,6 @@ entities:
     - type: Transform
       pos: 42.5,-22.5
       parent: 8364
-  - uid: 2259
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 51.5,-51.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
   - uid: 3215
     components:
     - type: Transform
@@ -130645,14 +129748,6 @@ entities:
       rot: 1.5707963267948966 rad
       pos: 11.5,-76.5
       parent: 8364
-  - uid: 20694
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 63.5,-45.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
   - uid: 20795
     components:
     - type: Transform
@@ -130891,22 +129986,6 @@ entities:
       parent: 8364
     - type: ApcPowerReceiver
       powerLoad: 0
-  - uid: 21379
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 63.5,-51.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
-  - uid: 21380
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 51.5,-45.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
   - uid: 21610
     components:
     - type: Transform
@@ -130990,14 +130069,6 @@ entities:
       parent: 8364
     - type: ApcPowerReceiver
       powerLoad: 0
-  - uid: 22542
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 55.5,-49.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
   - uid: 22711
     components:
     - type: Transform
@@ -131079,20 +130150,6 @@ entities:
       parent: 8364
     - type: ApcPowerReceiver
       powerLoad: 0
-  - uid: 25892
-    components:
-    - type: Transform
-      pos: 54.5,-43.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
-  - uid: 25893
-    components:
-    - type: Transform
-      pos: 61.5,-43.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
   - uid: 25920
     components:
     - type: Transform
@@ -131484,6 +130541,18 @@ entities:
     - type: Transform
       pos: 8.5,-80.5
       parent: 8364
+  - uid: 18473
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 54.5,-59.5
+      parent: 8364
+  - uid: 19324
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 60.5,-59.5
+      parent: 8364
   - uid: 21981
     components:
     - type: Transform
@@ -131561,13 +130630,6 @@ entities:
       rot: 3.141592653589793 rad
       pos: -9.5,-66.5
       parent: 8364
-  - uid: 3180
-    components:
-    - type: Transform
-      pos: 69.5,-59.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
   - uid: 3857
     components:
     - type: Transform
@@ -131634,6 +130696,12 @@ entities:
       parent: 8364
     - type: ApcPowerReceiver
       powerLoad: 0
+  - uid: 6460
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 53.5,-48.5
+      parent: 8364
   - uid: 6476
     components:
     - type: Transform
@@ -132563,22 +131631,6 @@ entities:
       parent: 8364
     - type: ApcPowerReceiver
       powerLoad: 0
-  - uid: 18570
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 49.5,-45.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
-  - uid: 18573
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 49.5,-62.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
   - uid: 18574
     components:
     - type: Transform
@@ -132624,6 +131676,12 @@ entities:
       parent: 8364
     - type: ApcPowerReceiver
       powerLoad: 0
+  - uid: 19044
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 58.5,-46.5
+      parent: 8364
   - uid: 19230
     components:
     - type: Transform
@@ -132667,14 +131725,6 @@ entities:
       parent: 8364
     - type: ApcPowerReceiver
       powerLoad: 0
-  - uid: 19975
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 78.5,-64.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
   - uid: 19977
     components:
     - type: Transform
@@ -132683,38 +131733,6 @@ entities:
       parent: 8364
     - type: ApcPowerReceiver
       powerLoad: 0
-  - uid: 19978
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 65.5,-65.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
-  - uid: 19979
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 65.5,-71.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
-  - uid: 19980
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 72.5,-68.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
-  - uid: 19981
-    components:
-    - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 70.5,-56.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
   - uid: 19982
     components:
     - type: Transform
@@ -132813,14 +131831,6 @@ entities:
       parent: 8364
     - type: ApcPowerReceiver
       powerLoad: 0
-  - uid: 21378
-    components:
-    - type: Transform
-      rot: 1.5707963267948966 rad
-      pos: 52.5,-56.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
   - uid: 21388
     components:
     - type: Transform
@@ -132828,22 +131838,6 @@ entities:
       parent: 8364
     - type: ApcPowerReceiver
       powerLoad: 0
-  - uid: 22527
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 55.5,-57.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
-  - uid: 22528
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 60.5,-57.5
-      parent: 8364
-    - type: ApcPowerReceiver
-      powerLoad: 0
   - uid: 22925
     components:
     - type: Transform
@@ -133148,10 +132142,15 @@ entities:
       rot: -1.5707963267948966 rad
       pos: 36.5,-46.5
       parent: 8364
-  - uid: 2389
+  - uid: 2388
     components:
     - type: Transform
-      pos: 59.5,-55.5
+      pos: 51.5,-43.5
+      parent: 8364
+  - uid: 2571
+    components:
+    - type: Transform
+      pos: 55.5,-51.5
       parent: 8364
   - uid: 4579
     components:
@@ -133168,11 +132167,6 @@ entities:
     - type: Transform
       pos: 44.5,-40.5
       parent: 8364
-  - uid: 5476
-    components:
-    - type: Transform
-      pos: 50.5,-55.5
-      parent: 8364
   - uid: 6265
     components:
     - type: Transform
@@ -133578,11 +132572,6 @@ entities:
     - type: Transform
       pos: 72.5,-35.5
       parent: 8364
-  - uid: 21353
-    components:
-    - type: Transform
-      pos: 55.5,-43.5
-      parent: 8364
   - uid: 21389
     components:
     - type: Transform
@@ -133776,6 +132765,12 @@ entities:
       rot: 1.5707963267948966 rad
       pos: 42.5,-73.5
       parent: 8364
+  - uid: 2289
+    components:
+    - type: Transform
+      rot: -1.5707963267948966 rad
+      pos: 42.5,-0.5
+      parent: 8364
   - uid: 10566
     components:
     - type: Transform
@@ -133847,6 +132842,12 @@ entities:
       parent: 8364
 - proto: RailingCornerSmall
   entities:
+  - uid: 2387
+    components:
+    - type: Transform
+      rot: 1.5707963267948966 rad
+      pos: 42.5,0.5
+      parent: 8364
   - uid: 21211
     components:
     - type: Transform
@@ -133993,6 +132994,16 @@ entities:
       parent: 8364
 - proto: RandomPosterAny
   entities:
+  - uid: 2287
+    components:
+    - type: Transform
+      pos: 52.5,-48.5
+      parent: 8364
+  - uid: 2290
+    components:
+    - type: Transform
+      pos: 61.5,-44.5
+      parent: 8364
   - uid: 6613
     components:
     - type: Transform
@@ -134297,6 +133308,21 @@ entities:
       parent: 8364
 - proto: RandomPosterLegit
   entities:
+  - uid: 2024
+    components:
+    - type: Transform
+      pos: 64.5,-51.5
+      parent: 8364
+  - uid: 2263
+    components:
+    - type: Transform
+      pos: 50.5,-44.5
+      parent: 8364
+  - uid: 2286
+    components:
+    - type: Transform
+      pos: 58.5,-42.5
+      parent: 8364
   - uid: 8469
     components:
     - type: Transform
@@ -135006,6 +134032,23 @@ entities:
     - type: Transform
       pos: -12.5,47.5
       parent: 8364
+- proto: RandomSpawner100
+  entities:
+  - uid: 2249
+    components:
+    - type: Transform
+      pos: 51.5,-51.5
+      parent: 8364
+  - uid: 2264
+    components:
+    - type: Transform
+      pos: 55.5,-55.5
+      parent: 8364
+  - uid: 2270
+    components:
+    - type: Transform
+      pos: 63.5,-54.5
+      parent: 8364
 - proto: RandomVending
   entities:
   - uid: 1528
@@ -135134,16 +134177,6 @@ entities:
       - 13893
 - proto: ReinforcedPlasmaWindow
   entities:
-  - uid: 2277
-    components:
-    - type: Transform
-      pos: 52.5,-50.5
-      parent: 8364
-  - uid: 2284
-    components:
-    - type: Transform
-      pos: 54.5,-51.5
-      parent: 8364
   - uid: 3494
     components:
     - type: Transform
@@ -135244,21 +134277,6 @@ entities:
     - type: Transform
       pos: 17.5,-50.5
       parent: 8364
-  - uid: 20662
-    components:
-    - type: Transform
-      pos: 54.5,-50.5
-      parent: 8364
-  - uid: 20681
-    components:
-    - type: Transform
-      pos: 52.5,-51.5
-      parent: 8364
-  - uid: 21362
-    components:
-    - type: Transform
-      pos: 53.5,-49.5
-      parent: 8364
   - uid: 22737
     components:
     - type: Transform
@@ -136392,21 +135410,6 @@ entities:
     - type: Transform
       pos: 23.5,-18.5
       parent: 8364
-  - uid: 2278
-    components:
-    - type: Transform
-      pos: 53.5,-47.5
-      parent: 8364
-  - uid: 2287
-    components:
-    - type: Transform
-      pos: 54.5,-47.5
-      parent: 8364
-  - uid: 2288
-    components:
-    - type: Transform
-      pos: 56.5,-52.5
-      parent: 8364
   - uid: 2493
     components:
     - type: Transform
@@ -136427,41 +135430,6 @@ entities:
     - type: Transform
       pos: 38.5,-40.5
       parent: 8364
-  - uid: 2570
-    components:
-    - type: Transform
-      pos: 52.5,-58.5
-      parent: 8364
-  - uid: 2571
-    components:
-    - type: Transform
-      pos: 53.5,-58.5
-      parent: 8364
-  - uid: 2573
-    components:
-    - type: Transform
-      pos: 56.5,-58.5
-      parent: 8364
-  - uid: 2574
-    components:
-    - type: Transform
-      pos: 57.5,-58.5
-      parent: 8364
-  - uid: 2575
-    components:
-    - type: Transform
-      pos: 58.5,-58.5
-      parent: 8364
-  - uid: 2578
-    components:
-    - type: Transform
-      pos: 56.5,-53.5
-      parent: 8364
-  - uid: 2579
-    components:
-    - type: Transform
-      pos: 55.5,-47.5
-      parent: 8364
   - uid: 2594
     components:
     - type: Transform
@@ -139309,6 +138277,26 @@ entities:
     - type: Transform
       pos: 27.5,-68.5
       parent: 8364
+  - uid: 12681
+    components:
+    - type: Transform
+      pos: 51.5,-60.5
+      parent: 8364
+  - uid: 12788
+    components:
+    - type: Transform
+      pos: 53.5,-56.5
+      parent: 8364
+  - uid: 13065
+    components:
+    - type: Transform
+      pos: 52.5,-56.5
+      parent: 8364
+  - uid: 13081
+    components:
+    - type: Transform
+      pos: 56.5,-56.5
+      parent: 8364
   - uid: 13149
     components:
     - type: Transform
@@ -139616,86 +138604,71 @@ entities:
     - type: Transform
       pos: 75.5,5.5
       parent: 8364
-  - uid: 19955
+  - uid: 19943
     components:
     - type: Transform
-      pos: 3.5,-58.5
+      pos: 57.5,-56.5
       parent: 8364
-  - uid: 20003
+  - uid: 19945
     components:
     - type: Transform
-      pos: -5.5,-19.5
+      pos: 63.5,-56.5
       parent: 8364
-  - uid: 20055
+  - uid: 19955
     components:
     - type: Transform
-      pos: 5.5,-58.5
+      pos: 3.5,-58.5
       parent: 8364
-  - uid: 20065
+  - uid: 19975
     components:
     - type: Transform
-      pos: 2.5,-64.5
+      pos: 58.5,-56.5
       parent: 8364
-  - uid: 20139
+  - uid: 19978
     components:
     - type: Transform
-      pos: -0.5,-65.5
+      pos: 61.5,-56.5
       parent: 8364
-  - uid: 20196
+  - uid: 20003
     components:
     - type: Transform
-      pos: 69.5,-16.5
+      pos: -5.5,-19.5
       parent: 8364
-  - uid: 20653
+  - uid: 20055
     components:
     - type: Transform
-      pos: 57.5,-42.5
+      pos: 5.5,-58.5
       parent: 8364
-  - uid: 20680
+  - uid: 20065
     components:
     - type: Transform
-      pos: 56.5,-50.5
+      pos: 2.5,-64.5
       parent: 8364
-  - uid: 20683
+  - uid: 20139
     components:
     - type: Transform
-      pos: 56.5,-48.5
+      pos: -0.5,-65.5
       parent: 8364
-  - uid: 20869
+  - uid: 20196
     components:
     - type: Transform
-      pos: 51.5,-47.5
+      pos: 69.5,-16.5
       parent: 8364
-  - uid: 20870
+  - uid: 20370
     components:
     - type: Transform
-      pos: 56.5,-49.5
+      pos: 51.5,-56.5
       parent: 8364
-  - uid: 20871
+  - uid: 20382
     components:
     - type: Transform
-      pos: 56.5,-51.5
+      pos: 62.5,-56.5
       parent: 8364
   - uid: 20872
     components:
     - type: Transform
       pos: 64.5,-39.5
       parent: 8364
-  - uid: 20875
-    components:
-    - type: Transform
-      pos: 63.5,-58.5
-      parent: 8364
-  - uid: 20876
-    components:
-    - type: Transform
-      pos: 62.5,-58.5
-      parent: 8364
-  - uid: 20877
-    components:
-    - type: Transform
-      pos: 61.5,-58.5
-      parent: 8364
   - uid: 21186
     components:
     - type: Transform
@@ -139708,11 +138681,6 @@ entities:
       rot: 1.5707963267948966 rad
       pos: 72.5,-42.5
       parent: 8364
-  - uid: 21371
-    components:
-    - type: Transform
-      pos: 52.5,-47.5
-      parent: 8364
   - uid: 21372
     components:
     - type: Transform
@@ -140233,6 +139201,11 @@ entities:
       parent: 8364
 - proto: Screwdriver
   entities:
+  - uid: 2261
+    components:
+    - type: Transform
+      pos: 59.397083,-51.321266
+      parent: 8364
   - uid: 12258
     components:
     - type: Transform
@@ -140285,6 +139258,11 @@ entities:
       parent: 8364
 - proto: ShardGlass
   entities:
+  - uid: 2285
+    components:
+    - type: Transform
+      pos: 60.52009,-47.51496
+      parent: 8364
   - uid: 25947
     components:
     - type: Transform
@@ -140433,6 +139411,23 @@ entities:
     - type: Transform
       pos: -24.410706,-71.44174
       parent: 8364
+- proto: SheetPlasma1
+  entities:
+  - uid: 2615
+    components:
+    - type: Transform
+      pos: 57.348213,-49.249336
+      parent: 8364
+  - uid: 2616
+    components:
+    - type: Transform
+      pos: 57.348213,-49.249336
+      parent: 8364
+  - uid: 3180
+    components:
+    - type: Transform
+      pos: 57.348213,-49.249336
+      parent: 8364
 - proto: SheetPlasteel
   entities:
   - uid: 4582
@@ -140506,11 +139501,6 @@ entities:
     - type: Transform
       pos: -51.5538,-4.6965327
       parent: 8364
-  - uid: 2249
-    components:
-    - type: Transform
-      pos: 60.60743,-43.443428
-      parent: 8364
   - uid: 4698
     components:
     - type: Transform
@@ -141828,15 +140818,6 @@ entities:
         - Pressed: Toggle
         17676:
         - Pressed: Toggle
-  - uid: 20866
-    components:
-    - type: Transform
-      pos: 56.5,-47.5
-      parent: 8364
-    - type: DeviceLinkSource
-      linkedPorts:
-        20667:
-        - Pressed: Toggle
   - uid: 20896
     components:
     - type: Transform
@@ -142669,6 +141650,14 @@ entities:
       parent: 8364
 - proto: SignKiddiePlaque
   entities:
+  - uid: 2001
+    components:
+    - type: MetaData
+      desc: A sign showing Bungle Town's permit to operate on this station.
+      name: Bungle Town
+    - type: Transform
+      pos: 56.5,-51.5
+      parent: 8364
   - uid: 5749
     components:
     - type: Transform
@@ -145940,6 +144929,12 @@ entities:
     - type: Transform
       pos: 2.5,-59.5
       parent: 8364
+  - uid: 5476
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 53.5,-49.5
+      parent: 8364
   - uid: 5878
     components:
     - type: Transform
@@ -146309,20 +145304,6 @@ entities:
       parent: 8364
 - proto: StorageCanister
   entities:
-  - uid: 2257
-    components:
-    - type: Transform
-      pos: 63.5,-55.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 2263
-    components:
-    - type: Transform
-      pos: 52.5,-57.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 3790
     components:
     - type: Transform
@@ -146344,34 +145325,6 @@ entities:
       parent: 8364
     - type: AtmosDevice
       joinedGrid: 8364
-  - uid: 20365
-    components:
-    - type: Transform
-      pos: 62.5,-55.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 20939
-    components:
-    - type: Transform
-      pos: 63.5,-52.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 20984
-    components:
-    - type: Transform
-      pos: 63.5,-51.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
-  - uid: 20985
-    components:
-    - type: Transform
-      pos: 63.5,-53.5
-      parent: 8364
-    - type: AtmosDevice
-      joinedGrid: 8364
   - uid: 21424
     components:
     - type: Transform
@@ -147688,7 +146641,22 @@ entities:
   - uid: 2002
     components:
     - type: Transform
-      pos: 57.5,-57.5
+      pos: 58.5,-49.5
+      parent: 8364
+  - uid: 2003
+    components:
+    - type: Transform
+      pos: 60.5,-49.5
+      parent: 8364
+  - uid: 2005
+    components:
+    - type: Transform
+      pos: 59.5,-49.5
+      parent: 8364
+  - uid: 2006
+    components:
+    - type: Transform
+      pos: 57.5,-49.5
       parent: 8364
   - uid: 2036
     components:
@@ -147698,13 +146666,23 @@ entities:
   - uid: 2258
     components:
     - type: Transform
-      pos: 58.5,-55.5
+      pos: 59.5,-51.5
+      parent: 8364
+  - uid: 2269
+    components:
+    - type: Transform
+      pos: 58.5,-51.5
       parent: 8364
   - uid: 2347
     components:
     - type: Transform
       pos: 41.5,-29.5
       parent: 8364
+  - uid: 2536
+    components:
+    - type: Transform
+      pos: 53.5,-48.5
+      parent: 8364
   - uid: 2553
     components:
     - type: Transform
@@ -148896,21 +147874,6 @@ entities:
     - type: Transform
       pos: 64.5,-23.5
       parent: 8364
-  - uid: 20275
-    components:
-    - type: Transform
-      pos: 62.5,-43.5
-      parent: 8364
-  - uid: 20379
-    components:
-    - type: Transform
-      pos: 60.5,-43.5
-      parent: 8364
-  - uid: 20380
-    components:
-    - type: Transform
-      pos: 61.5,-43.5
-      parent: 8364
   - uid: 20390
     components:
     - type: Transform
@@ -151564,6 +150527,11 @@ entities:
       parent: 8364
 - proto: trayScanner
   entities:
+  - uid: 2389
+    components:
+    - type: Transform
+      pos: 51.56124,-43.44272
+      parent: 8364
   - uid: 12266
     components:
     - type: Transform
@@ -152247,11 +151215,6 @@ entities:
       parent: 8364
 - proto: VendingMachineTankDispenserEVA
   entities:
-  - uid: 2008
-    components:
-    - type: Transform
-      pos: 55.5,-55.5
-      parent: 8364
   - uid: 5507
     components:
     - type: Transform
@@ -152695,11 +151658,6 @@ entities:
     - type: Transform
       pos: -29.5,2.5
       parent: 8364
-  - uid: 224
-    components:
-    - type: Transform
-      pos: 61.5,-54.5
-      parent: 8364
   - uid: 239
     components:
     - type: Transform
@@ -154392,36 +153350,6 @@ entities:
     - type: Transform
       pos: 39.5,-54.5
       parent: 8364
-  - uid: 1997
-    components:
-    - type: Transform
-      pos: 51.5,-58.5
-      parent: 8364
-  - uid: 1998
-    components:
-    - type: Transform
-      pos: 50.5,-58.5
-      parent: 8364
-  - uid: 1999
-    components:
-    - type: Transform
-      pos: 54.5,-58.5
-      parent: 8364
-  - uid: 2000
-    components:
-    - type: Transform
-      pos: 55.5,-58.5
-      parent: 8364
-  - uid: 2001
-    components:
-    - type: Transform
-      pos: 59.5,-58.5
-      parent: 8364
-  - uid: 2009
-    components:
-    - type: Transform
-      pos: 64.5,-55.5
-      parent: 8364
   - uid: 2011
     components:
     - type: Transform
@@ -154442,76 +153370,6 @@ entities:
     - type: Transform
       pos: 64.5,-50.5
       parent: 8364
-  - uid: 2017
-    components:
-    - type: Transform
-      pos: 51.5,-56.5
-      parent: 8364
-  - uid: 2018
-    components:
-    - type: Transform
-      pos: 50.5,-54.5
-      parent: 8364
-  - uid: 2019
-    components:
-    - type: Transform
-      pos: 50.5,-53.5
-      parent: 8364
-  - uid: 2020
-    components:
-    - type: Transform
-      pos: 50.5,-52.5
-      parent: 8364
-  - uid: 2021
-    components:
-    - type: Transform
-      pos: 50.5,-51.5
-      parent: 8364
-  - uid: 2022
-    components:
-    - type: Transform
-      pos: 50.5,-50.5
-      parent: 8364
-  - uid: 2023
-    components:
-    - type: Transform
-      pos: 50.5,-49.5
-      parent: 8364
-  - uid: 2024
-    components:
-    - type: Transform
-      pos: 50.5,-48.5
-      parent: 8364
-  - uid: 2025
-    components:
-    - type: Transform
-      pos: 50.5,-47.5
-      parent: 8364
-  - uid: 2026
-    components:
-    - type: Transform
-      pos: 50.5,-46.5
-      parent: 8364
-  - uid: 2027
-    components:
-    - type: Transform
-      pos: 50.5,-45.5
-      parent: 8364
-  - uid: 2028
-    components:
-    - type: Transform
-      pos: 50.5,-44.5
-      parent: 8364
-  - uid: 2029
-    components:
-    - type: Transform
-      pos: 50.5,-43.5
-      parent: 8364
-  - uid: 2030
-    components:
-    - type: Transform
-      pos: 50.5,-42.5
-      parent: 8364
   - uid: 2044
     components:
     - type: Transform
@@ -155222,20 +154080,45 @@ entities:
     - type: Transform
       pos: 67.5,20.5
       parent: 8364
-  - uid: 2268
+  - uid: 2245
     components:
     - type: Transform
-      pos: 54.5,-42.5
+      pos: 55.5,-56.5
       parent: 8364
-  - uid: 2276
+  - uid: 2246
     components:
     - type: Transform
-      pos: 52.5,-52.5
+      pos: 54.5,-56.5
+      parent: 8364
+  - uid: 2247
+    components:
+    - type: Transform
+      pos: 50.5,-58.5
+      parent: 8364
+  - uid: 2252
+    components:
+    - type: Transform
+      pos: 50.5,-57.5
+      parent: 8364
+  - uid: 2253
+    components:
+    - type: Transform
+      pos: 50.5,-56.5
+      parent: 8364
+  - uid: 2278
+    components:
+    - type: Transform
+      pos: 60.5,-56.5
+      parent: 8364
+  - uid: 2279
+    components:
+    - type: Transform
+      pos: 59.5,-56.5
       parent: 8364
   - uid: 2280
     components:
     - type: Transform
-      pos: 54.5,-49.5
+      pos: 64.5,-56.5
       parent: 8364
   - uid: 2291
     components:
@@ -155382,16 +154265,6 @@ entities:
     - type: Transform
       pos: 75.5,-26.5
       parent: 8364
-  - uid: 2387
-    components:
-    - type: Transform
-      pos: 59.5,-54.5
-      parent: 8364
-  - uid: 2388
-    components:
-    - type: Transform
-      pos: 60.5,-54.5
-      parent: 8364
   - uid: 2408
     components:
     - type: Transform
@@ -155542,11 +154415,6 @@ entities:
     - type: Transform
       pos: 65.5,-54.5
       parent: 8364
-  - uid: 2615
-    components:
-    - type: Transform
-      pos: 52.5,-49.5
-      parent: 8364
   - uid: 2631
     components:
     - type: Transform
@@ -157857,11 +156725,6 @@ entities:
     - type: Transform
       pos: -55.5,-19.5
       parent: 8364
-  - uid: 4245
-    components:
-    - type: Transform
-      pos: 64.5,-57.5
-      parent: 8364
   - uid: 4246
     components:
     - type: Transform
@@ -157967,11 +156830,6 @@ entities:
     - type: Transform
       pos: 35.5,-90.5
       parent: 8364
-  - uid: 4269
-    components:
-    - type: Transform
-      pos: 51.5,-55.5
-      parent: 8364
   - uid: 4270
     components:
     - type: Transform
@@ -158943,11 +157801,6 @@ entities:
     - type: Transform
       pos: 54.5,-60.5
       parent: 8364
-  - uid: 4656
-    components:
-    - type: Transform
-      pos: 51.5,-60.5
-      parent: 8364
   - uid: 4658
     components:
     - type: Transform
@@ -159513,11 +158366,6 @@ entities:
     - type: Transform
       pos: 2.5,-24.5
       parent: 8364
-  - uid: 5237
-    components:
-    - type: Transform
-      pos: 54.5,-55.5
-      parent: 8364
   - uid: 5245
     components:
     - type: Transform
@@ -159548,11 +158396,6 @@ entities:
     - type: Transform
       pos: 2.5,-26.5
       parent: 8364
-  - uid: 5294
-    components:
-    - type: Transform
-      pos: 54.5,-57.5
-      parent: 8364
   - uid: 5501
     components:
     - type: Transform
@@ -159738,11 +158581,6 @@ entities:
     - type: Transform
       pos: -42.5,-29.5
       parent: 8364
-  - uid: 6460
-    components:
-    - type: Transform
-      pos: 51.5,-57.5
-      parent: 8364
   - uid: 6494
     components:
     - type: Transform
@@ -162327,6 +161165,11 @@ entities:
     - type: Transform
       pos: -29.5,-23.5
       parent: 8364
+  - uid: 19944
+    components:
+    - type: Transform
+      pos: 64.5,-57.5
+      parent: 8364
   - uid: 19947
     components:
     - type: Transform
@@ -162377,111 +161220,11 @@ entities:
     - type: Transform
       pos: 17.5,-53.5
       parent: 8364
-  - uid: 20220
-    components:
-    - type: Transform
-      pos: 61.5,-42.5
-      parent: 8364
-  - uid: 20221
-    components:
-    - type: Transform
-      pos: 62.5,-42.5
-      parent: 8364
-  - uid: 20222
-    components:
-    - type: Transform
-      pos: 58.5,-54.5
-      parent: 8364
-  - uid: 20272
-    components:
-    - type: Transform
-      pos: 53.5,-42.5
-      parent: 8364
-  - uid: 20369
-    components:
-    - type: Transform
-      pos: 52.5,-42.5
-      parent: 8364
-  - uid: 20370
-    components:
-    - type: Transform
-      pos: 55.5,-42.5
-      parent: 8364
-  - uid: 20385
-    components:
-    - type: Transform
-      pos: 60.5,-42.5
-      parent: 8364
-  - uid: 20386
-    components:
-    - type: Transform
-      pos: 63.5,-42.5
-      parent: 8364
-  - uid: 20682
-    components:
-    - type: Transform
-      pos: 54.5,-52.5
-      parent: 8364
-  - uid: 20684
-    components:
-    - type: Transform
-      pos: 56.5,-47.5
-      parent: 8364
-  - uid: 20798
-    components:
-    - type: Transform
-      pos: 62.5,-54.5
-      parent: 8364
-  - uid: 20873
-    components:
-    - type: Transform
-      pos: 60.5,-58.5
-      parent: 8364
-  - uid: 20874
-    components:
-    - type: Transform
-      pos: 63.5,-54.5
-      parent: 8364
-  - uid: 20878
-    components:
-    - type: Transform
-      pos: 51.5,-42.5
-      parent: 8364
   - uid: 21284
     components:
     - type: Transform
       pos: -29.5,-24.5
       parent: 8364
-  - uid: 21336
-    components:
-    - type: Transform
-      pos: 56.5,-54.5
-      parent: 8364
-  - uid: 21344
-    components:
-    - type: Transform
-      pos: 51.5,-54.5
-      parent: 8364
-  - uid: 21345
-    components:
-    - type: Transform
-      pos: 52.5,-54.5
-      parent: 8364
-  - uid: 21347
-    components:
-    - type: Transform
-      pos: 55.5,-54.5
-      parent: 8364
-  - uid: 21348
-    components:
-    - type: Transform
-      pos: 54.5,-54.5
-      parent: 8364
-  - uid: 21361
-    components:
-    - type: Transform
-      pos: 59.5,-42.5
-      parent: 8364
   - uid: 21460
     components:
     - type: Transform
@@ -163285,6 +162028,11 @@ entities:
     - type: Transform
       pos: -58.5,6.5
       parent: 8364
+  - uid: 224
+    components:
+    - type: Transform
+      pos: 53.5,-50.5
+      parent: 8364
   - uid: 229
     components:
     - type: Transform
@@ -164270,6 +163018,11 @@ entities:
     - type: Transform
       pos: 55.5,11.5
       parent: 8364
+  - uid: 916
+    components:
+    - type: Transform
+      pos: 56.5,-53.5
+      parent: 8364
   - uid: 919
     components:
     - type: Transform
@@ -166235,6 +164988,21 @@ entities:
     - type: Transform
       pos: 67.5,-58.5
       parent: 8364
+  - uid: 2026
+    components:
+    - type: Transform
+      pos: 50.5,-43.5
+      parent: 8364
+  - uid: 2027
+    components:
+    - type: Transform
+      pos: 50.5,-44.5
+      parent: 8364
+  - uid: 2028
+    components:
+    - type: Transform
+      pos: 50.5,-45.5
+      parent: 8364
   - uid: 2031
     components:
     - type: Transform
@@ -166310,6 +165078,11 @@ entities:
     - type: Transform
       pos: 53.5,-38.5
       parent: 8364
+  - uid: 2267
+    components:
+    - type: Transform
+      pos: 54.5,-50.5
+      parent: 8364
   - uid: 2308
     components:
     - type: Transform
@@ -166750,6 +165523,11 @@ entities:
     - type: Transform
       pos: 40.5,-17.5
       parent: 8364
+  - uid: 2537
+    components:
+    - type: Transform
+      pos: 60.5,-42.5
+      parent: 8364
   - uid: 2540
     components:
     - type: Transform
@@ -166785,11 +165563,31 @@ entities:
     - type: Transform
       pos: 48.5,-17.5
       parent: 8364
+  - uid: 2570
+    components:
+    - type: Transform
+      pos: 59.5,-42.5
+      parent: 8364
   - uid: 2572
     components:
     - type: Transform
       pos: 55.5,-38.5
       parent: 8364
+  - uid: 2573
+    components:
+    - type: Transform
+      pos: 58.5,-53.5
+      parent: 8364
+  - uid: 2574
+    components:
+    - type: Transform
+      pos: 63.5,-53.5
+      parent: 8364
+  - uid: 2575
+    components:
+    - type: Transform
+      pos: 55.5,-50.5
+      parent: 8364
   - uid: 2632
     components:
     - type: Transform
@@ -168195,6 +166993,11 @@ entities:
     - type: Transform
       pos: 31.5,-94.5
       parent: 8364
+  - uid: 4656
+    components:
+    - type: Transform
+      pos: 62.5,-53.5
+      parent: 8364
   - uid: 4931
     components:
     - type: Transform
@@ -168210,6 +167013,11 @@ entities:
     - type: Transform
       pos: -17.5,12.5
       parent: 8364
+  - uid: 5294
+    components:
+    - type: Transform
+      pos: 60.5,-53.5
+      parent: 8364
   - uid: 6267
     components:
     - type: Transform
@@ -169865,6 +168673,11 @@ entities:
     - type: Transform
       pos: 17.5,-2.5
       parent: 8364
+  - uid: 13090
+    components:
+    - type: Transform
+      pos: 56.5,-51.5
+      parent: 8364
   - uid: 13148
     components:
     - type: Transform
@@ -170120,6 +168933,11 @@ entities:
     - type: Transform
       pos: -3.5,-58.5
       parent: 8364
+  - uid: 16367
+    components:
+    - type: Transform
+      pos: 56.5,-48.5
+      parent: 8364
   - uid: 16505
     components:
     - type: Transform
@@ -170310,6 +169128,11 @@ entities:
     - type: Transform
       pos: 34.5,-33.5
       parent: 8364
+  - uid: 18286
+    components:
+    - type: Transform
+      pos: 61.5,-44.5
+      parent: 8364
   - uid: 18331
     components:
     - type: Transform
@@ -170320,6 +169143,36 @@ entities:
     - type: Transform
       pos: 19.5,-37.5
       parent: 8364
+  - uid: 18472
+    components:
+    - type: Transform
+      pos: 56.5,-50.5
+      parent: 8364
+  - uid: 18506
+    components:
+    - type: Transform
+      pos: 61.5,-43.5
+      parent: 8364
+  - uid: 18507
+    components:
+    - type: Transform
+      pos: 61.5,-45.5
+      parent: 8364
+  - uid: 18525
+    components:
+    - type: Transform
+      pos: 61.5,-47.5
+      parent: 8364
+  - uid: 18539
+    components:
+    - type: Transform
+      pos: 61.5,-46.5
+      parent: 8364
+  - uid: 18540
+    components:
+    - type: Transform
+      pos: 58.5,-42.5
+      parent: 8364
   - uid: 18567
     components:
     - type: Transform
@@ -170360,6 +169213,11 @@ entities:
     - type: Transform
       pos: 6.5,-71.5
       parent: 8364
+  - uid: 19213
+    components:
+    - type: Transform
+      pos: 61.5,-49.5
+      parent: 8364
   - uid: 19217
     components:
     - type: Transform
@@ -170380,11 +169238,26 @@ entities:
     - type: Transform
       pos: 50.5,-61.5
       parent: 8364
+  - uid: 19866
+    components:
+    - type: Transform
+      pos: 61.5,-48.5
+      parent: 8364
   - uid: 19971
     components:
     - type: Transform
       pos: 15.5,-33.5
       parent: 8364
+  - uid: 19980
+    components:
+    - type: Transform
+      pos: 55.5,-42.5
+      parent: 8364
+  - uid: 19981
+    components:
+    - type: Transform
+      pos: 57.5,-42.5
+      parent: 8364
   - uid: 20013
     components:
     - type: Transform
@@ -170400,6 +169273,126 @@ entities:
     - type: Transform
       pos: -2.5,-48.5
       parent: 8364
+  - uid: 20187
+    components:
+    - type: Transform
+      pos: 52.5,-42.5
+      parent: 8364
+  - uid: 20217
+    components:
+    - type: Transform
+      pos: 51.5,-42.5
+      parent: 8364
+  - uid: 20219
+    components:
+    - type: Transform
+      pos: 50.5,-42.5
+      parent: 8364
+  - uid: 20220
+    components:
+    - type: Transform
+      pos: 63.5,-49.5
+      parent: 8364
+  - uid: 20221
+    components:
+    - type: Transform
+      pos: 62.5,-49.5
+      parent: 8364
+  - uid: 20222
+    components:
+    - type: Transform
+      pos: 60.5,-46.5
+      parent: 8364
+  - uid: 20272
+    components:
+    - type: Transform
+      pos: 59.5,-46.5
+      parent: 8364
+  - uid: 20273
+    components:
+    - type: Transform
+      pos: 56.5,-43.5
+      parent: 8364
+  - uid: 20274
+    components:
+    - type: Transform
+      pos: 56.5,-49.5
+      parent: 8364
+  - uid: 20275
+    components:
+    - type: Transform
+      pos: 56.5,-47.5
+      parent: 8364
+  - uid: 20365
+    components:
+    - type: Transform
+      pos: 56.5,-45.5
+      parent: 8364
+  - uid: 20366
+    components:
+    - type: Transform
+      pos: 56.5,-44.5
+      parent: 8364
+  - uid: 20367
+    components:
+    - type: Transform
+      pos: 52.5,-47.5
+      parent: 8364
+  - uid: 20369
+    components:
+    - type: Transform
+      pos: 54.5,-42.5
+      parent: 8364
+  - uid: 20371
+    components:
+    - type: Transform
+      pos: 56.5,-42.5
+      parent: 8364
+  - uid: 20372
+    components:
+    - type: Transform
+      pos: 63.5,-42.5
+      parent: 8364
+  - uid: 20376
+    components:
+    - type: Transform
+      pos: 62.5,-42.5
+      parent: 8364
+  - uid: 20377
+    components:
+    - type: Transform
+      pos: 52.5,-48.5
+      parent: 8364
+  - uid: 20378
+    components:
+    - type: Transform
+      pos: 52.5,-50.5
+      parent: 8364
+  - uid: 20379
+    components:
+    - type: Transform
+      pos: 52.5,-46.5
+      parent: 8364
+  - uid: 20381
+    components:
+    - type: Transform
+      pos: 61.5,-42.5
+      parent: 8364
+  - uid: 20383
+    components:
+    - type: Transform
+      pos: 52.5,-49.5
+      parent: 8364
+  - uid: 20384
+    components:
+    - type: Transform
+      pos: 53.5,-42.5
+      parent: 8364
+  - uid: 20385
+    components:
+    - type: Transform
+      pos: 50.5,-46.5
+      parent: 8364
   - uid: 20691
     components:
     - type: Transform
@@ -171030,6 +170023,13 @@ entities:
         - 0
         - 0
         - 0
+- proto: WardrobeBlueFilled
+  entities:
+  - uid: 16368
+    components:
+    - type: Transform
+      pos: 54.5,-43.5
+      parent: 8364
 - proto: WardrobeCargoFilled
   entities:
   - uid: 27602
@@ -171671,6 +170671,11 @@ entities:
       location: starboard quarter
 - proto: WaterCooler
   entities:
+  - uid: 2022
+    components:
+    - type: Transform
+      pos: 63.5,-50.5
+      parent: 8364
   - uid: 5522
     components:
     - type: Transform
@@ -172119,13 +171124,6 @@ entities:
     - type: Transform
       pos: 10.537883,-49.512733
       parent: 8364
-- proto: WelderMini
-  entities:
-  - uid: 2006
-    components:
-    - type: Transform
-      pos: 59.545315,-55.38308
-      parent: 8364
 - proto: WeldingFuelTankFull
   entities:
   - uid: 781
@@ -172228,11 +171226,6 @@ entities:
     - type: Transform
       pos: 32.5,-62.5
       parent: 8364
-  - uid: 20800
-    components:
-    - type: Transform
-      pos: 63.5,-43.5
-      parent: 8364
   - uid: 20913
     components:
     - type: Transform
@@ -172265,6 +171258,11 @@ entities:
       parent: 8364
 - proto: Windoor
   entities:
+  - uid: 2030
+    components:
+    - type: Transform
+      pos: 58.5,-49.5
+      parent: 8364
   - uid: 5755
     components:
     - type: Transform
@@ -173146,6 +172144,21 @@ entities:
     - type: Transform
       pos: 27.5,-3.5
       parent: 8364
+  - uid: 4245
+    components:
+    - type: Transform
+      pos: 59.5,-53.5
+      parent: 8364
+  - uid: 4269
+    components:
+    - type: Transform
+      pos: 61.5,-53.5
+      parent: 8364
+  - uid: 5237
+    components:
+    - type: Transform
+      pos: 57.5,-53.5
+      parent: 8364
   - uid: 7236
     components:
     - type: Transform
@@ -173508,6 +172521,21 @@ entities:
       rot: 1.5707963267948966 rad
       pos: -42.5,1.5
       parent: 8364
+  - uid: 16365
+    components:
+    - type: Transform
+      pos: 59.5,-49.5
+      parent: 8364
+  - uid: 16366
+    components:
+    - type: Transform
+      pos: 57.5,-49.5
+      parent: 8364
+  - uid: 17715
+    components:
+    - type: Transform
+      pos: 60.5,-49.5
+      parent: 8364
   - uid: 17843
     components:
     - type: Transform
@@ -174358,43 +173386,6 @@ entities:
     - type: Transform
       pos: -12.460218,-61.460724
       parent: 8364
-- proto: YellowOxygenTank
-  entities:
-  - uid: 21419
-    components:
-    - type: MetaData
-      name: empty tank
-    - type: Transform
-      pos: 79.5,-43.5
-      parent: 8364
-  - uid: 21420
-    components:
-    - type: MetaData
-      name: empty tank
-    - type: Transform
-      pos: 79.5,-43.5
-      parent: 8364
-  - uid: 21421
-    components:
-    - type: MetaData
-      name: empty tank
-    - type: Transform
-      pos: 79.5,-43.5
-      parent: 8364
-  - uid: 21422
-    components:
-    - type: MetaData
-      name: empty tank
-    - type: Transform
-      pos: 79.5,-43.5
-      parent: 8364
-  - uid: 21423
-    components:
-    - type: MetaData
-      name: empty tank
-    - type: Transform
-      pos: 79.5,-43.5
-      parent: 8364
 - proto: Zipties
   entities:
   - uid: 13775
diff --git a/Resources/Maps/fland.yml b/Resources/Maps/fland.yml
index ec0e7b15fa4..7322efa5088 100644
--- a/Resources/Maps/fland.yml
+++ b/Resources/Maps/fland.yml
@@ -107,11 +107,11 @@ entities:
           version: 6
         -2,2:
           ind: -2,2
-          tiles: HQAAAAABHQAAAAAAHQAAAAAAWQAAAAADWQAAAAADWQAAAAADHQAAAAABDgAAAAADDgAAAAABDgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAOgAAAAAALwAAAAAALwAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAOgAAAAAAHQAAAAABHQAAAAABHQAAAAABWQAAAAABWQAAAAADWQAAAAADeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAOgAAAAAAHQAAAAABHQAAAAAAHQAAAAABWQAAAAACWQAAAAADWQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAOgAAAAAAHQAAAAABHQAAAAABHQAAAAABWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAALwAAAAAALwAAAAAAeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAdgAAAAADdgAAAAAAdgAAAAACdgAAAAABdgAAAAABeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAOgAAAAAAHQAAAAADHQAAAAABHQAAAAADWQAAAAABWQAAAAAAeQAAAAAAdgAAAAABdgAAAAACdgAAAAADdgAAAAAAdgAAAAABaQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAOgAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAACeQAAAAAAdgAAAAADdgAAAAACHQAAAAACHQAAAAADHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAOgAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAABeQAAAAAAdgAAAAADdgAAAAABHQAAAAAAHQAAAAACHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAOgAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADdgAAAAADHQAAAAACHQAAAAADHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAOgAAAAAAWQAAAAABWQAAAAADeQAAAAAALwAAAAAALwAAAAAAeQAAAAAAdgAAAAACdgAAAAADHQAAAAACHQAAAAAAHQAAAAABeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAABHQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAaAAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADaAAAAAAAWQAAAAACWQAAAAABaAAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAACWQAAAAAAaAAAAAAAWQAAAAAAWQAAAAADaAAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAADWQAAAAACWQAAAAADaAAAAAAAWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
+          tiles: HQAAAAABHQAAAAAAHQAAAAAAWQAAAAADWQAAAAADWQAAAAADHQAAAAABDgAAAAADDgAAAAABDgAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAOgAAAAAALwAAAAAALwAAAAAAeQAAAAAAWQAAAAADWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAOgAAAAAAHQAAAAABHQAAAAABHQAAAAABWQAAAAABWQAAAAADWQAAAAADeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAOgAAAAAAHQAAAAABHQAAAAAAHQAAAAABWQAAAAACWQAAAAADWQAAAAABeQAAAAAAaAAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAOgAAAAAAHQAAAAABHQAAAAABHQAAAAABWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAeQAAAAAALwAAAAAALwAAAAAAeQAAAAAAWQAAAAAAWQAAAAABeQAAAAAAdgAAAAADdgAAAAAAdgAAAAACdgAAAAABdgAAAAABeQAAAAAAeQAAAAAAaAAAAAAAeQAAAAAAOgAAAAAAHQAAAAADHQAAAAABHQAAAAADWQAAAAABWQAAAAAAeQAAAAAAdgAAAAABdgAAAAACdgAAAAADdgAAAAAAdgAAAAABaQAAAAAAeQAAAAAAeQAAAAAAaQAAAAAAOgAAAAAAWQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAACeQAAAAAAdgAAAAADdgAAAAACHQAAAAACHQAAAAADHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAOgAAAAAAWQAAAAABWQAAAAABWQAAAAADWQAAAAACWQAAAAABeQAAAAAAdgAAAAADdgAAAAABHQAAAAAAHQAAAAACHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAOgAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdgAAAAADdgAAAAADHQAAAAACHQAAAAADHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAOgAAAAAAWQAAAAABWQAAAAADeQAAAAAADAAAAAAADAAAAAAAeQAAAAAAdgAAAAACdgAAAAADHQAAAAACHQAAAAAAHQAAAAABeQAAAAAAaQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAADHQAAAAABHQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAaAAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAADWQAAAAAAWQAAAAAAWQAAAAADaAAAAAAAWQAAAAACWQAAAAABaAAAAAAAWQAAAAADWQAAAAABWQAAAAAAWQAAAAACWQAAAAADWQAAAAACWQAAAAAAWQAAAAACWQAAAAADWQAAAAABWQAAAAACWQAAAAAAaAAAAAAAWQAAAAAAWQAAAAADaAAAAAAAWQAAAAACWQAAAAACWQAAAAADWQAAAAADWQAAAAACWQAAAAABWQAAAAABWQAAAAACWQAAAAABWQAAAAADWQAAAAACWQAAAAADaAAAAAAAWQAAAAABWQAAAAAAeQAAAAAAeQAAAAAAdgAAAAACdgAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAA
           version: 6
         -1,2:
           ind: -1,2
-          tiles: OgAAAAAAOgAAAAAAOgAAAAAAOgAAAAAAaAAAAAAAHQAAAAAAHQAAAAABHQAAAAABHQAAAAADHQAAAAABHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAADWQAAAAABWQAAAAAAOgAAAAAAOgAAAAAAOgAAAAAAOgAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACOgAAAAAAOgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAWQAAAAABWQAAAAADOgAAAAAAOgAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAACWQAAAAABWQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAHQAAAAABOgAAAAAAHQAAAAADHQAAAAACOgAAAAAAHQAAAAABHQAAAAAAWQAAAAABWQAAAAABWQAAAAADeQAAAAAAWQAAAAABWQAAAAABOgAAAAAAOgAAAAAAeQAAAAAAHQAAAAABOgAAAAAAHQAAAAACHQAAAAADOgAAAAAAeQAAAAAAHQAAAAAAWQAAAAADWQAAAAADWQAAAAABeQAAAAAAWQAAAAABWQAAAAAAOgAAAAAAOgAAAAAAeQAAAAAAHQAAAAABOgAAAAAAHQAAAAACHQAAAAACOgAAAAAAHQAAAAABHQAAAAAAWQAAAAADWQAAAAACWQAAAAADeQAAAAAAWQAAAAACWQAAAAAAOgAAAAAAOgAAAAAAHQAAAAABWQAAAAACWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAADWQAAAAABeQAAAAAAWQAAAAABWQAAAAABOgAAAAAAOgAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAABWQAAAAADWQAAAAACeQAAAAAAaAAAAAAAaAAAAAAAOgAAAAAAOgAAAAAAeQAAAAAAHQAAAAACOgAAAAAAHQAAAAACHQAAAAACOgAAAAAAHQAAAAACeQAAAAAALwAAAAAALwAAAAAALwAAAAAAeQAAAAAAWQAAAAACWQAAAAABOgAAAAAAOgAAAAAAeQAAAAAAHQAAAAADOgAAAAAAHQAAAAABHQAAAAAAOgAAAAAAHQAAAAADeQAAAAAALwAAAAAALwAAAAAALwAAAAAAeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAADaAAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAAAaAAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAABaAAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAABwAAAAAABwAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAaAAAAAAA
+          tiles: OgAAAAAAOgAAAAAAOgAAAAAAOgAAAAAAaAAAAAAAHQAAAAAAHQAAAAABHQAAAAABHQAAAAADHQAAAAABHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAADWQAAAAABWQAAAAAAOgAAAAAAOgAAAAAAOgAAAAAAOgAAAAAAeQAAAAAAWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAADWQAAAAACOgAAAAAAOgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAADWQAAAAAAWQAAAAADWQAAAAADWQAAAAACWQAAAAAAeQAAAAAAWQAAAAABWQAAAAADOgAAAAAAOgAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAABWQAAAAADWQAAAAACWQAAAAACWQAAAAABWQAAAAAAeQAAAAAAWQAAAAACWQAAAAADWQAAAAADeQAAAAAAeQAAAAAAHQAAAAABOgAAAAAAHQAAAAADHQAAAAACOgAAAAAAHQAAAAABHQAAAAAAWQAAAAABWQAAAAABWQAAAAADeQAAAAAAWQAAAAABWQAAAAABOgAAAAAAOgAAAAAAeQAAAAAAHQAAAAABOgAAAAAAHQAAAAACHQAAAAADOgAAAAAAeQAAAAAAHQAAAAAAWQAAAAADWQAAAAADWQAAAAABeQAAAAAAWQAAAAABWQAAAAAAOgAAAAAAOgAAAAAAeQAAAAAAHQAAAAABOgAAAAAAHQAAAAACHQAAAAACOgAAAAAAHQAAAAABHQAAAAAAWQAAAAADWQAAAAACWQAAAAADeQAAAAAAWQAAAAACWQAAAAAAOgAAAAAAOgAAAAAAHQAAAAABWQAAAAACWQAAAAABWQAAAAACWQAAAAABWQAAAAAAWQAAAAACWQAAAAABWQAAAAADWQAAAAADWQAAAAABeQAAAAAAWQAAAAABWQAAAAABOgAAAAAAOgAAAAAAeQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAABWQAAAAADWQAAAAABWQAAAAACWQAAAAABWQAAAAADWQAAAAACeQAAAAAAaAAAAAAAaAAAAAAAOgAAAAAAOgAAAAAAeQAAAAAAHQAAAAACOgAAAAAAHQAAAAACHQAAAAACOgAAAAAAHQAAAAACeQAAAAAADAAAAAAADAAAAAAADAAAAAAAeQAAAAAAWQAAAAACWQAAAAABOgAAAAAAOgAAAAAAeQAAAAAAHQAAAAADOgAAAAAAHQAAAAABHQAAAAAAOgAAAAAAHQAAAAADeQAAAAAADAAAAAAADAAAAAAADAAAAAAAeQAAAAAAWQAAAAADWQAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAWQAAAAACWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAACWQAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAADaAAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAADWQAAAAADWQAAAAABWQAAAAAAaAAAAAAAWQAAAAAAWQAAAAABWQAAAAACWQAAAAABWQAAAAACWQAAAAABWQAAAAABWQAAAAAAWQAAAAABWQAAAAADWQAAAAAAWQAAAAADWQAAAAABWQAAAAACWQAAAAABaAAAAAAAWQAAAAACWQAAAAABWQAAAAABWQAAAAABWQAAAAAAWQAAAAACeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAABwAAAAAABwAAAAAAeQAAAAAAeQAAAAAAWQAAAAAAWQAAAAACWQAAAAACeQAAAAAAeQAAAAAAaAAAAAAA
           version: 6
         0,2:
           ind: 0,2
@@ -219,7 +219,7 @@ entities:
           version: 6
         0,3:
           ind: 0,3
-          tiles: bAAAAAACeQAAAAAAbAAAAAABbAAAAAAAbAAAAAAAbAAAAAABbAAAAAAAbAAAAAABdQAAAAACbAAAAAAAbAAAAAADbAAAAAACbAAAAAACbAAAAAAAbAAAAAABbAAAAAAAbAAAAAADdQAAAAADbAAAAAADbAAAAAABbAAAAAABbAAAAAAAbAAAAAABbAAAAAABdQAAAAACbAAAAAADHQAAAAABHQAAAAACHQAAAAACHQAAAAAAHQAAAAADbAAAAAABbAAAAAACeQAAAAAAWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAbAAAAAADHQAAAAABHQAAAAADHQAAAAACHQAAAAADHQAAAAACbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAADbAAAAAABbAAAAAACbAAAAAABbAAAAAACbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAdQAAAAAAdQAAAAAAdQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAbAAAAAABeQAAAAAAaQAAAAAALAAAAAAALAAAAAAALAAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAdQAAAAAAdQAAAAAAdQAAAAAAeQAAAAAAbAAAAAAAbAAAAAABbAAAAAAAeQAAAAAAeQAAAAAALAAAAAAALAAAAAAALAAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAdQAAAAAAdQAAAAAAdQAAAAAAeQAAAAAAbAAAAAAAbAAAAAABbAAAAAACeQAAAAAAeQAAAAAALAAAAAAALAAAAAAALAAAAAAAeQAAAAAAHQAAAAAAHQAAAAAAHQAAAAAAdQAAAAAAdQAAAAAAdQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABeQAAAAAALAAAAAAALAAAAAAALAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAADbAAAAAAAbAAAAAABeQAAAAAALAAAAAAALAAAAAAALAAAAAAAeQAAAAAAHQAAAAADHQAAAAADHQAAAAADHQAAAAADHQAAAAABHQAAAAAAeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAABeQAAAAAAeQAAAAAALAAAAAAALAAAAAAALAAAAAAAeQAAAAAAHQAAAAACHQAAAAAAHQAAAAADHQAAAAAAHQAAAAAAHQAAAAACeQAAAAAAbAAAAAACbAAAAAAAbAAAAAADbAAAAAABeQAAAAAAeQAAAAAAdQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABdQAAAAAAbAAAAAABbAAAAAAAbAAAAAAAbAAAAAACbAAAAAAAbAAAAAACbAAAAAAAbAAAAAABbAAAAAABbAAAAAACdQAAAAABbAAAAAABbAAAAAAAbAAAAAADbAAAAAADeQAAAAAAbAAAAAADbAAAAAADWQAAAAACWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAADWQAAAAABWQAAAAAASwAAAAABWQAAAAADWQAAAAACWQAAAAABbAAAAAAAdQAAAAACbAAAAAACbAAAAAABbAAAAAADbAAAAAADbAAAAAACbAAAAAAAbAAAAAABbAAAAAADbAAAAAACbAAAAAAAdQAAAAAAbAAAAAADbAAAAAABbAAAAAAD
+          tiles: bAAAAAACeQAAAAAAbAAAAAABbAAAAAAAbAAAAAAAbAAAAAABbAAAAAAAbAAAAAABdQAAAAACbAAAAAAAbAAAAAADbAAAAAACbAAAAAACbAAAAAAAbAAAAAABbAAAAAAAbAAAAAADdQAAAAADbAAAAAADbAAAAAABbAAAAAABbAAAAAAAbAAAAAABbAAAAAABdQAAAAACbAAAAAADbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAABbAAAAAACeQAAAAAAWQAAAAAAWQAAAAADWQAAAAACWQAAAAAAWQAAAAAAWQAAAAADeQAAAAAAbAAAAAADbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAAAbAAAAAABeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAADbAAAAAADbAAAAAABbAAAAAACbAAAAAABbAAAAAACbAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdQAAAAAAdQAAAAAAeQAAAAAAeQAAAAAAdQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAdQAAAAAAdQAAAAAAdQAAAAAAdQAAAAAAdQAAAAAAdQAAAAAAeQAAAAAAbAAAAAADbAAAAAAAbAAAAAABeQAAAAAAaQAAAAAALAAAAAAALAAAAAAALAAAAAAAHQAAAAAAdQAAAAAAdQAAAAAAdQAAAAAAdQAAAAAAdQAAAAAAdQAAAAAAeQAAAAAAbAAAAAAAbAAAAAABbAAAAAAAeQAAAAAAeQAAAAAALAAAAAAALAAAAAAALAAAAAAAHQAAAAAAJgAAAAAAJgAAAAAAJgAAAAAAJgAAAAAAJgAAAAAAJgAAAAAAeQAAAAAAbAAAAAAAbAAAAAABbAAAAAACeQAAAAAAeQAAAAAALAAAAAAALAAAAAAALAAAAAAAeQAAAAAAJgAAAAAAJgAAAAAAJgAAAAAAJgAAAAAAJgAAAAAAJgAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABeQAAAAAALAAAAAAALAAAAAAALAAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAAAbAAAAAADbAAAAAAAbAAAAAABeQAAAAAALAAAAAAALAAAAAAALAAAAAAAeQAAAAAAHQAAAAADHQAAAAADHQAAAAADHQAAAAADHQAAAAABHQAAAAAAeQAAAAAAbAAAAAAAbAAAAAAAbAAAAAABeQAAAAAAeQAAAAAALAAAAAAALAAAAAAALAAAAAAAeQAAAAAAHQAAAAACHQAAAAAAHQAAAAADHQAAAAAAHQAAAAAAHQAAAAACeQAAAAAAbAAAAAACbAAAAAAAbAAAAAADbAAAAAABeQAAAAAAeQAAAAAAdQAAAAADeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAHQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAeQAAAAAAbAAAAAABdQAAAAAAbAAAAAABbAAAAAAAbAAAAAAAbAAAAAACbAAAAAAAbAAAAAACbAAAAAAAbAAAAAABbAAAAAABbAAAAAACdQAAAAABbAAAAAABbAAAAAAAbAAAAAADbAAAAAADeQAAAAAAbAAAAAADbAAAAAADWQAAAAACWQAAAAABWQAAAAADWQAAAAACWQAAAAAAWQAAAAADWQAAAAABWQAAAAAASwAAAAABWQAAAAADWQAAAAACWQAAAAABbAAAAAAAdQAAAAACbAAAAAACbAAAAAABbAAAAAADbAAAAAADbAAAAAACbAAAAAAAbAAAAAABbAAAAAADbAAAAAACbAAAAAAAdQAAAAAAbAAAAAADbAAAAAABbAAAAAAD
           version: 6
         0,4:
           ind: 0,4
@@ -612,8 +612,6 @@ entities:
           decals:
             2273: 7,-17
             3850: 22,41
-            4162: 14,49
-            4163: 10,49
         - node:
             angle: -1.5707963267948966 rad
             color: '#FFFFFFFF'
@@ -944,7 +942,6 @@ entities:
             3848: 20,41
             3849: 21,41
             4097: 30,48
-            4151: 10,50
             4368: 7,70
             4369: 7,72
             4472: 30,40
@@ -1658,6 +1655,9 @@ entities:
             8604: 71,12
             8605: 72,12
             8606: 73,12
+            8773: -4,40
+            8774: -5,40
+            8775: -6,40
         - node:
             color: '#D381C996'
             id: BrickTileSteelLineS
@@ -1783,10 +1783,11 @@ entities:
             3860: 15,38
             4035: 7,45
             4082: 24,50
-            4117: 15,51
             4230: 0,64
             4301: 19,64
             4335: 8,68
+            8730: 11,56
+            8741: 15,51
         - node:
             color: '#9FED5896'
             id: BrickTileWhiteCornerNe
@@ -1856,13 +1857,13 @@ entities:
             3863: 10,41
             3929: 10,45
             4081: 22,50
-            4118: 9,51
             4204: 6,56
             4229: -2,64
             4286: 3,63
             4300: 17,64
             4336: 4,68
             4337: 7,68
+            8740: 9,51
         - node:
             color: '#9FED5896'
             id: BrickTileWhiteCornerNw
@@ -1937,6 +1938,7 @@ entities:
             4215: 7,52
             4232: 0,60
             4338: 8,65
+            8748: 11,53
         - node:
             color: '#9FED5896'
             id: BrickTileWhiteCornerSe
@@ -2090,7 +2092,6 @@ entities:
             3346: 44,-15
             3581: 56,-42
             3654: 57,-33
-            4147: 9,48
         - node:
             color: '#EFB34196'
             id: BrickTileWhiteInnerNe
@@ -2126,7 +2127,6 @@ entities:
             3429: 50,-26
             3642: 57,-28
             3648: 56,-31
-            4148: 15,48
         - node:
             color: '#DE3A3A96'
             id: BrickTileWhiteInnerNw
@@ -2155,7 +2155,6 @@ entities:
             3393: 49,-28
             3402: 39,-28
             3655: 57,-31
-            4150: 9,51
         - node:
             color: '#FF81C996'
             id: BrickTileWhiteInnerSe
@@ -2183,7 +2182,6 @@ entities:
           decals:
             3394: 47,-28
             3646: 56,-29
-            4149: 15,51
         - node:
             color: '#DE3A3A96'
             id: BrickTileWhiteInnerSw
@@ -2243,12 +2241,14 @@ entities:
             4078: 24,47
             4079: 24,48
             4080: 24,49
-            4155: 15,50
             4231: 0,62
             4302: 19,63
             4303: 19,61
             4343: 8,66
             4344: 8,67
+            8733: 11,54
+            8734: 11,55
+            8742: 15,50
         - node:
             color: '#9FED580F'
             id: BrickTileWhiteLineE
@@ -2308,8 +2308,6 @@ entities:
             3662: 39,-36
             3663: 39,-37
             3664: 39,-38
-            4139: 9,49
-            4140: 9,50
             7033: 39,-50
             7034: 39,-49
             7035: 39,-48
@@ -2441,16 +2439,9 @@ entities:
             4041: 5,45
             4042: 4,45
             4083: 23,50
-            4125: 10,51
-            4126: 11,51
-            4127: 12,51
-            4128: 13,51
-            4129: 14,51
             4205: 7,56
             4206: 8,56
             4207: 9,56
-            4208: 10,56
-            4209: 11,56
             4223: 15,59
             4224: 14,59
             4225: 13,59
@@ -2468,6 +2459,11 @@ entities:
             4297: 16,63
             4298: 18,64
             4348: 6,67
+            8731: 10,56
+            8744: 14,51
+            8745: 13,51
+            8746: 12,51
+            8747: 11,51
         - node:
             color: '#9FED580F'
             id: BrickTileWhiteLineN
@@ -2514,11 +2510,6 @@ entities:
             3643: 56,-28
             3649: 55,-31
             3650: 54,-31
-            4134: 14,48
-            4135: 13,48
-            4136: 12,48
-            4137: 11,48
-            4138: 10,48
             7027: 37,-47
             7028: 36,-47
             7029: 38,-47
@@ -2644,8 +2635,6 @@ entities:
             4121: 12,47
             4122: 11,47
             4123: 10,47
-            4210: 11,53
-            4211: 10,53
             4212: 9,53
             4213: 8,53
             4220: 13,57
@@ -2729,11 +2718,6 @@ entities:
             3401: 40,-28
             3571: 57,-34
             3580: 57,-42
-            4142: 14,51
-            4143: 13,51
-            4144: 12,51
-            4145: 11,51
-            4146: 10,51
             5048: 56,-13
             5049: 55,-13
             5050: 54,-13
@@ -2893,11 +2877,11 @@ entities:
             4075: 22,47
             4076: 22,48
             4077: 22,49
-            4124: 9,50
             4217: 6,53
             4317: 3,62
             4321: 2,62
             4345: 4,67
+            8743: 9,50
         - node:
             color: '#79150096'
             id: BrickTileWhiteLineW
@@ -2951,8 +2935,6 @@ entities:
             3671: 37,-33
             3672: 37,-32
             3673: 37,-30
-            4141: 15,49
-            4154: 15,50
             7036: 35,-49
             7037: 35,-48
             7064: 35,-50
@@ -3998,6 +3980,27 @@ entities:
             8700: 15,53
             8701: 14,53
             8702: 13,53
+            8752: 7,48
+            8753: 7,49
+            8754: 6,49
+            8755: 6,48
+            8756: 5,48
+            8757: 5,49
+            8758: 4,49
+            8759: 4,48
+            8760: 3,48
+            8761: 3,49
+            8762: 2,49
+            8763: 2,48
+            8764: 0,48
+            8765: -1,48
+            8766: -2,48
+            8767: -2,49
+            8768: -1,49
+            8769: 0,49
+            8770: 0,50
+            8771: -1,50
+            8772: -2,50
         - node:
             color: '#79150096'
             id: CheckerNWSE
@@ -4174,27 +4177,6 @@ entities:
             3823: 23,41
             3824: 24,41
             3825: 25,41
-            4164: 0,48
-            4165: -1,48
-            4166: -2,48
-            4167: -2,49
-            4168: -1,49
-            4169: 0,49
-            4170: 0,50
-            4171: -1,50
-            4172: -2,50
-            4173: 2,48
-            4174: 3,48
-            4175: 4,48
-            4176: 5,48
-            4177: 6,48
-            4178: 7,48
-            4179: 7,49
-            4180: 6,49
-            4181: 5,49
-            4182: 4,49
-            4183: 3,49
-            4184: 2,49
             4622: 30,-59
             4623: 29,-59
             4624: 28,-59
@@ -4532,8 +4514,6 @@ entities:
             7994: 22,-23
             8214: 22,7
             8681: -11,8
-            8726: 10,53
-            8727: 10,56
         - node:
             cleanable: True
             color: '#FFFFFFFF'
@@ -10413,12 +10393,6 @@ entities:
             id: WarnEndW
           decals:
             5666: 59,-8
-        - node:
-            color: '#FFFFFFFF'
-            id: WarnFull
-          decals:
-            4152: 12,49
-            4153: 14,50
         - node:
             color: '#334E6DC8'
             id: WarnFullGreyscale
@@ -10430,6 +10404,7 @@ entities:
           decals:
             8692: 16,54
             8693: 16,58
+            8750: 10,52
         - node:
             color: '#9FED5896'
             id: WarnFullGreyscale
@@ -10680,11 +10655,11 @@ entities:
           decals:
             3986: 19,58
             3987: 19,54
-            4130: 15,48
-            4131: 15,49
             4239: 0,61
             4240: 0,63
             4322: 19,62
+            8737: 15,48
+            8738: 15,49
         - node:
             color: '#D381C996'
             id: WarnLineGreyscaleE
@@ -10754,6 +10729,7 @@ entities:
             4054: 24,45
             4323: 14,63
             4324: 7,63
+            8739: 10,51
         - node:
             color: '#9FED5896'
             id: WarnLineGreyscaleN
@@ -10859,6 +10835,7 @@ entities:
             8183: 3,47
             8483: 95,32
             8484: 96,32
+            8749: 10,53
         - node:
             color: '#A4610696'
             id: WarnLineGreyscaleS
@@ -10939,8 +10916,6 @@ entities:
             3988: 17,48
             3989: 17,49
             4047: 9,44
-            4132: 9,48
-            4133: 9,49
             4218: 6,54
             4219: 6,55
             4236: -2,61
@@ -10948,6 +10923,8 @@ entities:
             4238: -2,63
             4319: 2,61
             4320: 2,63
+            8735: 9,48
+            8736: 9,49
         - node:
             color: '#9FED5896'
             id: WarnLineGreyscaleW
@@ -20312,6 +20289,11 @@ entities:
       parent: 13329
 - proto: AirlockMaintMedLocked
   entities:
+  - uid: 10260
+    components:
+    - type: Transform
+      pos: -0.5,51.5
+      parent: 13329
   - uid: 17697
     components:
     - type: Transform
@@ -20349,13 +20331,6 @@ entities:
     - type: Transform
       pos: 26.5,-25.5
       parent: 13329
-- proto: AirlockMaintRnDMedLocked
-  entities:
-  - uid: 18619
-    components:
-    - type: Transform
-      pos: -0.5,51.5
-      parent: 13329
 - proto: AirlockMaintSalvageLocked
   entities:
   - uid: 11004
@@ -20390,6 +20365,11 @@ entities:
       parent: 13329
 - proto: AirlockMedicalGlassLocked
   entities:
+  - uid: 1505
+    components:
+    - type: Transform
+      pos: 5.5,54.5
+      parent: 13329
   - uid: 6641
     components:
     - type: Transform
@@ -20435,10 +20415,20 @@ entities:
     - type: Transform
       pos: 3.5,46.5
       parent: 13329
-  - uid: 18707
+  - uid: 18638
     components:
     - type: Transform
-      pos: 5.5,55.5
+      pos: -0.5,47.5
+      parent: 13329
+  - uid: 18639
+    components:
+    - type: Transform
+      pos: 1.5,49.5
+      parent: 13329
+  - uid: 18651
+    components:
+    - type: Transform
+      pos: 10.5,52.5
       parent: 13329
   - uid: 18708
     components:
@@ -20495,13 +20485,6 @@ entities:
     - type: Transform
       pos: 9.5,60.5
       parent: 13329
-- proto: AirlockMedicalScienceGlassLocked
-  entities:
-  - uid: 18618
-    components:
-    - type: Transform
-      pos: 1.5,49.5
-      parent: 13329
 - proto: AirlockQuartermasterGlassLocked
   entities:
   - uid: 11640
@@ -28900,16 +28883,6 @@ entities:
     - type: Transform
       pos: 24.469292,51.5738
       parent: 13329
-  - uid: 18651
-    components:
-    - type: Transform
-      pos: 0.5312333,50.854774
-      parent: 13329
-  - uid: 18652
-    components:
-    - type: Transform
-      pos: 0.7031083,50.792274
-      parent: 13329
   - uid: 34151
     components:
     - type: Transform
@@ -29012,6 +28985,36 @@ entities:
     - type: Transform
       pos: 52.5,-39.5
       parent: 13329
+  - uid: 18618
+    components:
+    - type: Transform
+      pos: 36.5,50.5
+      parent: 13329
+  - uid: 18619
+    components:
+    - type: Transform
+      pos: 32.5,50.5
+      parent: 13329
+  - uid: 18624
+    components:
+    - type: Transform
+      pos: 36.5,48.5
+      parent: 13329
+  - uid: 18625
+    components:
+    - type: Transform
+      pos: 32.5,48.5
+      parent: 13329
+  - uid: 18626
+    components:
+    - type: Transform
+      pos: 36.5,49.5
+      parent: 13329
+  - uid: 18627
+    components:
+    - type: Transform
+      pos: 32.5,49.5
+      parent: 13329
   - uid: 18723
     components:
     - type: Transform
@@ -30272,7 +30275,7 @@ entities:
   - uid: 18635
     components:
     - type: Transform
-      pos: 14.500584,47.585564
+      pos: 7.559045,47.574802
       parent: 13329
 - proto: BoxBottle
   entities:
@@ -30455,11 +30458,6 @@ entities:
     - type: Transform
       pos: 14.484999,39.61258
       parent: 13329
-  - uid: 18633
-    components:
-    - type: Transform
-      pos: 13.453709,47.554314
-      parent: 13329
   - uid: 18770
     components:
     - type: Transform
@@ -30614,11 +30612,6 @@ entities:
     - type: Transform
       pos: -15.496434,42.629738
       parent: 13329
-  - uid: 18648
-    components:
-    - type: Transform
-      pos: -1.3812413,50.29076
-      parent: 13329
   - uid: 19100
     components:
     - type: Transform
@@ -30645,11 +30638,6 @@ entities:
       parent: 13329
 - proto: BoxSterileMask
   entities:
-  - uid: 18647
-    components:
-    - type: Transform
-      pos: -1.4749913,50.556385
-      parent: 13329
   - uid: 18905
     components:
     - type: Transform
@@ -89293,11 +89281,6 @@ entities:
       rot: -1.5707963267948966 rad
       pos: 24.5,50.5
       parent: 13329
-  - uid: 18642
-    components:
-    - type: Transform
-      pos: -0.5,48.5
-      parent: 13329
   - uid: 18765
     components:
     - type: Transform
@@ -93638,18 +93621,6 @@ entities:
     - type: Transform
       pos: 76.55065,10.666498
       parent: 13329
-- proto: ClothingBackpackDuffelSurgeryFilled
-  entities:
-  - uid: 18737
-    components:
-    - type: Transform
-      pos: 11.597518,56.64033
-      parent: 13329
-  - uid: 18738
-    components:
-    - type: Transform
-      pos: 11.566268,53.60908
-      parent: 13329
 - proto: ClothingBackpackSatchelLeather
   entities:
   - uid: 6580
@@ -94040,11 +94011,6 @@ entities:
     - type: Transform
       pos: 8.524924,38.62128
       parent: 13329
-  - uid: 18757
-    components:
-    - type: Transform
-      pos: 11.477349,55.515778
-      parent: 13329
 - proto: ClothingHandsGlovesLeather
   entities:
   - uid: 1782
@@ -94504,18 +94470,6 @@ entities:
     - type: Transform
       pos: 121.521774,-20.40525
       parent: 13329
-- proto: ClothingHeadsetGrey
-  entities:
-  - uid: 18630
-    components:
-    - type: Transform
-      pos: 14.016209,47.44494
-      parent: 13329
-  - uid: 18631
-    components:
-    - type: Transform
-      pos: 13.906834,47.554314
-      parent: 13329
 - proto: ClothingHeadsetMining
   entities:
   - uid: 32208
@@ -94591,6 +94545,16 @@ entities:
       parent: 13329
 - proto: ClothingMaskBreathMedical
   entities:
+  - uid: 1499
+    components:
+    - type: Transform
+      pos: -1.5543714,49.25395
+      parent: 13329
+  - uid: 6768
+    components:
+    - type: Transform
+      pos: -1.4137464,49.175823
+      parent: 13329
   - uid: 18484
     components:
     - type: Transform
@@ -94718,11 +94682,6 @@ entities:
     - type: Transform
       pos: 6.5434475,52.678944
       parent: 13329
-  - uid: 18756
-    components:
-    - type: Transform
-      pos: 11.538149,54.48283
-      parent: 13329
   - uid: 34533
     components:
     - type: Transform
@@ -94763,6 +94722,13 @@ entities:
     - type: Transform
       pos: -35.53245,36.540043
       parent: 13329
+- proto: ClothingNeckHeadphones
+  entities:
+  - uid: 18652
+    components:
+    - type: Transform
+      pos: 31.565708,30.688412
+      parent: 13329
 - proto: ClothingNeckScarfStripedBlue
   entities:
   - uid: 18674
@@ -96004,22 +95970,21 @@ entities:
       parent: 13329
 - proto: computerBodyScanner
   entities:
-  - uid: 16951
+  - uid: 13336
     components:
     - type: Transform
-      rot: -1.5707963267948966 rad
-      pos: 8.5,36.5
+      pos: 11.5,56.5
       parent: 13329
-  - uid: 18716
+  - uid: 13346
     components:
     - type: Transform
-      pos: 9.5,56.5
+      pos: 6.5,56.5
       parent: 13329
-  - uid: 18717
+  - uid: 16951
     components:
     - type: Transform
-      rot: 3.141592653589793 rad
-      pos: 9.5,53.5
+      rot: -1.5707963267948966 rad
+      pos: 8.5,36.5
       parent: 13329
   - uid: 20044
     components:
@@ -96173,6 +96138,11 @@ entities:
     - type: Transform
       pos: 15.5,41.5
       parent: 13329
+  - uid: 18578
+    components:
+    - type: Transform
+      pos: 0.5,50.5
+      parent: 13329
   - uid: 18688
     components:
     - type: Transform
@@ -96301,11 +96271,6 @@ entities:
       rot: 1.5707963267948966 rad
       pos: -16.5,-22.5
       parent: 13329
-  - uid: 13463
-    components:
-    - type: Transform
-      pos: 12.5,49.5
-      parent: 13329
   - uid: 20054
     components:
     - type: Transform
@@ -97869,15 +97834,10 @@ entities:
         - 0
         - 0
         - 0
-  - uid: 24265
-    components:
-    - type: Transform
-      pos: 8.5,53.5
-      parent: 13329
-  - uid: 24266
+  - uid: 18647
     components:
     - type: Transform
-      pos: 8.5,56.5
+      pos: 11.5,54.5
       parent: 13329
 - proto: CrateFunParty
   entities:
@@ -98023,31 +97983,6 @@ entities:
         - 0
         - 0
         - 0
-- proto: CrateMedicalScrubs
-  entities:
-  - uid: 18739
-    components:
-    - type: Transform
-      pos: 7.5,56.5
-      parent: 13329
-    - type: EntityStorage
-      air:
-        volume: 200
-        immutable: False
-        temperature: 293.1495
-        moles:
-        - 3.0981817
-        - 11.655066
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
 - proto: CrateMedicalSupplies
   entities:
   - uid: 34529
@@ -98075,29 +98010,11 @@ entities:
         - 0
 - proto: CrateMedicalSurgery
   entities:
-  - uid: 18736
+  - uid: 18648
     components:
     - type: Transform
-      pos: 6.5,56.5
+      pos: 11.5,53.5
       parent: 13329
-    - type: EntityStorage
-      air:
-        volume: 200
-        immutable: False
-        temperature: 293.1495
-        moles:
-        - 3.0981817
-        - 11.655066
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
-        - 0
 - proto: CrateMousetrapBoxes
   entities:
   - uid: 32681
@@ -98424,7 +98341,7 @@ entities:
   - uid: 18632
     components:
     - type: Transform
-      pos: 10.547459,47.491814
+      pos: 7.441557,50.594215
       parent: 13329
   - uid: 30760
     components:
@@ -98448,6 +98365,12 @@ entities:
       parent: 13329
 - proto: CryogenicSleepUnit
   entities:
+  - uid: 18634
+    components:
+    - type: Transform
+      rot: 3.141592653589793 rad
+      pos: 21.5,51.5
+      parent: 13329
   - uid: 27924
     components:
     - type: Transform
@@ -99337,10 +99260,10 @@ entities:
       parent: 13329
 - proto: DefibrillatorCabinetFilled
   entities:
-  - uid: 13342
+  - uid: 11850
     components:
     - type: Transform
-      pos: 9.5,52.5
+      pos: 14.5,52.5
       parent: 13329
   - uid: 13343
     components:
@@ -109775,16 +109698,6 @@ entities:
     - type: Transform
       pos: 21.596437,36.347313
       parent: 13329
-  - uid: 18649
-    components:
-    - type: Transform
-      pos: 0.4531083,50.604774
-      parent: 13329
-  - uid: 18650
-    components:
-    - type: Transform
-      pos: 0.6093583,50.46415
-      parent: 13329
 - proto: EmergencyLight
   entities:
   - uid: 11013
@@ -109887,6 +109800,11 @@ entities:
       parent: 13329
 - proto: EmergencyRollerBedSpawnFolded
   entities:
+  - uid: 10262
+    components:
+    - type: Transform
+      pos: 6.4365883,50.53447
+      parent: 13329
   - uid: 18573
     components:
     - type: Transform
@@ -110581,16 +110499,6 @@ entities:
     - type: Transform
       pos: 2.5,40.5
       parent: 13329
-  - uid: 18628
-    components:
-    - type: Transform
-      pos: 11.5,47.5
-      parent: 13329
-  - uid: 18641
-    components:
-    - type: Transform
-      pos: -1.5,48.5
-      parent: 13329
   - uid: 18691
     components:
     - type: Transform
@@ -115303,7 +115211,7 @@ entities:
     - type: Transform
       pos: 131.32036,-3.2101665
       parent: 13329
-- proto: FoodBoxDonkpocketGondola
+- proto: FoodBoxDonkpocketPizza
   entities:
   - uid: 21337
     components:
@@ -161932,18 +161840,6 @@ entities:
     - type: Transform
       pos: 67.54935,57.561733
       parent: 13329
-- proto: HandheldCrewMonitor
-  entities:
-  - uid: 19019
-    components:
-    - type: Transform
-      pos: 23.528522,58.4457
-      parent: 13329
-  - uid: 19147
-    components:
-    - type: Transform
-      pos: 7.529708,47.611584
-      parent: 13329
 - proto: HandheldGPSBasic
   entities:
   - uid: 6972
@@ -162200,6 +162096,11 @@ entities:
     - type: Transform
       pos: 13.5,46.5
       parent: 13329
+  - uid: 18631
+    components:
+    - type: Transform
+      pos: 10.5,52.5
+      parent: 13329
   - uid: 18745
     components:
     - type: Transform
@@ -165205,11 +165106,6 @@ entities:
       parent: 13329
 - proto: MachineFrame
   entities:
-  - uid: 13346
-    components:
-    - type: Transform
-      pos: 10.5,50.5
-      parent: 13329
   - uid: 15519
     components:
     - type: Transform
@@ -165763,6 +165659,21 @@ entities:
       parent: 13329
 - proto: MedicalBed
   entities:
+  - uid: 13321
+    components:
+    - type: Transform
+      pos: 9.5,50.5
+      parent: 13329
+  - uid: 18642
+    components:
+    - type: Transform
+      pos: 9.5,47.5
+      parent: 13329
+  - uid: 18655
+    components:
+    - type: Transform
+      pos: 15.5,50.5
+      parent: 13329
   - uid: 18795
     components:
     - type: Transform
@@ -165788,36 +165699,6 @@ entities:
     - type: Transform
       pos: 15.5,55.5
       parent: 13329
-  - uid: 19070
-    components:
-    - type: Transform
-      pos: 36.5,48.5
-      parent: 13329
-  - uid: 19071
-    components:
-    - type: Transform
-      pos: 32.5,48.5
-      parent: 13329
-  - uid: 19075
-    components:
-    - type: Transform
-      pos: 36.5,50.5
-      parent: 13329
-  - uid: 19076
-    components:
-    - type: Transform
-      pos: 32.5,50.5
-      parent: 13329
-  - uid: 34636
-    components:
-    - type: Transform
-      pos: 36.5,49.5
-      parent: 13329
-  - uid: 34637
-    components:
-    - type: Transform
-      pos: 32.5,49.5
-      parent: 13329
 - proto: MedicalScanner
   entities:
   - uid: 26066
@@ -166769,6 +166650,16 @@ entities:
       joinedGrid: 13329
 - proto: NitrousOxideTankFilled
   entities:
+  - uid: 18617
+    components:
+    - type: Transform
+      pos: -1.5746546,48.56645
+      parent: 13329
+  - uid: 18637
+    components:
+    - type: Transform
+      pos: -1.4184046,48.56645
+      parent: 13329
   - uid: 31659
     components:
     - type: Transform
@@ -166802,20 +166693,20 @@ entities:
       parent: 13329
 - proto: OperatingTable
   entities:
-  - uid: 16950
+  - uid: 13463
     components:
     - type: Transform
-      pos: 8.5,37.5
+      pos: 7.5,56.5
       parent: 13329
-  - uid: 18714
+  - uid: 16950
     components:
     - type: Transform
-      pos: 10.5,56.5
+      pos: 8.5,37.5
       parent: 13329
-  - uid: 18715
+  - uid: 17012
     components:
     - type: Transform
-      pos: 10.5,53.5
+      pos: 10.5,56.5
       parent: 13329
   - uid: 20043
     components:
@@ -167330,11 +167221,6 @@ entities:
     - type: Transform
       pos: 75.5,-8.5
       parent: 13329
-  - uid: 18634
-    components:
-    - type: Transform
-      pos: 12.5,47.5
-      parent: 13329
   - uid: 26255
     components:
     - type: Transform
@@ -170878,13 +170764,6 @@ entities:
       parent: 13329
     - type: ApcPowerReceiver
       powerLoad: 0
-  - uid: 18655
-    components:
-    - type: Transform
-      pos: 10.5,51.5
-      parent: 13329
-    - type: ApcPowerReceiver
-      powerLoad: 0
   - uid: 18656
     components:
     - type: Transform
@@ -185223,6 +185102,11 @@ entities:
       parent: 13329
 - proto: SignMedical
   entities:
+  - uid: 10600
+    components:
+    - type: Transform
+      pos: -2.5,47.5
+      parent: 13329
   - uid: 17628
     components:
     - type: Transform
@@ -185840,6 +185724,11 @@ entities:
       parent: 13329
 - proto: SignSurgery
   entities:
+  - uid: 18448
+    components:
+    - type: Transform
+      pos: 9.5,52.5
+      parent: 13329
   - uid: 18722
     components:
     - type: Transform
@@ -186153,15 +186042,15 @@ entities:
     - type: Transform
       pos: -8.5,33.5
       parent: 13329
-  - uid: 18448
+  - uid: 18449
     components:
     - type: Transform
-      pos: 5.5,54.5
+      pos: 22.5,42.5
       parent: 13329
-  - uid: 18449
+  - uid: 18633
     components:
     - type: Transform
-      pos: 22.5,42.5
+      pos: 5.5,55.5
       parent: 13329
   - uid: 19092
     components:
@@ -189603,47 +189492,6 @@ entities:
     - type: Transform
       pos: 29.5,12.5
       parent: 13329
-- proto: SpawnVehicleATV
-  entities:
-  - uid: 11848
-    components:
-    - type: Transform
-      pos: 20.5,-17.5
-      parent: 13329
-  - uid: 13321
-    components:
-    - type: Transform
-      pos: -37.5,10.5
-      parent: 13329
-  - uid: 19139
-    components:
-    - type: Transform
-      pos: 6.5,50.5
-      parent: 13329
-- proto: SpawnVehicleJanicart
-  entities:
-  - uid: 1499
-    components:
-    - type: Transform
-      pos: 4.5,10.5
-      parent: 13329
-- proto: SpawnVehicleSecway
-  entities:
-  - uid: 10260
-    components:
-    - type: Transform
-      pos: 33.5,21.5
-      parent: 13329
-  - uid: 10261
-    components:
-    - type: Transform
-      pos: 33.5,22.5
-      parent: 13329
-  - uid: 10600
-    components:
-    - type: Transform
-      pos: 15.5,15.5
-      parent: 13329
 - proto: SprayBottle
   entities:
   - uid: 18495
@@ -189787,11 +189635,6 @@ entities:
     - type: Transform
       pos: 21.5,49.5
       parent: 13329
-  - uid: 18578
-    components:
-    - type: Transform
-      pos: 21.5,51.5
-      parent: 13329
 - proto: StationMap
   entities:
   - uid: 27930
@@ -193048,6 +192891,11 @@ entities:
     - type: Transform
       pos: 21.5,26.5
       parent: 13329
+  - uid: 10263
+    components:
+    - type: Transform
+      pos: -1.5,49.5
+      parent: 13329
   - uid: 10310
     components:
     - type: Transform
@@ -193631,6 +193479,11 @@ entities:
       rot: -1.5707963267948966 rad
       pos: 27.5,48.5
       parent: 13329
+  - uid: 18611
+    components:
+    - type: Transform
+      pos: -1.5,48.5
+      parent: 13329
   - uid: 18644
     components:
     - type: Transform
@@ -194813,6 +194666,16 @@ entities:
     - type: Transform
       pos: 45.5,3.5
       parent: 13329
+  - uid: 10601
+    components:
+    - type: Transform
+      pos: 8.5,55.5
+      parent: 13329
+  - uid: 11848
+    components:
+    - type: Transform
+      pos: 9.5,51.5
+      parent: 13329
   - uid: 18533
     components:
     - type: Transform
@@ -194843,40 +194706,25 @@ entities:
     - type: Transform
       pos: 25.5,48.5
       parent: 13329
-  - uid: 18624
-    components:
-    - type: Transform
-      pos: 10.5,47.5
-      parent: 13329
-  - uid: 18625
-    components:
-    - type: Transform
-      pos: 14.5,47.5
-      parent: 13329
-  - uid: 18626
-    components:
-    - type: Transform
-      pos: 13.5,47.5
-      parent: 13329
-  - uid: 18627
+  - uid: 18628
     components:
     - type: Transform
-      pos: 12.5,47.5
+      pos: 9.5,56.5
       parent: 13329
-  - uid: 18637
+  - uid: 18630
     components:
     - type: Transform
-      pos: -1.5,49.5
+      pos: 10.5,47.5
       parent: 13329
-  - uid: 18638
+  - uid: 18641
     components:
     - type: Transform
-      pos: -1.5,50.5
+      pos: 15.5,51.5
       parent: 13329
-  - uid: 18639
+  - uid: 18649
     components:
     - type: Transform
-      pos: 0.5,50.5
+      pos: 8.5,56.5
       parent: 13329
   - uid: 18810
     components:
@@ -195299,6 +195147,16 @@ entities:
     - type: Transform
       pos: 14.5,14.5
       parent: 13329
+  - uid: 13342
+    components:
+    - type: Transform
+      pos: 11.5,49.5
+      parent: 13329
+  - uid: 13345
+    components:
+    - type: Transform
+      pos: 12.5,49.5
+      parent: 13329
   - uid: 14363
     components:
     - type: Transform
@@ -195385,30 +195243,10 @@ entities:
     - type: Transform
       pos: 21.5,42.5
       parent: 13329
-  - uid: 18617
-    components:
-    - type: Transform
-      pos: -0.5,47.5
-      parent: 13329
-  - uid: 18718
-    components:
-    - type: Transform
-      pos: 11.5,53.5
-      parent: 13329
-  - uid: 18719
-    components:
-    - type: Transform
-      pos: 11.5,54.5
-      parent: 13329
-  - uid: 18720
-    components:
-    - type: Transform
-      pos: 11.5,55.5
-      parent: 13329
-  - uid: 18721
+  - uid: 18650
     components:
     - type: Transform
-      pos: 11.5,56.5
+      pos: 13.5,49.5
       parent: 13329
   - uid: 19158
     components:
@@ -198272,11 +198110,6 @@ entities:
     - type: Transform
       pos: -15.5,-18.5
       parent: 13329
-  - uid: 13345
-    components:
-    - type: Transform
-      pos: 14.5,50.5
-      parent: 13329
   - uid: 15547
     components:
     - type: Transform
@@ -198328,54 +198161,6 @@ entities:
     - type: Transform
       pos: 33.5,42.5
       parent: 13329
-- proto: VehicleJanicartDestroyed
-  entities:
-  - uid: 32456
-    components:
-    - type: Transform
-      pos: 125.5,0.5
-      parent: 13329
-- proto: VehicleKeyATV
-  entities:
-  - uid: 6768
-    components:
-    - type: Transform
-      pos: -38.508892,10.513957
-      parent: 13329
-  - uid: 11850
-    components:
-    - type: Transform
-      pos: 21.546587,-14.529799
-      parent: 13329
-  - uid: 19140
-    components:
-    - type: Transform
-      pos: 7.420335,50.627213
-      parent: 13329
-- proto: VehicleKeyJanicart
-  entities:
-  - uid: 1505
-    components:
-    - type: Transform
-      pos: 2.5370955,10.514563
-      parent: 13329
-- proto: VehicleKeySecway
-  entities:
-  - uid: 10262
-    components:
-    - type: Transform
-      pos: 30.501001,22.600615
-      parent: 13329
-  - uid: 10263
-    components:
-    - type: Transform
-      pos: 30.501001,22.600615
-      parent: 13329
-  - uid: 10601
-    components:
-    - type: Transform
-      pos: 15.48284,15.515955
-      parent: 13329
 - proto: VendingBarDrobe
   entities:
   - uid: 1186
@@ -198575,11 +198360,6 @@ entities:
     - type: Transform
       pos: -19.5,-2.5
       parent: 13329
-  - uid: 18611
-    components:
-    - type: Transform
-      pos: 9.5,47.5
-      parent: 13329
   - uid: 29158
     components:
     - type: Transform
@@ -198782,6 +198562,11 @@ entities:
       parent: 13329
 - proto: VendingMachineMedical
   entities:
+  - uid: 10261
+    components:
+    - type: Transform
+      pos: -1.5,50.5
+      parent: 13329
   - uid: 18560
     components:
     - type: Transform
@@ -217723,11 +217508,6 @@ entities:
     - type: Transform
       pos: 9.5,52.5
       parent: 13329
-  - uid: 17012
-    components:
-    - type: Transform
-      pos: 10.5,52.5
-      parent: 13329
   - uid: 17013
     components:
     - type: Transform
@@ -222398,15 +222178,6 @@ entities:
     - type: Transform
       pos: 90.5,-36.5
       parent: 13329
-- proto: WarpPointBombing
-  entities:
-  - uid: 26272
-    components:
-    - type: Transform
-      pos: 19.5,18.5
-      parent: 13329
-    - type: WarpPoint
-      location: Security Evidence Room
 - proto: WaterCooler
   entities:
   - uid: 4854
@@ -223413,12 +223184,6 @@ entities:
       parent: 13329
 - proto: WindoorSecureMedicalLocked
   entities:
-  - uid: 13336
-    components:
-    - type: Transform
-      rot: 3.141592653589793 rad
-      pos: -0.5,47.5
-      parent: 13329
   - uid: 18827
     components:
     - type: Transform
diff --git a/Resources/Maps/marathon.yml b/Resources/Maps/marathon.yml
index 292f12f5d28..bed5dd26f67 100644
--- a/Resources/Maps/marathon.yml
+++ b/Resources/Maps/marathon.yml
@@ -51792,18 +51792,6 @@ entities:
     - type: Transform
       pos: 6.4995365,21.072325
       parent: 30
-- proto: ClothingEyesGlassesSecurity
-  entities:
-  - uid: 1461
-    components:
-    - type: Transform
-      pos: -43.337395,31.456226
-      parent: 30
-  - uid: 2032
-    components:
-    - type: Transform
-      pos: -44.436646,46.5757
-      parent: 30
 - proto: ClothingEyesGlassesSunglasses
   entities:
   - uid: 683
@@ -52607,48 +52595,6 @@ entities:
     - type: Transform
       pos: -75.60953,-47.39969
       parent: 30
-- proto: ClothingOuterSanta
-  entities:
-  - uid: 18695
-    components:
-    - type: Transform
-      pos: -27.60547,58.54977
-      parent: 30
-  - uid: 18696
-    components:
-    - type: Transform
-      pos: -27.60547,58.54977
-      parent: 30
-  - uid: 18819
-    components:
-    - type: Transform
-      pos: -27.60547,58.54977
-      parent: 30
-  - uid: 18820
-    components:
-    - type: Transform
-      pos: -27.60547,58.54977
-      parent: 30
-  - uid: 18827
-    components:
-    - type: Transform
-      pos: -27.402346,58.377895
-      parent: 30
-  - uid: 18831
-    components:
-    - type: Transform
-      pos: -27.402346,58.377895
-      parent: 30
-  - uid: 18833
-    components:
-    - type: Transform
-      pos: -27.402346,58.377895
-      parent: 30
-  - uid: 18835
-    components:
-    - type: Transform
-      pos: -27.402346,58.377895
-      parent: 30
 - proto: ClothingOuterSuitChicken
   entities:
   - uid: 16151
@@ -102383,6 +102329,21 @@ entities:
     - type: Transform
       pos: -10.326736,-38.446224
       parent: 30
+  - uid: 10012
+    components:
+    - type: Transform
+      pos: -1.4952288,-44.42826
+      parent: 30
+  - uid: 11333
+    components:
+    - type: Transform
+      pos: -1.4344845,-44.759243
+      parent: 30
+  - uid: 19791
+    components:
+    - type: Transform
+      pos: -60.268562,45.564415
+      parent: 30
   - uid: 19792
     components:
     - type: Transform
@@ -141779,21 +141740,4 @@ entities:
     - type: Transform
       pos: -6.388359,64.59328
       parent: 30
-- proto: YellowOxygenTankFilled
-  entities:
-  - uid: 10012
-    components:
-    - type: Transform
-      pos: -1.4952288,-44.42826
-      parent: 30
-  - uid: 11333
-    components:
-    - type: Transform
-      pos: -1.4344845,-44.759243
-      parent: 30
-  - uid: 19791
-    components:
-    - type: Transform
-      pos: -60.268562,45.564415
-      parent: 30
 ...
diff --git a/Resources/Maps/meta.yml b/Resources/Maps/meta.yml
index 9dcc2957164..10fa94ffb03 100644
--- a/Resources/Maps/meta.yml
+++ b/Resources/Maps/meta.yml
@@ -15837,13 +15837,6 @@ entities:
     - type: Transform
       pos: -14.519806,-23.287313
       parent: 5350
-- proto: BoxSechud
-  entities:
-  - uid: 2686
-    components:
-    - type: Transform
-      pos: 2.5457363,42.596703
-      parent: 5350
 - proto: BoxShotgunIncendiary
   entities:
   - uid: 3116
@@ -36249,6 +36242,16 @@ entities:
     - type: Transform
       pos: -25.5,54.5
       parent: 5350
+  - uid: 8415
+    components:
+    - type: Transform
+      pos: -29.5,60.5
+      parent: 5350
+  - uid: 8416
+    components:
+    - type: Transform
+      pos: -30.5,60.5
+      parent: 5350
   - uid: 8621
     components:
     - type: Transform
@@ -36439,6 +36442,16 @@ entities:
     - type: Transform
       pos: 48.5,13.5
       parent: 5350
+  - uid: 9290
+    components:
+    - type: Transform
+      pos: -30.5,62.5
+      parent: 5350
+  - uid: 9291
+    components:
+    - type: Transform
+      pos: -29.5,62.5
+      parent: 5350
   - uid: 9478
     components:
     - type: Transform
@@ -36939,6 +36952,26 @@ entities:
     - type: Transform
       pos: -39.5,52.5
       parent: 5350
+  - uid: 10297
+    components:
+    - type: Transform
+      pos: -28.5,62.5
+      parent: 5350
+  - uid: 10387
+    components:
+    - type: Transform
+      pos: -27.5,62.5
+      parent: 5350
+  - uid: 10388
+    components:
+    - type: Transform
+      pos: -26.5,62.5
+      parent: 5350
+  - uid: 10432
+    components:
+    - type: Transform
+      pos: -25.5,62.5
+      parent: 5350
   - uid: 10550
     components:
     - type: Transform
@@ -39204,6 +39237,11 @@ entities:
     - type: Transform
       pos: 71.5,8.5
       parent: 5350
+  - uid: 14291
+    components:
+    - type: Transform
+      pos: -28.5,60.5
+      parent: 5350
   - uid: 14999
     components:
     - type: Transform
@@ -39214,6 +39252,21 @@ entities:
     - type: Transform
       pos: 72.5,8.5
       parent: 5350
+  - uid: 15639
+    components:
+    - type: Transform
+      pos: -27.5,60.5
+      parent: 5350
+  - uid: 15640
+    components:
+    - type: Transform
+      pos: -26.5,60.5
+      parent: 5350
+  - uid: 15667
+    components:
+    - type: Transform
+      pos: -25.5,60.5
+      parent: 5350
   - uid: 16151
     components:
     - type: Transform
@@ -60283,23 +60336,6 @@ entities:
     - type: Transform
       pos: 54.41529,14.40629
       parent: 5350
-- proto: ClothingEyesGlassesSecurity
-  entities:
-  - uid: 10420
-    components:
-    - type: Transform
-      pos: -3.442388,40.441223
-      parent: 5350
-  - uid: 10421
-    components:
-    - type: Transform
-      pos: -3.458013,40.5506
-      parent: 5350
-  - uid: 10497
-    components:
-    - type: Transform
-      pos: 18.535847,41.55662
-      parent: 5350
 - proto: ClothingEyesGlassesSunglasses
   entities:
   - uid: 2030
@@ -116310,13 +116346,6 @@ entities:
     - type: Transform
       pos: 10.629476,34.365833
       parent: 5350
-- proto: HandheldCrewMonitor
-  entities:
-  - uid: 16241
-    components:
-    - type: Transform
-      pos: -17.467426,-36.423878
-      parent: 5350
 - proto: HandheldGPSBasic
   entities:
   - uid: 3571
@@ -120684,6 +120713,16 @@ entities:
     - type: Transform
       pos: -16.506245,-14.163311
       parent: 5350
+  - uid: 3638
+    components:
+    - type: Transform
+      pos: -43.593536,23.615883
+      parent: 5350
+  - uid: 3639
+    components:
+    - type: Transform
+      pos: -43.374786,23.584633
+      parent: 5350
 - proto: PaintingAmogusTriptych
   entities:
   - uid: 24635
@@ -138869,32 +138908,6 @@ entities:
     - type: Transform
       pos: -3.5,30.5
       parent: 5350
-- proto: SpawnVehicleATV
-  entities:
-  - uid: 24625
-    components:
-    - type: Transform
-      pos: -8.5,-35.5
-      parent: 5350
-- proto: SpawnVehicleJanicart
-  entities:
-  - uid: 9291
-    components:
-    - type: Transform
-      pos: -23.5,28.5
-      parent: 5350
-- proto: SpawnVehicleSecway
-  entities:
-  - uid: 8415
-    components:
-    - type: Transform
-      pos: -4.5,28.5
-      parent: 5350
-  - uid: 10297
-    components:
-    - type: Transform
-      pos: 4.5,34.5
-      parent: 5350
 - proto: SprayBottle
   entities:
   - uid: 14634
@@ -145485,32 +145498,6 @@ entities:
     - type: Transform
       pos: -46.53311,-52.435802
       parent: 5350
-- proto: VehicleKeyATV
-  entities:
-  - uid: 24646
-    components:
-    - type: Transform
-      pos: -7.4760914,-35.418602
-      parent: 5350
-- proto: VehicleKeyJanicart
-  entities:
-  - uid: 9290
-    components:
-    - type: Transform
-      pos: -28.519938,26.44267
-      parent: 5350
-- proto: VehicleKeySecway
-  entities:
-  - uid: 8416
-    components:
-    - type: Transform
-      pos: -2.5585675,29.702742
-      parent: 5350
-  - uid: 10432
-    components:
-    - type: Transform
-      pos: 4.4444723,36.563564
-      parent: 5350
 - proto: VendingBarDrobe
   entities:
   - uid: 3109
@@ -169078,16 +169065,4 @@ entities:
     - type: Transform
       pos: 45.520813,-8.421944
       parent: 5350
-- proto: YellowOxygenTankFilled
-  entities:
-  - uid: 3638
-    components:
-    - type: Transform
-      pos: -43.593536,23.615883
-      parent: 5350
-  - uid: 3639
-    components:
-    - type: Transform
-      pos: -43.374786,23.584633
-      parent: 5350
 ...
diff --git a/Resources/Prototypes/Body/Organs/Animal/animal.yml b/Resources/Prototypes/Body/Organs/Animal/animal.yml
index 358fc74bca6..2f50821df35 100644
--- a/Resources/Prototypes/Body/Organs/Animal/animal.yml
+++ b/Resources/Prototypes/Body/Organs/Animal/animal.yml
@@ -1,5 +1,5 @@
 - type: entity
-  id: BaseAnimalOrgan
+  id: BaseAnimalOrganUnGibbable
   parent: BaseItem
   abstract: true
   components:
@@ -23,6 +23,12 @@
     tags:
       - Meat
 
+- type: entity
+  id: BaseAnimalOrgan
+  parent: BaseAnimalOrganUnGibbable
+  abstract: true
+  components:
+  - type: Gibbable
 
 - type: entity
   id: OrganAnimalLungs
diff --git a/Resources/Prototypes/Body/Organs/human.yml b/Resources/Prototypes/Body/Organs/human.yml
index 6abf168a9e7..fe33c11029f 100644
--- a/Resources/Prototypes/Body/Organs/human.yml
+++ b/Resources/Prototypes/Body/Organs/human.yml
@@ -1,5 +1,5 @@
 - type: entity
-  id: BaseHumanOrgan
+  id: BaseHumanOrganUnGibbable
   parent: BaseItem
   abstract: true
   components:
@@ -27,9 +27,16 @@
     tags:
       - Meat
 
+- type: entity
+  id: BaseHumanOrgan
+  parent: BaseHumanOrganUnGibbable
+  abstract: true
+  components:
+  - type: Gibbable
+
 - type: entity
   id: OrganHumanBrain
-  parent: BaseHumanOrgan
+  parent: BaseHumanOrganUnGibbable
   name: brain
   description: "The source of incredible, unending intelligence. Honk."
   components:
diff --git a/Resources/Prototypes/Body/Parts/animal.yml b/Resources/Prototypes/Body/Parts/animal.yml
index cf65fd21360..4db026b40fb 100644
--- a/Resources/Prototypes/Body/Parts/animal.yml
+++ b/Resources/Prototypes/Body/Parts/animal.yml
@@ -23,6 +23,7 @@
   - type: Tag
     tags:
       - Trash
+  - type: Gibbable
   - type: Extractable
     juiceSolution:
       reagents:
diff --git a/Resources/Prototypes/Body/Parts/base.yml b/Resources/Prototypes/Body/Parts/base.yml
index a27059f59f3..836d0f140af 100644
--- a/Resources/Prototypes/Body/Parts/base.yml
+++ b/Resources/Prototypes/Body/Parts/base.yml
@@ -9,6 +9,7 @@
   - type: Damageable
     damageContainer: Biological
   - type: BodyPart
+  - type: Gibbable
   - type: ContainerContainer
     containers:
       bodypart: !type:Container
diff --git a/Resources/Prototypes/Body/Parts/skeleton.yml b/Resources/Prototypes/Body/Parts/skeleton.yml
index 3f41f88ee54..1b378c62332 100644
--- a/Resources/Prototypes/Body/Parts/skeleton.yml
+++ b/Resources/Prototypes/Body/Parts/skeleton.yml
@@ -14,6 +14,7 @@
         ents: []
   - type: StaticPrice
     price: 20
+  - type: Gibbable
   - type: Tag
     tags:
       - Trash
diff --git a/Resources/Prototypes/Body/Parts/terminator.yml b/Resources/Prototypes/Body/Parts/terminator.yml
index dec0c99f7c2..58530da959c 100644
--- a/Resources/Prototypes/Body/Parts/terminator.yml
+++ b/Resources/Prototypes/Body/Parts/terminator.yml
@@ -16,6 +16,7 @@
     containers:
       bodypart: !type:Container
         ents: []
+  - type: Gibbable
   - type: StaticPrice
     price: 200
 
diff --git a/Resources/Prototypes/Catalog/Fills/Boxes/syndicate.yml b/Resources/Prototypes/Catalog/Fills/Boxes/syndicate.yml
index 41fe404dc49..1de429a50d0 100644
--- a/Resources/Prototypes/Catalog/Fills/Boxes/syndicate.yml
+++ b/Resources/Prototypes/Catalog/Fills/Boxes/syndicate.yml
@@ -40,8 +40,8 @@
   components:
     - type: StorageFill
       contents:
-        - id: PowerCellHigh
-          amount: 1
         - id: ClothingEyesGlassesHiddenSecurity
           amount: 1
+        - id: SurveillanceCameraMonitorCircuitboard
+          amount: 1
 
diff --git a/Resources/Prototypes/Catalog/Fills/Items/belt.yml b/Resources/Prototypes/Catalog/Fills/Items/belt.yml
index 8a27e36f08b..976d2a4307f 100644
--- a/Resources/Prototypes/Catalog/Fills/Items/belt.yml
+++ b/Resources/Prototypes/Catalog/Fills/Items/belt.yml
@@ -84,9 +84,8 @@
       - id: EmergencyMedipen #You never know what people are going to latejoin into
 
 - type: entity
-  id: ClothingBeltParamedicFilled
-  parent: ClothingBeltMedical #in the future, make this a seperate prototype so it can have a unique, darker sprite
-  name: EMT belt
+  id: ClothingBeltMedicalEMTFilled
+  parent: ClothingBeltMedicalEMT
   suffix: Paramedic,Filled
   components:
   - type: StorageFill
diff --git a/Resources/Prototypes/Catalog/Fills/Lockers/dressers.yml b/Resources/Prototypes/Catalog/Fills/Lockers/dressers.yml
index a22c5290cb4..4ca0ac3a744 100644
--- a/Resources/Prototypes/Catalog/Fills/Lockers/dressers.yml
+++ b/Resources/Prototypes/Catalog/Fills/Lockers/dressers.yml
@@ -77,6 +77,8 @@
     contents:
       - id: ClothingNeckCloakQm
       - id: ClothingHeadsetCargo
+      - id: ClothingHeadHatBeretQM
+      - id: ClothingUniformJumpsuitQMFormal
       - id: ClothingUniformJumpsuitQMTurtleneck
       - id: ClothingUniformJumpskirtQMTurtleneck
       - id: ClothingHandsGlovesColorBrown
diff --git a/Resources/Prototypes/Catalog/Fills/Lockers/heads.yml b/Resources/Prototypes/Catalog/Fills/Lockers/heads.yml
index 8ac0b0afe94..0afb9225e8a 100644
--- a/Resources/Prototypes/Catalog/Fills/Lockers/heads.yml
+++ b/Resources/Prototypes/Catalog/Fills/Lockers/heads.yml
@@ -49,7 +49,7 @@
 
 - type: entity
   id: LockerCaptainFilled
-  suffix: Filled
+  suffix: Filled, AntiqueLaser
   parent: LockerCaptain
   components:
   - type: StorageFill
@@ -77,6 +77,31 @@
       - id: ClothingOuterCoatCaptain
       # Corvax-Resprite-End
 
+- type: entity
+  id: LockerCaptainFilledNoLaser
+  suffix: Filled
+  parent: LockerCaptain
+  components:
+  - type: StorageFill
+    contents:
+      - id: ClothingOuterArmorCaptainCarapace
+      - id: NukeDisk
+      - id: PinpointerNuclear
+      - id: CaptainIDCard
+      - id: WeaponDisabler
+      - id: CommsComputerCircuitboard
+      - id: ClothingHeadsetAltCommand
+      - id: SpaceCash1000
+      - id: PlushieNuke
+        prob: 0.1
+      - id: CigarGoldCase
+        prob: 0.25
+      - id: ClothingBeltSheathFilled
+      - id: DoorRemoteCommand
+      - id: RubberStampCaptain
+      - id: JetpackCaptainFilled
+      - id: MedalCase
+
 - type: entity
   id: LockerHeadOfPersonnelFilled
   suffix: Filled
diff --git a/Resources/Prototypes/Catalog/Fills/Lockers/medical.yml b/Resources/Prototypes/Catalog/Fills/Lockers/medical.yml
index 0461538b033..a20a8ac67d3 100644
--- a/Resources/Prototypes/Catalog/Fills/Lockers/medical.yml
+++ b/Resources/Prototypes/Catalog/Fills/Lockers/medical.yml
@@ -141,5 +141,6 @@
       - id: ClothingHandsGlovesLatex
       - id: ClothingHeadsetMedical
       - id: ClothingMaskSterile
+      - id: HandheldGPSBasic
       - id: MedkitFilled
         prob: 0.3
diff --git a/Resources/Prototypes/Catalog/VendingMachines/Inventories/sec.yml b/Resources/Prototypes/Catalog/VendingMachines/Inventories/sec.yml
index 695f7e98afc..b1152f42ab9 100644
--- a/Resources/Prototypes/Catalog/VendingMachines/Inventories/sec.yml
+++ b/Resources/Prototypes/Catalog/VendingMachines/Inventories/sec.yml
@@ -8,6 +8,7 @@
     ClusterBangFull: 2
     GrenadeStinger: 4
     Flash: 5
+    Tourniquet: 5
     FlashlightSeclite: 5
     ClothingEyesGlassesSunglasses: 2
     ClothingEyesHudSecurity: 2
diff --git a/Resources/Prototypes/Corvax/Entities/Mobs/NPCs/pets.yml b/Resources/Prototypes/Corvax/Entities/Mobs/NPCs/pets.yml
index e8218c85ee7..341bd81d960 100644
--- a/Resources/Prototypes/Corvax/Entities/Mobs/NPCs/pets.yml
+++ b/Resources/Prototypes/Corvax/Entities/Mobs/NPCs/pets.yml
@@ -37,6 +37,7 @@
     - type: Bloodstream
       bloodMaxVolume: 300
     - type: Puller
+      needsHands: false
     - type: InteractionPopup
       successChance: 1
       interactSuccessString: petting-success-gorilla
diff --git a/Resources/Prototypes/Damage/modifier_sets.yml b/Resources/Prototypes/Damage/modifier_sets.yml
index bf88837e8da..8a7b84ff1a7 100644
--- a/Resources/Prototypes/Damage/modifier_sets.yml
+++ b/Resources/Prototypes/Damage/modifier_sets.yml
@@ -52,12 +52,9 @@
   id: PerforatedMetallic
   coefficients:
     Blunt: 2
-    Slash: 0.6
     Piercing: 0.2
-    Shock: 1.2
+    Shock: 0.6
   flatReductions:
-    Blunt: 5
-    Heat: 5
     Piercing: 10
 
 # for fragile electronics like consoles or shuttle engines.
diff --git a/Resources/Prototypes/Datasets/criminal_records.yml b/Resources/Prototypes/Datasets/criminal_records.yml
new file mode 100644
index 00000000000..ee283091843
--- /dev/null
+++ b/Resources/Prototypes/Datasets/criminal_records.yml
@@ -0,0 +1,18 @@
+# "funny" placeholders of extremely minor/non-crimes for wanted reason dialog
+- type: dataset
+  id: CriminalRecordsWantedReasonPlaceholders
+  values:
+  - Ate their own shoes
+  - Being a clown
+  - Being a mime
+  - Breathed the wrong way
+  - Broke into evac
+  - Did literally nothing
+  - Didn't say hello to me
+  - Drank one too many
+  - Lied on common radio
+  - Looked at me funny
+  - Slipped the HoS
+  - Stole the clown's mask
+  - Told an unfunny joke
+  - Wore a gasmask
diff --git a/Resources/Prototypes/Entities/Clothing/Belt/belts.yml b/Resources/Prototypes/Entities/Clothing/Belt/belts.yml
index de6c7754695..0effc02da61 100644
--- a/Resources/Prototypes/Entities/Clothing/Belt/belts.yml
+++ b/Resources/Prototypes/Entities/Clothing/Belt/belts.yml
@@ -303,6 +303,17 @@
     sprite: Clothing/Belt/belt_overlay.rsi
   - type: Appearance
 
+- type: entity
+  parent: ClothingBeltMedical
+  id: ClothingBeltMedicalEMT
+  name: EMT belt
+  description: Perfect for holding various equipment for medical emergencies.
+  components:
+  - type: Sprite
+    sprite: Clothing/Belt/emt.rsi
+  - type: Clothing
+    sprite: Clothing/Belt/emt.rsi
+
 - type: entity
   parent: ClothingBeltStorageBase
   id: ClothingBeltPlant
diff --git a/Resources/Prototypes/Entities/Clothing/Eyes/glasses.yml b/Resources/Prototypes/Entities/Clothing/Eyes/glasses.yml
index e969118bbee..5b6380cb0ef 100644
--- a/Resources/Prototypes/Entities/Clothing/Eyes/glasses.yml
+++ b/Resources/Prototypes/Entities/Clothing/Eyes/glasses.yml
@@ -122,7 +122,6 @@
     sprite: Clothing/Eyes/Glasses/outlawglasses.rsi
   - type: VisionCorrection
   - type: IdentityBlocker
-    coverage: EYES
 
 - type: entity
   parent: ClothingEyesBase
diff --git a/Resources/Prototypes/Entities/Clothing/Head/bandanas.yml b/Resources/Prototypes/Entities/Clothing/Head/bandanas.yml
index 1d1d5878602..8ee6479ee65 100644
--- a/Resources/Prototypes/Entities/Clothing/Head/bandanas.yml
+++ b/Resources/Prototypes/Entities/Clothing/Head/bandanas.yml
@@ -1,114 +1,72 @@
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadBaseButcherable, BaseFoldable]
+  id: ClothingHeadBandBase
+  abstract: true
+  components:
+  - type: Foldable
+    folded: true
+  - type: Mask
+    isToggled: true
+  - type: IngestionBlocker
+    enabled: false
+  - type: IdentityBlocker
+    enabled: false
+    coverage: MOUTH
+  - type: Sprite # needed for vendor inventory icons
+    layers:
+    - state: icon
+      map: ["foldedLayer"]
+      visible: true
+    - state: icon_mask
+      map: [ "unfoldedLayer" ]
+      visible: false
+
+- type: entity
+  parent: [ClothingHeadBandBase, ClothingMaskBandBlack]
   id: ClothingHeadBandBlack
   name: black bandana
-  description: A black bandana to make you look cool.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Bandanas/black.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Bandanas/black.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadBandBase, ClothingMaskBandBlue]
   id: ClothingHeadBandBlue
   name: blue bandana
-  description: A blue bandana to make you look cool.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Bandanas/blue.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Bandanas/blue.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadBandBase, ClothingMaskBandBotany]
   id: ClothingHeadBandBotany
   name: botany bandana
-  description: A botany bandana to make you look cool, made from natural fibers.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Bandanas/botany.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Bandanas/botany.rsi
-  - type: Tag
-    tags:
-    - ClothMade
-    - HamsterWearable
-    - WhitelistChameleon
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadBandBase, ClothingMaskBandGold]
   id: ClothingHeadBandGold
   name: gold bandana
-  description: A gold bandana to make you look cool.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Bandanas/gold.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Bandanas/gold.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadBandBase, ClothingMaskBandGreen]
   id: ClothingHeadBandGreen
   name: green bandana
-  description: A green bandana to make you look cool.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Bandanas/green.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Bandanas/green.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadBandBase, ClothingMaskBandGrey]
   id: ClothingHeadBandGrey
   name: grey bandana
-  description: A grey bandana to make you look cool.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Bandanas/grey.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Bandanas/grey.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadBandBase, ClothingMaskBandRed]
   id: ClothingHeadBandRed
   name: red bandana
-  description: A red bandana to make you look cool.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Bandanas/red.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Bandanas/red.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadBandBase, ClothingMaskBandSkull]
   id: ClothingHeadBandSkull
   name: skull bandana
-  description: A bandana with a skull to make you look even cooler.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Bandanas/skull.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Bandanas/skull.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadBandBase, ClothingMaskBandMerc]
   id: ClothingHeadBandMerc
   name: mercenary bandana
-  description: To protect the head from the sun, insects and other dangers of the higher path.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Bandanas/merc.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Bandanas/merc.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadBandBase, ClothingMaskBandBrown]
   id: ClothingHeadBandBrown
-  name: brown bandana
-  description: A brown bandana to make you look cool.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Bandanas/brown.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Bandanas/brown.rsi
+  name: brown bandana
\ No newline at end of file
diff --git a/Resources/Prototypes/Entities/Clothing/Head/hats.yml b/Resources/Prototypes/Entities/Clothing/Head/hats.yml
index dd8af5eb583..9b0e9583ee6 100644
--- a/Resources/Prototypes/Entities/Clothing/Head/hats.yml
+++ b/Resources/Prototypes/Entities/Clothing/Head/hats.yml
@@ -84,6 +84,22 @@
     - HamsterWearable
     - WhitelistChameleon
 
+- type: entity
+  parent: ClothingHeadBase
+  id: ClothingHeadHatBeretQM
+  name: quartermaster's beret
+  description: A beret with the cargo's insignia emblazoned on it. For quartermasters that are more inclined towards style.
+  components:
+  - type: Sprite
+    sprite: Clothing/Head/Hats/beret_qm.rsi
+  - type: Clothing
+    sprite: Clothing/Head/Hats/beret_qm.rsi
+  - type: Tag
+    tags:
+    - ClothMade
+    - HamsterWearable
+    - WhitelistChameleon
+
 - type: entity
   parent: ClothingHeadBase
   id: ClothingHeadHatBeretHoS
@@ -963,4 +979,49 @@
     - type: Sprite
       sprite: Clothing/Head/Hats/cowboyhatbountyhunter.rsi
     - type: Clothing
-      sprite: Clothing/Head/Hats/cowboyhatbountyhunter.rsi
\ No newline at end of file
+      sprite: Clothing/Head/Hats/cowboyhatbountyhunter.rsi
+
+- type: entity
+  parent: ClothingHeadBase
+  id: ClothingHeadHatStrawHat
+  name: straw hat
+  description: A fancy hat for hot days! Not recommended to wear near fires.
+  components:
+  - type: Sprite
+    sprite: Clothing/Head/Hats/straw_hat.rsi
+  - type: Clothing
+    sprite: Clothing/Head/Hats/straw_hat.rsi
+  - type: Construction
+    graph: StrawHat
+    node: strawhat
+  - type: Tag
+    tags:
+    - HamsterWearable
+  - type: Flammable
+    fireSpread: true
+    canResistFire: false
+    alwaysCombustible: true
+    canExtinguish: true
+    damage:
+      types:
+        Heat: 1
+  - type: Damageable
+    damageModifierSet: Wood
+  - type: Appearance
+  - type: FireVisuals
+    sprite: Effects/fire.rsi
+    normalState: fire
+  - type: Destructible
+    thresholds:
+    - trigger:
+        !type:DamageTrigger
+        damage: 15
+      behaviors:
+      - !type:SpawnEntitiesBehavior
+        spawn:
+            Ash:
+              min: 1
+              max: 1
+      - !type:DoActsBehavior
+        acts: [ "Destruction" ]
+
diff --git a/Resources/Prototypes/Entities/Clothing/Head/soft.yml b/Resources/Prototypes/Entities/Clothing/Head/soft.yml
index 50be724c415..d063b8e8534 100644
--- a/Resources/Prototypes/Entities/Clothing/Head/soft.yml
+++ b/Resources/Prototypes/Entities/Clothing/Head/soft.yml
@@ -1,5 +1,47 @@
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadBaseButcherable, BaseFoldable]
+  id: ClothingHeadHeadHatBaseFlippable
+  abstract: true
+  components:
+  - type: Appearance
+  - type: Foldable
+    canFoldInsideContainer: true
+    unfoldVerbText: fold-flip-verb
+    foldVerbText: fold-flip-verb
+  - type: FoldableClothing
+    foldedEquippedPrefix: flipped
+    foldedHeldPrefix: flipped
+  - type: Sprite
+    layers:
+    - state: icon
+      map: [ "unfoldedLayer" ]
+    - state: icon_flipped
+      map: ["foldedLayer"]
+      visible: false
+      
+- type: entity
+  parent: ClothingHeadHeadHatBaseFlippable
+  id: ClothingHeadHeadHatBaseFlipped
+  suffix: flipped
+  abstract: true
+  components:
+  - type: Foldable
+    folded: true
+  - type: Clothing
+    equippedPrefix: flipped
+  - type: Item
+    heldPrefix: flipped
+  - type: Sprite
+    layers:
+    - state: icon
+      map: [ "unfoldedLayer" ]
+      visible: false
+    - state: icon_flipped
+      map: ["foldedLayer"]
+      visible: true
+
+- type: entity
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatBluesoft
   name: blue cap
   description: "It's a baseball hat in a tasteless blue colour."
@@ -10,18 +52,12 @@
     sprite: Clothing/Head/Soft/bluesoft.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatBluesoft]
   id: ClothingHeadHatBluesoftFlipped
-  name: blue cap flipped
-  description: "It's a baseball hat in a tasteless blue colour. Flipped."
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/bluesoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/bluesoft_flipped.rsi
+  name: blue cap
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatCargosoft
   name: cargo cap
   description: "It's a baseball hat painted in Cargo colours."
@@ -37,18 +73,18 @@
     - WhitelistChameleon
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatCargosoft]
   id: ClothingHeadHatCargosoftFlipped
-  name: cargo cap flipped
-  description: "It's a baseball hat painted in Cargo colours. Flipped."
+  name: cargo cap
   components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/cargosoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/cargosoft_flipped.rsi
+  - type: Tag
+    tags:
+    - ClothMade
+    - HamsterWearable
+    - WhitelistChameleon
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatQMsoft
   name: quartermaster's cap
   description: "It's a baseball hat painted in the Quartermaster's colors."
@@ -59,18 +95,12 @@
     sprite: Clothing/Head/Soft/qmsoft.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatQMsoft]
   id: ClothingHeadHatQMsoftFlipped
-  name: quartermaster's cap flipped
-  description: "It's a baseball hat painted in the Quartermaster's colors. Flipped."
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/qmsoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/qmsoft_flipped.rsi
+  name: quartermaster's cap
     
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatCorpsoft
   name: corporate cap
   description: A baseball bat in corporation colors.
@@ -81,18 +111,12 @@
     sprite: Clothing/Head/Soft/corpsoft.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatCorpsoft]
   id: ClothingHeadHatCorpsoftFlipped
-  name: corporate cap flipped
-  description: A baseball bat in corporation colors. Flipped.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/corpsoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/corpsoft_flipped.rsi
+  name: corporate cap
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatGreensoft
   name: green cap
   description: "It's a baseball hat in a tasteless green colour."
@@ -103,18 +127,12 @@
     sprite: Clothing/Head/Soft/greensoft.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatGreensoft]
   id: ClothingHeadHatGreensoftFlipped
-  name: green cap flipped
-  description: "It's a baseball hat in a tasteless green colour. Flipped."
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/greensoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/greensoft_flipped.rsi
+  name: green cap
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatBlacksoft
   name: black cap
   description: "It's a baseball hat in a tasteless black colour."
@@ -125,18 +143,12 @@
     sprite: Clothing/Head/Soft/blacksoft.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatBlacksoft]
   id: ClothingHeadHatBlacksoftFlipped
-  name: black cap flipped
-  description: "It's a baseball hat in a tasteless black colour. Flipped."
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/blacksoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/blacksoft_flipped.rsi
+  name: black cap
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatGreysoft
   name: grey cap
   description: "It's a baseball hat in a tasteless grey colour."
@@ -147,18 +159,12 @@
     sprite: Clothing/Head/Soft/greysoft.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatGreysoft]
   id: ClothingHeadHatGreysoftFlipped
-  name: grey cap flipped
-  description: "It's a baseball hat in a tasteless grey colour. Flipped."
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/greysoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/greysoft_flipped.rsi
+  name: grey cap
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatMimesoft
   name: mime cap
   description: "It's a baseball hat in a tasteless white colour."
@@ -169,18 +175,12 @@
     sprite: Clothing/Head/Soft/mimesoft.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatMimesoft]
   id: ClothingHeadHatMimesoftFlipped
-  name: mime cap flipped
-  description: It's a baseball hat in a tasteless white colour. Flipped.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/mimesoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/mimesoft_flipped.rsi
+  name: mime cap
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatOrangesoft
   name: orange cap
   description: It's a baseball hat in a good-looking orange colour.
@@ -191,18 +191,12 @@
     sprite: Clothing/Head/Soft/orangesoft.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatOrangesoft]
   id: ClothingHeadHatOrangesoftFlipped
-  name: orange cap flipped
-  description: It's a baseball hat in a good-looking orange colour. Flipped.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/orangesoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/orangesoft_flipped.rsi
+  name: orange cap
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatPurplesoft
   name: purple cap
   description: It's a baseball hat in a tasteless purple colour.
@@ -218,18 +212,18 @@
     - WhitelistChameleon
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatPurplesoft]
   id: ClothingHeadHatPurplesoftFlipped
-  name: purple cap flipped
-  description: It's a baseball hat in a tasteless purple colour. Flipped.
+  name: purple cap
   components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/purplesoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/purplesoft_flipped.rsi
+  - type: Tag
+    tags:
+    - ClothMade
+    - HamsterWearable
+    - WhitelistChameleon
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatRedsoft
   name: red cap
   description: It's a baseball hat in a tasteless red colour.
@@ -240,18 +234,12 @@
     sprite: Clothing/Head/Soft/redsoft.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatRedsoft]
   id: ClothingHeadHatRedsoftFlipped
-  name: red cap flipped
-  description: It's a baseball hat in a tasteless purple colour. Flipped.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/redsoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/redsoft_flipped.rsi
+  name: red cap
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatSecsoft
   name: security cap
   description: It's a robust baseball hat in tasteful red colour.
@@ -262,18 +250,12 @@
     sprite: Clothing/Head/Soft/secsoft.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatSecsoft]
   id: ClothingHeadHatSecsoftFlipped
-  name: security cap flipped
-  description: It's a robust baseball hat in tasteful red colour. Flipped.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/secsoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/secsoft_flipped.rsi
+  name: security cap
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatYellowsoft
   name: yellow cap
   description: A yellow baseball hat.
@@ -284,20 +266,14 @@
     sprite: Clothing/Head/Soft/yellowsoft.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatYellowsoft]
   id: ClothingHeadHatYellowsoftFlipped
-  name: yellow cap flipped
-  description: A yellow flipped baseball hat.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/yellowsoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/yellowsoft_flipped.rsi
+  name: yellow cap
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatBizarreSoft
-  name: troublemaker's soft
+  name: troublemaker's cap
   description: A truly.. bizarre accessory.
   components:
   - type: Sprite
@@ -306,18 +282,12 @@
     sprite: Clothing/Head/Soft/bizarresoft.rsi
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatBizarreSoft]
   id: ClothingHeadHatBizarreSoftFlipped
-  name: troublemaker's soft flipped
-  description: A truly.. bizarre accessory, flipped.
-  components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/bizarresoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/bizarresoft_flipped.rsi
+  name: troublemaker's cap
     
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: ClothingHeadHeadHatBaseFlippable
   id: ClothingHeadHatParamedicsoft
   name: paramedic cap
   description: "It's a paramedic's baseball hat with a medical logo."
@@ -333,12 +303,12 @@
     - WhitelistChameleon
 
 - type: entity
-  parent: ClothingHeadBaseButcherable
+  parent: [ClothingHeadHeadHatBaseFlipped, ClothingHeadHatParamedicsoft]
   id: ClothingHeadHatParamedicsoftFlipped
-  name: paramedic cap flipped
-  description: "It's a paramedic's baseball hat with a medical logo. Flipped."
+  name: paramedic cap
   components:
-  - type: Sprite
-    sprite: Clothing/Head/Soft/paramedicsoft_flipped.rsi
-  - type: Clothing
-    sprite: Clothing/Head/Soft/paramedicsoft_flipped.rsi
+  - type: Tag
+    tags:
+    - ClothMade
+    - HamsterWearable
+    - WhitelistChameleon
diff --git a/Resources/Prototypes/Entities/Clothing/Masks/bandanas.yml b/Resources/Prototypes/Entities/Clothing/Masks/bandanas.yml
new file mode 100644
index 00000000000..c008a755ee7
--- /dev/null
+++ b/Resources/Prototypes/Entities/Clothing/Masks/bandanas.yml
@@ -0,0 +1,138 @@
+- type: entity
+  parent: [ClothingMaskBaseButcherable, BaseFoldable]
+  id: ClothingMaskBandanaBase
+  abstract: true
+  components:
+  - type: Appearance
+  - type: Foldable
+    canFoldInsideContainer: true
+  - type: FoldableClothing
+    foldedSlots:
+    - HEAD
+    unfoldedSlots:
+    - MASK
+  - type: Mask
+  - type: IngestionBlocker
+  - type: IdentityBlocker
+    coverage: MOUTH
+  - type: Sprite
+    layers:
+    - state: icon_mask
+      map: [ "unfoldedLayer" ]
+    - state: icon
+      map: ["foldedLayer"]
+      visible: false
+
+- type: entity
+  parent: ClothingMaskBandanaBase
+  id: ClothingMaskBandBlack
+  name: black bandana
+  description: A black bandana to make you look cool.
+  components:
+  - type: Sprite
+    sprite: Clothing/Head/Bandanas/black.rsi
+  - type: Clothing
+    sprite: Clothing/Head/Bandanas/black.rsi
+
+- type: entity
+  parent: ClothingMaskBandanaBase
+  id: ClothingMaskBandBlue
+  name: blue bandana
+  description: A blue bandana to make you look cool.
+  components:
+  - type: Sprite
+    sprite: Clothing/Head/Bandanas/blue.rsi
+  - type: Clothing
+    sprite: Clothing/Head/Bandanas/blue.rsi
+
+- type: entity
+  parent: ClothingMaskBandanaBase
+  id: ClothingMaskBandBotany
+  name: botany bandana
+  description: A botany bandana to make you look cool, made from natural fibers.
+  components:
+  - type: Sprite
+    sprite: Clothing/Head/Bandanas/botany.rsi
+  - type: Clothing
+    sprite: Clothing/Head/Bandanas/botany.rsi
+  - type: Tag
+    tags:
+    - ClothMade
+    - WhitelistChameleon
+
+- type: entity
+  parent: ClothingMaskBandanaBase
+  id: ClothingMaskBandGold
+  name: gold bandana
+  description: A gold bandana to make you look cool.
+  components:
+  - type: Sprite
+    sprite: Clothing/Head/Bandanas/gold.rsi
+  - type: Clothing
+    sprite: Clothing/Head/Bandanas/gold.rsi
+
+- type: entity
+  parent: ClothingMaskBandanaBase
+  id: ClothingMaskBandGreen
+  name: green bandana
+  description: A green bandana to make you look cool.
+  components:
+  - type: Sprite
+    sprite: Clothing/Head/Bandanas/green.rsi
+  - type: Clothing
+    sprite: Clothing/Head/Bandanas/green.rsi
+
+- type: entity
+  parent: ClothingMaskBandanaBase
+  id: ClothingMaskBandGrey
+  name: grey bandana
+  description: A grey bandana to make you look cool.
+  components:
+  - type: Sprite
+    sprite: Clothing/Head/Bandanas/grey.rsi
+  - type: Clothing
+    sprite: Clothing/Head/Bandanas/grey.rsi
+
+- type: entity
+  parent: ClothingMaskBandanaBase
+  id: ClothingMaskBandRed
+  name: red bandana
+  description: A red bandana to make you look cool.
+  components:
+  - type: Sprite
+    sprite: Clothing/Head/Bandanas/red.rsi
+  - type: Clothing
+    sprite: Clothing/Head/Bandanas/red.rsi
+
+- type: entity
+  parent: ClothingMaskBandanaBase
+  id: ClothingMaskBandSkull
+  name: skull bandana
+  description: A bandana with a skull to make you look even cooler.
+  components:
+  - type: Sprite
+    sprite: Clothing/Head/Bandanas/skull.rsi
+  - type: Clothing
+    sprite: Clothing/Head/Bandanas/skull.rsi
+
+- type: entity
+  parent: ClothingMaskBandanaBase
+  id: ClothingMaskBandMerc
+  name: mercenary bandana
+  description: To protect the head from the sun, insects and other dangers of the higher path.
+  components:
+  - type: Sprite
+    sprite: Clothing/Head/Bandanas/merc.rsi
+  - type: Clothing
+    sprite: Clothing/Head/Bandanas/merc.rsi
+
+- type: entity
+  parent: ClothingMaskBandanaBase
+  id: ClothingMaskBandBrown
+  name: brown bandana
+  description: A brown bandana to make you look cool.
+  components:
+  - type: Sprite
+    sprite: Clothing/Head/Bandanas/brown.rsi
+  - type: Clothing
+    sprite: Clothing/Head/Bandanas/brown.rsi
diff --git a/Resources/Prototypes/Entities/Clothing/Masks/base_clothingmask.yml b/Resources/Prototypes/Entities/Clothing/Masks/base_clothingmask.yml
index d57065ba79a..3531a26a6c5 100644
--- a/Resources/Prototypes/Entities/Clothing/Masks/base_clothingmask.yml
+++ b/Resources/Prototypes/Entities/Clothing/Masks/base_clothingmask.yml
@@ -27,3 +27,26 @@
     icon: { sprite: Clothing/Mask/gas.rsi, state: icon }
     iconOn: Interface/Default/blocked.png
     event: !type:ToggleMaskEvent
+
+- type: entity
+  id: ClothingMaskBaseButcherable
+  parent: ClothingMaskBase
+  abstract: true
+  components:
+  - type: Butcherable
+    butcheringType: Knife
+    spawned:
+    - id: MaterialCloth1
+      amount: 1
+  - type: Food
+    requiresSpecialDigestion: true
+  - type: SolutionContainerManager
+    solutions:
+      food:
+        maxVol: 10
+        reagents:
+        - ReagentId: Fiber
+          Quantity: 10
+  - type: Tag
+    tags:
+      - ClothMade
\ No newline at end of file
diff --git a/Resources/Prototypes/Entities/Clothing/Uniforms/jumpsuits.yml b/Resources/Prototypes/Entities/Clothing/Uniforms/jumpsuits.yml
index e8f6520d5cc..57735ecdd6c 100644
--- a/Resources/Prototypes/Entities/Clothing/Uniforms/jumpsuits.yml
+++ b/Resources/Prototypes/Entities/Clothing/Uniforms/jumpsuits.yml
@@ -493,6 +493,17 @@
     - type: Clothing
       sprite: Clothing/Uniforms/Jumpsuit/qmturtle.rsi
 
+- type: entity
+  parent: ClothingUniformBase
+  id: ClothingUniformJumpsuitQMFormal
+  name: quartermasters's formal suit
+  description: Inspired by the quartermasters of military's past, the perfect outfit for supplying a formal occasion.
+  components:
+    - type: Sprite
+      sprite: Clothing/Uniforms/Jumpsuit/qmformal.rsi
+    - type: Clothing
+      sprite: Clothing/Uniforms/Jumpsuit/qmformal.rsi
+
 - type: entity
   parent: ClothingUniformBase
   id: ClothingUniformJumpsuitResearchDirector
@@ -1447,4 +1458,4 @@
   - type: Sprite
     sprite: Clothing/Uniforms/Jumpsuit/familiar_garbs.rsi
   - type: Clothing
-    sprite: Clothing/Uniforms/Jumpsuit/familiar_garbs.rsi
\ No newline at end of file
+    sprite: Clothing/Uniforms/Jumpsuit/familiar_garbs.rsi
diff --git a/Resources/Prototypes/Entities/Markers/Spawners/Random/Food_Drinks/donkpocketbox.yml b/Resources/Prototypes/Entities/Markers/Spawners/Random/Food_Drinks/donkpocketbox.yml
index cf7b2a5e869..fb52cd1c40d 100644
--- a/Resources/Prototypes/Entities/Markers/Spawners/Random/Food_Drinks/donkpocketbox.yml
+++ b/Resources/Prototypes/Entities/Markers/Spawners/Random/Food_Drinks/donkpocketbox.yml
@@ -14,6 +14,7 @@
         - FoodBoxDonkpocketSpicy
         - FoodBoxDonkpocketTeriyaki
         - FoodBoxDonkpocketPizza
+        - FoodBoxDonkpocketStonk
         - FoodBoxDonkpocketBerry
         - FoodBoxDonkpocketHonk
         - FoodBoxDonkpocketDink
diff --git a/Resources/Prototypes/Entities/Mobs/NPCs/animals.yml b/Resources/Prototypes/Entities/Mobs/NPCs/animals.yml
index f6ba7626638..1251884965e 100644
--- a/Resources/Prototypes/Entities/Mobs/NPCs/animals.yml
+++ b/Resources/Prototypes/Entities/Mobs/NPCs/animals.yml
@@ -58,8 +58,6 @@
     damage:
       types:
         Piercing: 5
-  - type: Puller
-    needsHands: true
   - type: Tag
     tags:
     - VimPilot
@@ -122,8 +120,6 @@
   - type: HTN
     rootTask:
       task: SimpleHostileCompound
-  - type: Puller
-    needsHands: true
   - type: ZombieImmune
 
 - type: entity
@@ -229,12 +225,10 @@
     accent: chicken
   - type: SentienceTarget
     flavorKind: station-event-random-sentience-flavor-organic
-  - type: Puller
-    needsHands: true
   - type: NpcFactionMember
     factions:
     - Passive
-    
+
 - type: entity
   parent: MobChicken
   id: MobChicken1
@@ -259,7 +253,7 @@
         Base: dead-1
       Dead:
         Base: dead-1
-        
+
 - type: entity
   parent: MobChicken
   id: MobChicken2
@@ -699,8 +693,6 @@
     bloodMaxVolume: 0.1
   - type: MobPrice
     price: 50
-  - type: Puller
-    needsHands: true
 
 - type: entity
   name: cow
@@ -983,7 +975,6 @@
       path: /Audio/Animals/goose_honk.ogg
   - type: Bloodstream
     bloodMaxVolume: 100
-  - type: Puller
   - type: NpcFactionMember
     factions:
     - Passive
@@ -1040,7 +1031,6 @@
   - type: HTN
     rootTask:
       task: SimpleHostileCompound
-  - type: Puller
 
 - type: entity
   name: kangaroo
@@ -1299,7 +1289,7 @@
   - type: GhostTakeoverAvailable
   - type: Loadout
     prototypes: [SyndicateOperativeGearMonkey]
-  
+
 - type: entity
   id: MobMonkeySyndicateAgent
   parent: MobBaseSyndicateMonkey
@@ -1587,8 +1577,6 @@
   - type: CanEscapeInventory
   - type: MobPrice
     price: 50
-  - type: Puller
-    needsHands: true
   - type: BadFood
   - type: NonSpreaderZombie
   - type: PreventSpiller
@@ -1721,8 +1709,6 @@
   - type: Damageable
     damageContainer: Biological
     damageModifierSet: Scale
-  - type: Puller
-    needsHands: true
   - type: Tag
     tags:
     - VimPilot
@@ -1826,8 +1812,6 @@
       path: /Audio/Animals/frog_ribbit.ogg
   - type: Bloodstream
     bloodMaxVolume: 50
-  - type: Puller
-    needsHands: true
   - type: Tag
     tags:
     - VimPilot
@@ -2052,8 +2036,6 @@
   - type: Damageable
     damageContainer: Biological
     damageModifierSet: Scale
-  - type: Puller
-    needsHands: true
 
 # Code unique spider prototypes or combine them all into one spider and get a
 # random sprite state when you spawn it.
@@ -2240,6 +2222,9 @@
         collection: FootstepClownFast
     - type: Speech
       speechVerb: Cluwne
+    - type: Bloodstream
+      bloodMaxVolume: 150
+      bloodReagent: Laughter
 
 - type: entity
   name: possum
@@ -2497,7 +2482,6 @@
       gender: epicene
   - type: SentienceTarget
     flavorKind: station-event-random-sentience-flavor-corgi
-  - type: Puller
   - type: MobPrice
     price: 200
   - type: Tag
diff --git a/Resources/Prototypes/Entities/Mobs/NPCs/behonker.yml b/Resources/Prototypes/Entities/Mobs/NPCs/behonker.yml
index 3b3b9b44120..bc63deeac36 100644
--- a/Resources/Prototypes/Entities/Mobs/NPCs/behonker.yml
+++ b/Resources/Prototypes/Entities/Mobs/NPCs/behonker.yml
@@ -112,6 +112,9 @@
           Radiation: 10
     - type: Input
       context: "human"
+    - type: Bloodstream
+      bloodMaxVolume: 300
+      bloodReagent: Laughter
 
 - type: entity
   name: behonker
diff --git a/Resources/Prototypes/Entities/Mobs/NPCs/simplemob.yml b/Resources/Prototypes/Entities/Mobs/NPCs/simplemob.yml
index edf89e30b42..12ea40b1e3c 100644
--- a/Resources/Prototypes/Entities/Mobs/NPCs/simplemob.yml
+++ b/Resources/Prototypes/Entities/Mobs/NPCs/simplemob.yml
@@ -104,6 +104,3 @@
   - type: MobPrice
     price: 150
   - type: FloatingVisuals
-  - type: Puller
-    needsHands: True
-
diff --git a/Resources/Prototypes/Entities/Mobs/Player/guardian.yml b/Resources/Prototypes/Entities/Mobs/Player/guardian.yml
index 06eda05ee15..d892b31fac3 100644
--- a/Resources/Prototypes/Entities/Mobs/Player/guardian.yml
+++ b/Resources/Prototypes/Entities/Mobs/Player/guardian.yml
@@ -85,6 +85,7 @@
       altDisarm: false
       animation: WeaponArcFist
       attackRate: 1.8
+      autoAttack: true
       damage:
         types:
           Blunt: 20
diff --git a/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks-cartons.yml b/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks-cartons.yml
index 345611bd87f..cab95b0803b 100644
--- a/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks-cartons.yml
+++ b/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks-cartons.yml
@@ -36,7 +36,23 @@
     solution: drink
 
 - type: entity
-  parent: DrinkCartonBaseFull
+  id: DrinkCartonVisualsOpenable
+  abstract: true
+  components:
+  - type: Appearance
+  - type: GenericVisualizer
+    visuals:
+      enum.OpenableVisuals.Opened:
+        enum.OpenableVisuals.Layer:
+          True: {state: "icon_open"}
+          False: {state: "icon"}
+  - type: Sprite
+    layers:
+      - state: icon
+        map: ["enum.OpenableVisuals.Layer"]
+
+- type: entity
+  parent: [DrinkCartonVisualsOpenable, DrinkCartonBaseFull]
   id: DrinkJuiceLimeCarton
   name: lime juice
   description: Sweet-sour goodness.
@@ -51,7 +67,7 @@
     sprite: Objects/Consumable/Drinks/limejuice.rsi
 
 - type: entity
-  parent: DrinkCartonBaseFull
+  parent: [DrinkCartonVisualsOpenable, DrinkCartonBaseFull]
   id: DrinkJuiceOrangeCarton
   name: orange juice
   description: Full of vitamins and deliciousness!
@@ -66,7 +82,7 @@
     sprite: Objects/Consumable/Drinks/orangejuice.rsi
 
 - type: entity
-  parent: DrinkCartonBaseFull
+  parent: [DrinkCartonVisualsOpenable, DrinkCartonBaseFull]
   id: DrinkJuiceTomatoCarton
   name: tomato juice
   description: Well, at least it LOOKS like tomato juice. You can't tell with all that redness.
@@ -81,7 +97,7 @@
     sprite: Objects/Consumable/Drinks/tomatojuice.rsi
 
 - type: entity
-  parent: DrinkCartonBaseFull
+  parent: [DrinkCartonVisualsOpenable, DrinkCartonBaseFull]
   id: DrinkCreamCarton
   name: milk cream
   description: It's cream. Made from milk. What else did you think you'd find in there?
@@ -96,7 +112,7 @@
     sprite: Objects/Consumable/Drinks/cream.rsi
 
 - type: entity
-  parent: DrinkCartonBaseFull
+  parent: [DrinkCartonVisualsOpenable, DrinkCartonBaseFull]
   id: DrinkMilkCarton
   name: milk
   description: An opaque white liquid produced by the mammary glands of mammals.
@@ -112,7 +128,7 @@
     sprite: Objects/Consumable/Drinks/milk.rsi
 
 - type: entity
-  parent: DrinkCartonBaseFull
+  parent: [DrinkCartonVisualsOpenable, DrinkCartonBaseFull]
   id: DrinkSoyMilkCarton
   name: soy milk
   description: White and nutritious soy goodness!
@@ -128,7 +144,7 @@
     sprite: Objects/Consumable/Drinks/soymilk.rsi
 
 - type: entity
-  parent: DrinkCartonBaseFull
+  parent: [DrinkCartonVisualsOpenable, DrinkCartonBaseFull]
   id: DrinkOatMilkCarton
   name: oat milk
   description: It's oat milk. Tan and nutritious goodness!
diff --git a/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks.yml b/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks.yml
index ae808fb1059..6fe951d8344 100644
--- a/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks.yml
+++ b/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks.yml
@@ -134,10 +134,9 @@
       fillBaseName: fill
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkAbsintheGlass
-  name: absinthe glass
-  description: Wormwood, anise, oh my.
+  suffix: absinthe
   components:
   - type: SolutionContainerManager
     solutions:
@@ -146,14 +145,14 @@
         reagents:
         - ReagentId: Absinthe
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/absintheglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkAcidSpitGlass
-  name: acid spit glass
-  description: A drink from the company archives. Made from live aliens.
+  suffix: acid spit
   components:
   - type: SolutionContainerManager
     solutions:
@@ -162,14 +161,14 @@
         reagents:
         - ReagentId: AcidSpit
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/acidspitglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkAleGlass
-  name: ale glass
-  description: A freezing pint of delicious ale
+  suffix: ale
   components:
   - type: SolutionContainerManager
     solutions:
@@ -178,14 +177,14 @@
         reagents:
         - ReagentId: Ale
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/aleglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkAlliesCocktail
-  name: allies cocktail
-  description: A drink made from your allies.
+  suffix: allies cocktail
   components:
   - type: SolutionContainerManager
     solutions:
@@ -194,14 +193,14 @@
         reagents:
         - ReagentId: AlliesCocktail
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/alliescocktail.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkAloe
-  name: aloe glass
-  description: Very, very, very good.
+  suffix: aloe
   components:
   - type: SolutionContainerManager
     solutions:
@@ -210,14 +209,14 @@
         reagents:
         - ReagentId: Aloe
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/aloe.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkAmasecGlass
-  name: amasec glass
-  description: Always handy before COMBAT!!!
+  suffix: amasec
   components:
   - type: SolutionContainerManager
     solutions:
@@ -226,14 +225,14 @@
         reagents:
         - ReagentId: Amasec
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/amasecglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkAndalusia
-  name: andalusia glass
-  description: A nice drink with a strange name.
+  suffix: andalusia
   components:
   - type: SolutionContainerManager
     solutions:
@@ -242,14 +241,14 @@
         reagents:
         - ReagentId: Andalusia
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/andalusia.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkAntifreeze
-  name: anti-freeze glass
-  description: The ultimate refreshment.
+  suffix: antifreeze
   components:
   - type: SolutionContainerManager
     solutions:
@@ -258,15 +257,11 @@
         reagents:
         - ReagentId: Antifreeze
           Quantity: 30
-  - type: Drink
-  - type: Sprite
-    sprite: Objects/Consumable/Drinks/antifreeze.rsi
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkAtomicBombGlass
-  name: atomic bomb glass
-  description: We cannot take legal responsibility for your actions after imbibing.
+  suffix: atomic bomb
   components:
   - type: SolutionContainerManager
     solutions:
@@ -275,15 +270,14 @@
         reagents:
         - ReagentId: AtomicBomb
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/atomicbombglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkB52Glass
-  name: b-52 glass
-  description: Coffee, Irish Cream, and cognac. You will get bombed.
+  suffix: b-52
   components:
   - type: SolutionContainerManager
     solutions:
@@ -292,15 +286,14 @@
         reagents:
         - ReagentId: B52
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/b52glass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkBahamaMama
-  name: bahama mama glass
-  description: Tropical cocktail.
+  suffix: bahama mama
   components:
   - type: SolutionContainerManager
     solutions:
@@ -309,15 +302,14 @@
         reagents:
         - ReagentId: BahamaMama
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/bahama_mama.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkBananaHonkGlass
-  name: banana honk glass
-  description: A drink from Banana Heaven.
+  suffix: banana honk
   components:
   - type: SolutionContainerManager
     solutions:
@@ -326,15 +318,14 @@
         reagents:
         - ReagentId: BananaHonk
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/bananahonkglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkBarefootGlass
-  name: barefoot glass
-  description: Barefoot and pregnant.
+  suffix: barefoot
   components:
   - type: SolutionContainerManager
     solutions:
@@ -343,15 +334,14 @@
         reagents:
         - ReagentId: Barefoot
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/b&p.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkBeepskySmashGlass
-  name: beepsky smash glass
-  description: Heavy, hot and strong. Just like the Iron fist of the LAW.
+  suffix: beepsky smash
   components:
   - type: SolutionContainerManager
     solutions:
@@ -360,15 +350,14 @@
         reagents:
         - ReagentId: BeepskySmash
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/beepskysmashglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkBeerglass
-  name: beer glass
-  description: A freezing pint of beer.
+  suffix: beer
   components:
   - type: SolutionContainerManager
     solutions:
@@ -377,16 +366,15 @@
         reagents:
         - ReagentId: Beer
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/beerglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkBerryJuice
-  name: berry juice
-  description: Berry juice. Or maybe it's jam. Who cares?
+  suffix: berry juice
   components:
-  - type: Drink
   - type: SolutionContainerManager
     solutions:
       drink:
@@ -394,14 +382,14 @@
         reagents:
         - ReagentId: JuiceBerry
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/berryjuice.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkBlackRussianGlass
-  name: black russian glass
-  description: For the lactose-intolerant. Still as classy as a White Russian.
+  suffix: black russian
   components:
   - type: SolutionContainerManager
     solutions:
@@ -410,17 +398,15 @@
         reagents:
         - ReagentId: BlackRussian
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/blackrussianglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkBlueCuracaoGlass
-  name: blue curacao
-  description: Exotically blue, fruity drink, distilled from oranges.
+  suffix: blue curacao
   components:
-  - type: Drink
   - type: SolutionContainerManager
     solutions:
       drink:
@@ -428,14 +414,14 @@
         reagents:
         - ReagentId: BlueCuracao
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/curacaoglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkBloodyMaryGlass
-  name: bloody mary glass
-  description: Tomato juice, mixed with Vodka and a lil' bit of lime. Tastes like liquid murder.
+  suffix: bloody mary
   components:
   - type: SolutionContainerManager
     solutions:
@@ -444,15 +430,14 @@
         reagents:
         - ReagentId: BloodyMary
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/bloodymaryglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkBooger
-  name: booger
-  description: Ewww...
+  suffix: booger
   components:
   - type: SolutionContainerManager
     solutions:
@@ -461,15 +446,14 @@
         reagents:
         - ReagentId: Booger
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/booger.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkBraveBullGlass
-  name: brave bull glass
-  description: Tequilla and coffee liquor, brought together in a mouthwatering mixture. Drink up.
+  suffix: brave bull
   components:
   - type: SolutionContainerManager
     solutions:
@@ -478,17 +462,15 @@
         reagents:
         - ReagentId: BraveBull
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/bravebullglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkCarrotJuice
-  name: carrot juice
-  description: It's just like a carrot but without crunching.
+  suffix: carrot juice
   components:
-  - type: Drink
   - type: SolutionContainerManager
     solutions:
       drink:
@@ -496,18 +478,15 @@
         reagents:
         - ReagentId: JuiceCarrot
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/carrotjuice.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkChocolateGlass
-  name: hot chocolate
-  description: A heated drink consisting melted chocolate and heated milk.
+  suffix: chocolate
   components:
-  - type: Drink
-  - type: Sprite
-    sprite: Objects/Consumable/Drinks/chocolateglass.rsi
   - type: SolutionContainerManager
     solutions:
       drink:
@@ -515,12 +494,14 @@
         reagents:
         - ReagentId: HotCocoa
           Quantity: 30
+  - type: Icon
+    sprite: Objects/Consumable/Drinks/chocolateglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkCoffee
-  name: coffee
-  description: Don't drop it, or you'll send scalding liquid and glass shards everywhere.
+  suffix: coffee
   components:
   - type: SolutionContainerManager
     solutions:
@@ -529,14 +510,14 @@
         reagents:
         - ReagentId: Coffee
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/coffee.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkCognacGlass
-  name: cognac glass
-  description: Damn, you feel like some kind of French aristocrat just by holding this.
+  suffix: cognac
   components:
   - type: SolutionContainerManager
     solutions:
@@ -545,14 +526,14 @@
         reagents:
         - ReagentId: Cognac
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/cognacglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkCream
-  name: cream
-  description: Ewwww...
+  suffix: cream
   components:
   - type: SolutionContainerManager
     solutions:
@@ -561,14 +542,11 @@
         reagents:
         - ReagentId: Cream
           Quantity: 30
-  - type: Sprite
-    sprite: Objects/Consumable/Drinks/cream.rsi
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkCubaLibreGlass
-  name: cuba libre glass
-  description: A classic mix of rum and cola.
+  suffix: cuba libre
   components:
   - type: SolutionContainerManager
     solutions:
@@ -577,14 +555,14 @@
         reagents:
         - ReagentId: CubaLibre
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/cubalibreglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkDeadRumGlass
-  name: deadrum glass
-  description: Popular with the sailors. Not very popular with everyone else.
+  suffix: dead rum
   components:
   - type: SolutionContainerManager
     solutions:
@@ -593,15 +571,14 @@
         reagents:
         - ReagentId: DeadRum
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/rumglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkDemonsBlood
-  name: demons blood
-  description: Just looking at this thing makes the hair at the back of your neck stand up.
+  suffix: demon's blood
   components:
   - type: SolutionContainerManager
     solutions:
@@ -610,15 +587,14 @@
         reagents:
         - ReagentId: DemonsBlood
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/demonsblood.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkDevilsKiss
-  name: devil's kiss
-  description: Creepy time!
+  suffix: devil's kiss
   components:
   - type: SolutionContainerManager
     solutions:
@@ -627,15 +603,14 @@
         reagents:
         - ReagentId: DevilsKiss
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/devilskiss.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkDoctorsDelightGlass
-  name: the doctor's delight
-  description: A healthy mixture of juices, guaranteed to keep you healthy until the next toolboxing takes place.
+  suffix: doctor's delight
   components:
   - type: SolutionContainerManager
     solutions:
@@ -644,15 +619,14 @@
         reagents:
         - ReagentId: DoctorsDelight
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/doctorsdelightglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkDriestMartiniGlass
-  name: driest martini glass
-  description: Only for the experienced. You think you see sand floating in the glass.
+  suffix: driest martini
   components:
   - type: SolutionContainerManager
     solutions:
@@ -661,15 +635,14 @@
         reagents:
         - ReagentId: DriestMartini
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/driestmartiniglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkDrGibbGlass
-  name: Dr. Gibb glass
-  description: Dr. Gibb. Not as dangerous as the name might imply.
+  suffix: dr gibb
   components:
   - type: SolutionContainerManager
     solutions:
@@ -678,15 +651,14 @@
         reagents:
         - ReagentId: DrGibb
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/dr_gibb_glass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkErikaSurprise
-  name: erika surprise
-  description: The surprise is, it's green!
+  suffix: erika surprise
   components:
   - type: SolutionContainerManager
     solutions:
@@ -695,15 +667,14 @@
         reagents:
         - ReagentId: ErikaSurprise
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/erikasurprise.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkFourteenLokoGlass
-  name: Fourteen Loko glass
-  description: This is a container of Fourteen Loko, it appears to be of the highest quality. The drink, not the container.
+  suffix: fourteen loko
   components:
   - type: SolutionContainerManager
     solutions:
@@ -712,15 +683,14 @@
         reagents:
         - ReagentId: FourteenLoko
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/fourteen_loko_glass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkGargleBlasterGlass
-  name: pan-galactic gargle blaster
-  description: Does... does this mean that Arthur and Ford are on the ship? Oh joy.
+  suffix: pan-galactic gargle blaster
   components:
   - type: SolutionContainerManager
     solutions:
@@ -729,15 +699,14 @@
         reagents:
         - ReagentId: GargleBlaster
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/gargleblasterglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkGinGlass
-  name: gin
-  description: Crystal clear Griffeater gin.
+  suffix: gin
   components:
   - type: SolutionContainerManager
     solutions:
@@ -746,15 +715,14 @@
         reagents:
         - ReagentId: Gin
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/ginvodkaglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkGinFizzGlass
-  name: gin fizz glass
-  description: Refreshingly lemony, deliciously dry.
+  suffix: gin fizz
   components:
   - type: SolutionContainerManager
     solutions:
@@ -763,15 +731,14 @@
         reagents:
         - ReagentId: GinFizz
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/ginfizzglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkGinTonicglass
-  name: gin and tonic
-  description: A mild but still great cocktail. Drink up, like a true Englishman.
+  suffix: gin and tonic
   components:
   - type: SolutionContainerManager
     solutions:
@@ -780,15 +747,14 @@
         reagents:
         - ReagentId: GinTonic
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/gintonicglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkGildlagerGlass
-  name: gildlager glass
-  description: 100 proof that teen girls will drink anything with gold in it.
+  suffix: gildlager
   components:
   - type: SolutionContainerManager
     solutions:
@@ -797,17 +763,15 @@
         reagents:
         - ReagentId: Gildlager
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/gildlagerglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkGrapeJuice
-  name: grape juice
-  description: It's grrrrrape!
+  suffix: grape juice
   components:
-  - type: Drink
   - type: SolutionContainerManager
     solutions:
       drink:
@@ -815,24 +779,30 @@
         reagents:
         - ReagentId: JuiceGrape
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/grapejuice.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkGrapeSodaGlass
-  name: grape soda glass
-  description: Looks like a delicious drink!
+  suffix: grape soda
   components:
-  - type: Drink
-  - type: Sprite
+  - type: SolutionContainerManager
+    solutions:
+      drink:
+        maxVol: 30
+        reagents:
+        - ReagentId: GrapeSoda
+          Quantity: 30
+  - type: Icon
     sprite: Objects/Consumable/Drinks/gsodaglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkGreenTeaGlass
-  name: green tea glass
-  description: Tasty green tea. It has antioxidants; it's good for you!
+  suffix: green tea
   components:
   - type: SolutionContainerManager
     solutions:
@@ -841,15 +811,14 @@
         reagents:
         - ReagentId: GreenTea
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/glass_green.rsi #Placeholder
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkGrenadineGlass
-  name: grenadine syrup glass
-  description: Sweet and tangy, a bar syrup used to add color or flavor to drinks.
+  suffix: grenadine
   components:
   - type: SolutionContainerManager
     solutions:
@@ -858,15 +827,14 @@
         reagents:
         - ReagentId: Grenadine
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/grenadineglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkGrogGlass
-  name: grog glass
-  description: A fine and cepa drink for Space.
+  suffix: grog
   components:
   - type: SolutionContainerManager
     solutions:
@@ -875,24 +843,30 @@
         reagents:
         - ReagentId: Grog
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/grogglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkHippiesDelightGlass
-  name: hippies' delight glass
-  description: A drink enjoyed by people during the 1960's.
+  suffix: hippies' delight
   components:
-  - type: Drink
-  - type: Sprite
+  - type: SolutionContainerManager
+    solutions:
+      drink:
+        maxVol: 30
+        reagents:
+        - ReagentId: HippiesDelight
+          Quantity: 30
+  - type: Icon
     sprite: Objects/Consumable/Drinks/hippiesdelightglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkHoochGlass
-  name: hooch
+  suffix: hooch
   description: You've really hit rock bottom now... your liver packed its bags and left last night.
   components:
   - type: SolutionContainerManager
@@ -902,15 +876,14 @@
         reagents:
         - ReagentId: Hooch
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/glass_brown2.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkIcedCoffeeGlass
-  name: iced coffee glass
-  description: A drink to perk you up and refresh you!
+  suffix: iced coffee
   components:
   - type: SolutionContainerManager
     solutions:
@@ -919,15 +892,14 @@
         reagents:
         - ReagentId: IcedCoffee
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/icedcoffeeglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkIcedGreenTeaGlass
-  name: iced green tea glass
-  description: It looks like green tea with ice. One might even call it iced green tea.
+  suffix: iced green tea
   components:
   - type: SolutionContainerManager
     solutions:
@@ -936,15 +908,14 @@
         reagents:
         - ReagentId: IcedGreenTea
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/glass_green.rsi #Placeholder
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkIcedTeaGlass
-  name: iced tea
-  description: A refreshing southern beverage.
+  suffix: iced tea
   components:
   - type: SolutionContainerManager
     solutions:
@@ -953,25 +924,30 @@
         reagents:
         - ReagentId: IcedTea
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/icedteaglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkIcedBeerGlass
-  name: iced beer glass
-  description: A beer so frosty, the air around it freezes.
+  suffix: iced beer
   components:
-  - type: Drink
-  - type: Sprite
+  - type: SolutionContainerManager
+    solutions:
+      drink:
+        maxVol: 30
+        reagents:
+        - ReagentId: IcedBeer
+          Quantity: 30
+  - type: Icon
     sprite: Objects/Consumable/Drinks/iced_beerglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkIceGlass
-  name: ice glass
-  description: Generally, you're supposed to put something else in there too...
+  suffix: ice
   components:
   - type: SolutionContainerManager
     solutions:
@@ -980,14 +956,14 @@
         reagents:
         - ReagentId: Ice
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/iceglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkIceCreamGlass
-  name: ice cream glass
-  description: A glass full of good old ice cream. Might want a spoon.
+  suffix: ice cream
   components:
   - type: SolutionContainerManager
     solutions:
@@ -996,16 +972,14 @@
         reagents:
         - ReagentId: IceCream
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/icecreamglass.rsi
     state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkIrishCarBomb
-  name: irish car bomb
-  description: An irish car bomb.
+  suffix: irish car bomb
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1014,14 +988,14 @@
         reagents:
         - ReagentId: IrishCarBomb
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/irishcarbomb.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkIrishCoffeeGlass
-  name: irish coffee glass
-  description: Coffee and alcohol. More fun than a Mimosa to drink in the morning.
+  suffix: irish coffee
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1030,14 +1004,14 @@
         reagents:
         - ReagentId: IrishCoffee
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/irishcoffeeglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkIrishCreamGlass
-  name: irish cream glass
-  description: It's cream, mixed with whiskey. What else would you expect from the Irish?
+  suffix: irish cream
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1046,14 +1020,14 @@
         reagents:
         - ReagentId: IrishCream
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/irishcreamglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkCoffeeLiqueurGlass
-  name: coffee liqueur glass
-  description: DAMN, THIS THING LOOKS ROBUST
+  suffix: coffee liqueur
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1062,14 +1036,14 @@
         reagents:
         - ReagentId: CoffeeLiqueur
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/coffeeliqueurglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkKiraSpecial
-  name: kira special
-  description: Long live the guy who everyone had mistaken for a girl. Baka!
+  suffix: kira special
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1078,15 +1052,14 @@
         reagents:
         - ReagentId: KiraSpecial
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/kiraspecial.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkLemonadeGlass
-  name: lemonade glass
-  description: Oh the nostalgia...
+  suffix: lemonade
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1095,17 +1068,15 @@
         reagents:
         - ReagentId: Lemonade
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/lemonadeglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkLemonJuice
-  name: lemon juice
-  description: Sour...
+  suffix: lemon juice
   components:
-  - type: Drink
   - type: SolutionContainerManager
     solutions:
       drink:
@@ -1113,16 +1084,15 @@
         reagents:
         - ReagentId: JuiceLemon
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/lemonjuice.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkLemonLime
-  name: lemon lime
-  description: A tangy substance made of 0.5% natural citrus!
+  suffix: lemon lime
   components:
-  - type: Drink
   - type: SolutionContainerManager
     solutions:
       drink:
@@ -1130,16 +1100,15 @@
         reagents:
         - ReagentId: LemonLime
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/lemonlime.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkLimeJuice
-  name: lime juice
-  description: It's some sweet-sour lime juice.
+  suffix: lime juice
   components:
-  - type: Drink
   - type: SolutionContainerManager
     solutions:
       drink:
@@ -1147,14 +1116,11 @@
         reagents:
         - ReagentId: JuiceLime
           Quantity: 30
-  - type: Sprite
-    sprite: Objects/Consumable/Drinks/limejuice.rsi
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkLongIslandIcedTeaGlass
-  name: long island iced tea glass
-  description: The liquor cabinet, brought together in a delicious mix. Intended for middle-aged alcoholic women only.
+  suffix: long island iced tea
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1163,15 +1129,14 @@
         reagents:
         - ReagentId: LongIslandIcedTea
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/longislandicedteaglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkManhattanGlass
-  name: manhattan glass
-  description: The Detective's undercover drink of choice. He never could stomach gin...
+  suffix: manhattan
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1180,15 +1145,14 @@
         reagents:
         - ReagentId: Manhattan
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/manhattanglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkManhattanProjectGlass
-  name: manhattan project glass
-  description: A scientist's drink of choice, for pondering ways to blow up the station.
+  suffix: manhattan project
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1197,15 +1161,14 @@
         reagents:
         - ReagentId: ManhattanProject
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/proj_manhattanglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkManlyDorfGlass
-  name: the manly dorf glass
-  description: A manly concotion made from Ale and Beer. Intended for true men only.
+  suffix: manly dorf
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1214,14 +1177,14 @@
         reagents:
         - ReagentId: ManlyDorf
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/manlydorfglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkMargaritaGlass
-  name: margarita glass
-  description: On the rocks with salt on the rim. Arriba~!
+  suffix: margarita
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1230,15 +1193,14 @@
         reagents:
         - ReagentId: Margarita
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/margaritaglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkMartiniGlass
-  name: classic martini glass
-  description: Damn, the bartender even stirred it, not shook it.
+  suffix: classic martini
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1247,15 +1209,14 @@
         reagents:
         - ReagentId: Martini
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/martiniglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkMeadGlass
-  name: mead glass
-  description: A Viking's beverage, though a cheap one.
+  suffix: mead
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1264,25 +1225,23 @@
         reagents:
         - ReagentId: Mead
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/meadglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkMilkshake
-  name: milkshake
-  description: Glorious brainfreezing mixture.
+  suffix: milkshake
   components:
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/milkshake.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkMojito
-  name: mojito
-  description: Fresh from Spesscuba.
+  suffix: mojito
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1291,15 +1250,14 @@
         reagents:
         - ReagentId: Mojito
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/mojito.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkNeurotoxinGlass
-  name: neurotoxin glass
-  description: A drink that is guaranteed to knock you silly.
+  suffix: neurotoxin
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1308,15 +1266,14 @@
         reagents:
         - ReagentId: Neurotoxin
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/neurotoxinglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkNothing
-  name: nothing
-  description: Absolutely nothing.
+  suffix: nothing
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1325,15 +1282,14 @@
         reagents:
         - ReagentId: Nothing
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/nothing.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkNTCahors
-  name: neotheology cahors whine
-  description: It looks like wine, but more dark.
+  suffix: neotheology cahors whine
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1342,15 +1298,14 @@
         reagents:
         - ReagentId: NTCahors
           Quantity: 30
-  - type: Drink
-  - type: Sprite
-    sprite: Objects/Consumable/Drinks/ntcahors.rsi
+  - type: Icon
+    sprite: Objects/Consumable/Drinks/wineglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkNuclearColaGlass
-  name: nuclear cola glass
-  description: Don't cry, Don't raise your eye, It's only nuclear wasteland.
+  suffix: nuclear cola
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1359,17 +1314,15 @@
         reagents:
         - ReagentId: NuclearCola
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/nuclear_colaglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkOrangeJuice
-  name: orange juice
-  description: Vitamins! Yay!
+  suffix: orange juice
   components:
-  - type: Drink
   - type: SolutionContainerManager
     solutions:
       drink:
@@ -1377,14 +1330,14 @@
         reagents:
         - ReagentId: JuiceOrange
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/orangejuice.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkPatronGlass
-  name: patron glass
-  description: Drinking patron in the bar, with all the subpar ladies.
+  suffix: patron
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1393,17 +1346,15 @@
         reagents:
         - ReagentId: Patron
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/patronglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkPoisonBerryJuice
-  name: poison berry juice
-  description: Looks like some deadly juice.
+  suffix: poison berry juice
   components:
-  - type: Drink
   - type: SolutionContainerManager
     solutions:
       drink:
@@ -1411,14 +1362,14 @@
         reagents:
         - ReagentId: JuiceBerryPoison
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/poisonberryjuice.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkPoisonWineGlass
-  name: poison wine glass
-  description: A black ichor with an oily purple sheer on top. Are you sure you should drink this?
+  suffix: poison wine
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1427,15 +1378,14 @@
         reagents:
         - ReagentId: PoisonWine
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/pwineglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkPoscaGlass
-  name: posca glass
-  description: Poor warriors' drink from a forgotten era.
+  suffix: posca
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1444,15 +1394,14 @@
         reagents:
         - ReagentId: Posca
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/glass_light_yellow.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkRedMeadGlass
-  name: red mead glass
-  description: A true Viking's beverage, though its color is strange.
+  suffix: red mead
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1461,15 +1410,14 @@
         reagents:
         - ReagentId: RedMead
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/red_meadglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkRewriter
-  name: rewriter
-  description: The secret of the sanctuary of the Libarian...
+  suffix: rewriter
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1478,15 +1426,14 @@
         reagents:
         - ReagentId: Rewriter
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/rewriter.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkRootBeerGlass
-  name: root beer glass
-  description: Fizzy, foamy, and full of sweet, non-caffienated goodness.
+  suffix: root beer
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1495,16 +1442,14 @@
         reagents:
         - ReagentId: RootBeer
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/rootbeerglass.rsi
     state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkRootBeerFloatGlass
-  name: root beer float glass
-  description: Fizzy, foamy, and now with ice cream on top! Amazing!
+  suffix: root beer float
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1513,16 +1458,14 @@
         reagents:
         - ReagentId: RootBeerFloat
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/rootbeerfloatglass.rsi
     state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkRumGlass
-  name: rum glass
-  description: Now you want to Pray for a pirate suit, don't you?
+  suffix: rum
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1531,15 +1474,14 @@
         reagents:
         - ReagentId: Rum
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/rumglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkSakeGlass
-  name: sake glass
-  description: Wine made from rice, it's sake!
+  suffix: sake
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1548,15 +1490,11 @@
         reagents:
         - ReagentId: Sake
           Quantity: 30
-  - type: Drink
-  - type: Sprite
-    sprite: Objects/Consumable/Drinks/ginvodkaglass.rsi
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkSbitenGlass
-  name: sbiten glass
-  description: A spicy mix of Vodka and Spice. Very hot.
+  suffix: sbiten
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1565,15 +1503,14 @@
         reagents:
         - ReagentId: Sbiten
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/sbitenglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkScrewdriverCocktailGlass
-  name: screwdriver glass
-  description: A simple, yet superb mixture of Vodka and orange juice. Just the thing for the tired engineer.
+  suffix: screwdriver
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1582,15 +1519,14 @@
         reagents:
         - ReagentId: ScrewdriverCocktail
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/screwdriverglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkCogChampBase
-  name: cogchamp glass
-  description: This mix of Cognac, Screwdriver and Welding Fuel will have you seeing His light surely!
+  suffix: cogchamp
   components:
     - type: SolutionContainerManager
       solutions:
@@ -1599,15 +1535,14 @@
           reagents:
             - ReagentId: CogChamp
               Quantity: 30
-    - type: Drink
-    - type: Sprite
+    - type: Icon
       sprite: Objects/Consumable/Drinks/cogchamp.rsi
+      state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkSuiDreamGlass
-  name: sui dream glass
-  description: A froofy, fruity, and sweet mixed drink. Understanding the name only brings shame.
+  suffix: sui dream
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1616,15 +1551,14 @@
         reagents:
         - ReagentId: SuiDream
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/sdreamglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkEmeraldGlass
-  name: melon liquor
-  description: A relatively sweet and fruity 46 proof liquor.
+  suffix: melon liquor
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1633,15 +1567,14 @@
         reagents:
         - ReagentId: MelonLiquor
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/emeraldglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkMoonshineGlass
-  name: moonshine
-  description: You've really hit rock bottom now... your liver packed its bags and left last night.
+  suffix: moonshine
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1650,15 +1583,14 @@
         reagents:
         - ReagentId: Moonshine
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/glass_clear.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkGlassWhite
-  name: milk
-  description: White and nutritious goodness!
+  suffix: milk
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1667,14 +1599,14 @@
         reagents:
         - ReagentId: Milk
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/glass_white.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkSilencerGlass
-  name: silencer glass
-  description: A drink from Mime Heaven.
+  suffix: silencer
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1683,15 +1615,14 @@
         reagents:
         - ReagentId: Silencer
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/silencerglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkSingulo
-  name: singulo
-  description: A blue-space beverage!
+  suffix: singulo
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1700,15 +1631,14 @@
         reagents:
         - ReagentId: Singulo
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/singulo.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkSnowWhite
-  name: snow white
-  description: A cold refreshment.
+  suffix: snow white
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1717,15 +1647,14 @@
         reagents:
         - ReagentId: SnowWhite
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/snowwhite.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkSoyLatte
-  name: soy latte
-  description: A nice and refreshing beverage while you are reading.
+  suffix: soy latte
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1734,15 +1663,14 @@
         reagents:
         - ReagentId: SoyLatte
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/soy_latte.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkSpaceUpGlass
-  name: space-up glass
-  description: Space-up. It helps keep your cool.
+  suffix: space-up
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1751,15 +1679,14 @@
         reagents:
         - ReagentId: SpaceUp
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/space-up_glass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkSpaceMountainWindGlass
-  name: space mountain wind glass
-  description: Space Mountain Wind. As you know, there are no mountains in space, only wind.
+  suffix: space mountain wind
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1768,15 +1695,14 @@
         reagents:
         - ReagentId: SpaceMountainWind
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/space_mountain_wind_glass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkSyndicatebomb
-  name: syndicate bomb
-  description: Tastes like terrorism!
+  suffix: syndicate bomb
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1785,14 +1711,14 @@
         reagents:
         - ReagentId: SyndicateBomb
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/syndicatebomb.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkTeaGlass
-  name: tea glass
-  description: Tasty black tea. It has antioxidants; it's good for you!
+  suffix: tea
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1801,8 +1727,9 @@
         reagents:
         - ReagentId: Tea
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/teaglass.rsi
+    state: icon
 
 - type: entity
   parent: DrinkGlassBase
@@ -1821,10 +1748,9 @@
     sprite: Objects/Consumable/Drinks/teapot.rsi
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkTequilaGlass
-  name: tequila glass
-  description: Now all that's missing is the weird colored shades!
+  suffix: tequila
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1833,15 +1759,14 @@
         reagents:
         - ReagentId: Tequila
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/tequillaglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkTequilaSunriseGlass
-  name: tequila sunrise glass
-  description: Oh great, now you feel nostalgic about sunrises back on Terra...
+  suffix: tequila sunrise
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1850,15 +1775,14 @@
         reagents:
         - ReagentId: TequilaSunrise
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/tequillasunriseglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkTheMartinez
-  name: The Martinez glass
-  description: The edgerunner legend.  Remembered by a drink, Forgotten by a drunk.
+  suffix: The Martinez
   components:
     - type: SolutionContainerManager
       solutions:
@@ -1867,14 +1791,14 @@
           reagents:
             - ReagentId: TheMartinez
               Quantity: 30
-    - type: Sprite
+    - type: Icon
       sprite: Objects/Consumable/Drinks/the_martinez.rsi
+      state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkThreeMileIslandGlass
-  name: three mile island glass
-  description: A glass of this is sure to prevent a meltdown.
+  suffix: three mile island
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1883,15 +1807,14 @@
         reagents:
         - ReagentId: ThreeMileIsland
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/threemileislandglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkTomatoJuice
-  name: tomato juice
-  description: Are you sure this is tomato juice?
+  suffix: tomato juice
   components:
   - type: Drink
   - type: SolutionContainerManager
@@ -1901,14 +1824,11 @@
         reagents:
         - ReagentId: JuiceTomato
           Quantity: 30
-  - type: Sprite
-    sprite: Objects/Consumable/Drinks/tomatojuice.rsi
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkToxinsSpecialGlass
-  name: toxins special glass
-  description: Woah, this thing is on FIRE
+  suffix: toxins special
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1917,15 +1837,14 @@
         reagents:
         - ReagentId: ToxinsSpecial
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/toxinsspecialglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkVermouthGlass
-  name: vermouth glass
-  description: You wonder why you're even drinking this straight.
+  suffix: vermouth
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1934,15 +1853,14 @@
         reagents:
         - ReagentId: Vermouth
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/vermouthglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkVodkaGlass
-  name: vodka glass
-  description: Number one drink and fueling choice for Russians worldwide.
+  suffix: vodka
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1951,15 +1869,14 @@
         reagents:
         - ReagentId: Vodka
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/ginvodkaglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkVodkaMartiniGlass
-  name: vodka martini glass
-  description: A bastardisation of the classic martini. Still great.
+  suffix: vodka martini
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1968,15 +1885,14 @@
         reagents:
         - ReagentId: VodkaMartini
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/martiniglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkVodkaTonicGlass
-  name: vodka tonic glass
-  description: For when a gin and tonic isn't russian enough.
+  suffix: vodka tonic
   components:
   - type: SolutionContainerManager
     solutions:
@@ -1985,9 +1901,9 @@
         reagents:
         - ReagentId: VodkaTonic
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/vodkatonicglass.rsi
+    state: icon
 
 - type: entity
   parent: DrinkGlassBase
@@ -2007,12 +1923,10 @@
     sprite: Objects/Consumable/Drinks/water.rsi
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkWatermelonJuice
-  name: watermelon juice
-  description: Delicious juice made from watermelon.
+  suffix: watermelon juice
   components:
-  - type: Drink
   - type: SolutionContainerManager
     solutions:
       drink:
@@ -2020,14 +1934,11 @@
         reagents:
         - ReagentId: JuiceWatermelon
           Quantity: 30
-  - type: Sprite
-    sprite: Objects/Consumable/Drinks/watermelon.rsi
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkWhiskeyColaGlass
-  name: whiskey cola glass
-  description: An innocent-looking mixture of cola and Whiskey. Delicious.
+  suffix: whiskey cola
   components:
   - type: SolutionContainerManager
     solutions:
@@ -2036,14 +1947,14 @@
         reagents:
         - ReagentId: WhiskeyCola
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/whiskeycolaglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkWhiskeyGlass
-  name: whiskey glass
-  description: The silky, smoky whiskey goodness inside makes the drink look very classy.
+  suffix: whiskey
   components:
   - type: SolutionContainerManager
     solutions:
@@ -2052,14 +1963,14 @@
         reagents:
         - ReagentId: Whiskey
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/whiskeyglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkWhiskeySodaGlass
-  name: whiskey soda glass
-  description: Ultimate refreshment.
+  suffix: whiskey soda
   components:
   - type: SolutionContainerManager
     solutions:
@@ -2068,15 +1979,14 @@
         reagents:
         - ReagentId: WhiskeySoda
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/whiskeysodaglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkWhiteRussianGlass
-  name: white russian glass
-  description: A very nice looking drink. But that's just, like, your opinion, man.
+  suffix: white russian
   components:
   - type: SolutionContainerManager
     solutions:
@@ -2085,15 +1995,14 @@
         reagents:
         - ReagentId: WhiteRussian
           Quantity: 30
-  - type: Drink
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/whiterussianglass.rsi
+    state: icon
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkWineGlass
-  name: wine glass
-  description: A very classy looking drink.
+  suffix: wine
   components:
   - type: SolutionContainerManager
     solutions:
@@ -2102,8 +2011,9 @@
         reagents:
         - ReagentId: Wine
           Quantity: 30
-  - type: Sprite
+  - type: Icon
     sprite: Objects/Consumable/Drinks/wineglass.rsi
+    state: icon
 
 # TODO: MOVE
 
@@ -2196,10 +2106,9 @@
           Quantity: 5
 
 - type: entity
-  parent: DrinkGlassBase
+  parent: DrinkGlass
   id: DrinkBloodGlass
-  name: blood glass
-  description: Drink like a vampire!
+  suffix: blood
   components:
     - type: SolutionContainerManager
       solutions:
@@ -2208,5 +2117,6 @@
           reagents:
             - ReagentId: Blood
               Quantity: 30
-    - type: Sprite
+    - type: Icon
       sprite: Objects/Consumable/Drinks/bloodglass.rsi
+      state: icon
diff --git a/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks_bottles.yml b/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks_bottles.yml
index 2c156d58289..b0b2c2729f9 100644
--- a/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks_bottles.yml
+++ b/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks_bottles.yml
@@ -79,7 +79,46 @@
       Glass: 100
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  id: DrinkBottleVisualsOpenable
+  abstract: true
+  components:
+  - type: Appearance
+  - type: GenericVisualizer
+    visuals:
+      enum.OpenableVisuals.Opened:
+        enum.OpenableVisuals.Layer:
+          True: {state: "icon_open"}
+          False: {state: "icon"}
+  - type: Sprite
+    layers:
+      - state: icon
+        map: ["enum.OpenableVisuals.Layer"]
+
+- type: entity
+  id: DrinkBottleVisualsAll
+  abstract: true
+  components:
+  - type: Appearance
+  - type: GenericVisualizer
+    visuals:
+      enum.OpenableVisuals.Opened:
+        enum.OpenableVisuals.Layer:
+          True: {state: "icon_open"}
+          False: {state: "icon_empty"}
+  - type: Sprite
+    sprite: Objects/Consumable/Drinks/alco-bottle.rsi
+    layers:
+      - state: icon
+        map: ["enum.OpenableVisuals.Layer"]
+      - state: fill-1
+        map: ["enum.SolutionContainerLayers.Fill"]
+        visible: false
+  - type: SolutionContainerVisuals
+    maxFillLevels: 5
+    fillBaseName: fill-
+
+- type: entity
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkAbsintheBottleFull
   name: Jailbreaker Verte
   description: One sip of this and you just know you're gonna have a good time.
@@ -94,7 +133,7 @@
     sprite: Objects/Consumable/Drinks/absinthebottle.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkBlueCuracaoBottleFull
   name: Miss Blue Curacao
   description: A fruity, exceptionally azure drink. Does not allow the imbiber to use the fifth magic.
@@ -106,10 +145,19 @@
         - ReagentId: BlueCuracao
           Quantity: 100
   - type: Sprite
-    sprite: Objects/Consumable/Drinks/alco-blue.rsi
+    sprite: Objects/Consumable/Drinks/alco-bottle.rsi
+    layers:
+      - state: icon_blue
+        map: ["enum.OpenableVisuals.Layer"]
+      - state: fill-1
+        map: ["enum.SolutionContainerLayers.Fill"]
+        visible: false
+  - type: SolutionContainerVisuals
+    maxFillLevels: 6
+    fillBaseName: fill-
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsOpenable, DrinkBottleGlassBaseFull]
   id: DrinkBottleOfNothingFull
   name: bottle of nothing
   description: A bottle filled with nothing.
@@ -124,7 +172,7 @@
     sprite: Objects/Consumable/Drinks/bottleofnothing.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsOpenable, DrinkBottleGlassBaseFull]
   id: DrinkChampagneBottleFull
   name: champagne bottle
   description: Only people devoid of imagination can't find an excuse for champagne.
@@ -139,7 +187,7 @@
     sprite: Objects/Consumable/Drinks/champagnebottle.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkCognacBottleFull
   name: cognac bottle
   description: A sweet and strongly alchoholic drink, made after numerous distillations and years of maturing. You might as well not scream 'SHITCURITY' this time.
@@ -156,7 +204,7 @@
     sprite: Objects/Consumable/Drinks/cognacbottle.rsi
 
 - type: entity
-  parent: DrinkBottlePlasticBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottlePlasticBaseFull]
   id: DrinkColaBottleFull
   name: space cola bottle
   description: Cola. In space.
@@ -172,9 +220,8 @@
   - type: Sprite
     sprite: Objects/Consumable/Drinks/colabottle.rsi
 
-
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkGrenadineBottleFull
   name: briar rose grenadine syrup bottle
   description: Sweet and tangy, a bar syrup used to add color or flavor to drinks.
@@ -190,9 +237,11 @@
     opened: true
   - type: Sprite
     sprite: Objects/Consumable/Drinks/grenadinebottle.rsi
+  - type: SolutionContainerVisuals
+    maxFillLevels: 6
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkGinBottleFull
   name: Griffeater gin
   description: A bottle of high quality gin, produced in the New London Space Station.
@@ -209,7 +258,7 @@
     sprite: Objects/Consumable/Drinks/ginbottle.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkGildlagerBottleFull
   name: gildlager bottle
   description: 100 proof cinnamon schnapps, made for alcoholic teen girls on spring break.
@@ -224,7 +273,7 @@
     sprite: Objects/Consumable/Drinks/gildlagerbottle.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsOpenable, DrinkBottleGlassBaseFull]
   id: DrinkCoffeeLiqueurBottleFull
   name: coffee liqueur bottle
   description: The great taste of coffee with none of the benifits.
@@ -241,7 +290,7 @@
     sprite: Objects/Consumable/Drinks/coffeeliqueurbottle.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkMelonLiquorBottleFull
   name: emeraldine melon liquor
   description: A bottle of 46 proof Emeraldine Melon Liquor. Sweet and light.
@@ -253,10 +302,19 @@
         - ReagentId: MelonLiquor
           Quantity: 100
   - type: Sprite
-    sprite: Objects/Consumable/Drinks/alco-green.rsi
+    sprite: Objects/Consumable/Drinks/alco-bottle.rsi
+    layers:
+      - state: icon_green
+        map: ["enum.OpenableVisuals.Layer"]
+      - state: fill-1
+        map: ["enum.SolutionContainerLayers.Fill"]
+        visible: false
+  - type: SolutionContainerVisuals
+    maxFillLevels: 6
+    fillBaseName: fill-
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkPatronBottleFull
   name: wrapp artiste patron bottle
   description: Silver laced tequilla, served in space night clubs across the galaxy.
@@ -271,7 +329,7 @@
     sprite: Objects/Consumable/Drinks/patronbottle.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsOpenable, DrinkBottleGlassBaseFull]
   id: DrinkPoisonWinebottleFull
   name: warlock's velvet bottle
   description: What a delightful packaging for a surely high quality wine! The vintage must be amazing!
@@ -286,7 +344,7 @@
     sprite: Objects/Consumable/Drinks/pwinebottle.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkRumBottleFull
   name: captain pete's Cuban spiced rum
   description: This isn't just rum, oh no. It's practically GRIFF in a bottle.
@@ -303,7 +361,7 @@
     sprite: Objects/Consumable/Drinks/rumbottle.rsi
 
 - type: entity
-  parent: DrinkBottlePlasticBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottlePlasticBaseFull]
   id: DrinkSpaceMountainWindBottleFull
   name: space mountain wind bottle
   description: Blows right through you like a space wind.
@@ -321,7 +379,7 @@
     sprite: Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi
 
 - type: entity
-  parent: DrinkBottlePlasticBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottlePlasticBaseFull]
   id: DrinkSpaceUpBottleFull
   name: space-up bottle
   description: Tastes like a hull breach in your mouth.
@@ -339,7 +397,7 @@
     sprite: Objects/Consumable/Drinks/space-up_bottle.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkTequilaBottleFull
   name: caccavo guaranteed quality tequila bottle
   description: Made from premium petroleum distillates, pure thalidomide and other fine quality ingredients!
@@ -356,7 +414,7 @@
     sprite: Objects/Consumable/Drinks/tequillabottle.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkVermouthBottleFull
   name: goldeneye vermouth bottle
   description: Sweet, sweet dryness!
@@ -373,7 +431,7 @@
     sprite: Objects/Consumable/Drinks/vermouthbottle.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkVodkaBottleFull
   name: vodka bottle
   description: Aah, vodka. Prime choice of drink AND fuel by Russians worldwide.
@@ -390,7 +448,7 @@
     sprite: Objects/Consumable/Drinks/vodkabottle.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkWhiskeyBottleFull
   name: uncle git's special reserve
   description: A premium single-malt whiskey, gently matured inside the tunnels of a nuclear shelter. TUNNEL WHISKEY RULES.
@@ -407,7 +465,7 @@
     sprite: Objects/Consumable/Drinks/whiskeybottle.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsOpenable, DrinkBottleGlassBaseFull]
   id: DrinkWineBottleFull
   name: doublebearded bearded special wine bottle
   description: A faint aura of unease and asspainery surrounds the bottle.
@@ -426,7 +484,7 @@
 # Small Bottles
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkBeerBottleFull
   name: beer  # beer it is. coffee. beer? coff-ee? be-er? c-o... b-e
   description: An alcoholic beverage made from malted grains, hops, yeast, and water.
@@ -444,7 +502,7 @@
     sprite: Objects/Consumable/Drinks/beer.rsi
 
 - type: entity
-  parent: DrinkBottleGlassBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottleGlassBaseFull]
   id: DrinkBeerGrowler # Needs to be renamed DrinkBeerBottleFull
   name: Beer Growler  # beer it is. coffee. beer? coff-ee? be-er? c-o... b-e
   description: An alcoholic beverage made from malted grains, hops, yeast, and water. XL growler bottle.
@@ -463,7 +521,7 @@
 
 
 - type: entity
-  parent: DrinkBottlePlasticBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottlePlasticBaseFull]
   id: DrinkAleBottleFull
   name: Magm-Ale
   description: A true dorf's drink of choice.
@@ -482,7 +540,7 @@
     sprite: Objects/Consumable/Drinks/alebottle.rsi
 
 - type: entity
-  parent: DrinkBottlePlasticBaseFull
+  parent: [DrinkBottleVisualsAll, DrinkBottlePlasticBaseFull]
   id: DrinkAleBottleFullGrowler
   name: Magm-Ale Growler
   description: A true dorf's drink of choice. XL growler bottle.
@@ -500,7 +558,7 @@
     sprite: Objects/Consumable/Drinks/alebottle.rsi
 
 - type: entity
-  parent: DrinkBottlePlasticBaseFull
+  parent: [DrinkBottleVisualsOpenable, DrinkBottlePlasticBaseFull]
   id: DrinkWaterBottleFull
   name: water bottle
   description: Simple clean water of unknown origin. You think that maybe you dont want to know it.
@@ -519,6 +577,7 @@
     sprite: Objects/Consumable/Drinks/waterbottle.rsi
     layers:
       - state: icon
+        map: ["enum.OpenableVisuals.Layer"]
       - state: icon-1
         map: ["enum.SolutionContainerLayers.Fill"]
         visible: false
@@ -564,7 +623,7 @@
 # Cartons, TODO: this needs to be moved elsewhere eventually, since cartons shouldnt smash into glass shards
 
 - type: entity
-  parent: DrinkBottlePlasticBaseFull
+  parent: [DrinkBottleVisualsOpenable, DrinkBottlePlasticBaseFull]
   id: DrinkJuiceLimeCartonXL
   name: lime juice XL
   description: Sweet-sour goodness.
@@ -583,7 +642,7 @@
     sprite: Objects/Consumable/Drinks/limejuice.rsi
 
 - type: entity
-  parent: DrinkBottlePlasticBaseFull
+  parent: [DrinkBottleVisualsOpenable, DrinkBottlePlasticBaseFull]
   id: DrinkJuiceOrangeCartonXL
   name: orange juice XL
   description: Full of vitamins and deliciousness!
@@ -602,7 +661,7 @@
     sprite: Objects/Consumable/Drinks/orangejuice.rsi
 
 - type: entity
-  parent: DrinkBottlePlasticBaseFull
+  parent: [DrinkBottleVisualsOpenable, DrinkBottlePlasticBaseFull]
   id: DrinkCreamCartonXL
   name: Milk Cream XL
   description: It's cream. Made from milk. What else did you think you'd find in there?
diff --git a/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks_fun.yml b/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks_fun.yml
index f89b56ea878..2fd2331f91e 100644
--- a/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks_fun.yml
+++ b/Resources/Prototypes/Entities/Objects/Consumable/Drinks/drinks_fun.yml
@@ -11,7 +11,7 @@
     sprite: Objects/Consumable/Drinks/glue-tube.rsi
     layers:
       - state: icon
-        map: [ "enum.SolutionContainerLayers.Base" ]
+        map: ["enum.OpenableVisuals.Layer"]
       - state: fill1
         map: [ "enum.SolutionContainerLayers.Fill" ]
         visible: false
@@ -29,6 +29,12 @@
   - type: SolutionContainerVisuals
     maxFillLevels: 6
     fillBaseName: fill
+  - type: GenericVisualizer
+    visuals:
+      enum.OpenableVisuals.Opened:
+        enum.OpenableVisuals.Layer:
+          True: {state: "icon_open"}
+          False: {state: "icon"}
   - type: Tag
     tags:
       - DrinkSpaceGlue
@@ -48,7 +54,7 @@
     sprite: Objects/Consumable/Drinks/lube-tube.rsi
     layers:
       - state: icon
-        map: [ "enum.SolutionContainerLayers.Base" ]
+        map: ["enum.OpenableVisuals.Layer"]
       - state: fill1
         map: [ "enum.SolutionContainerLayers.Fill" ]
         visible: false
@@ -65,12 +71,18 @@
   - type: SolutionContainerVisuals
     maxFillLevels: 6
     fillBaseName: fill
+  - type: GenericVisualizer
+    visuals:
+      enum.OpenableVisuals.Opened:
+        enum.OpenableVisuals.Layer:
+          True: {state: "icon_open"}
+          False: {state: "icon"}
   - type: Lube
   - type: TrashOnSolutionEmpty
     solution: drink
 
 
-# Mopwata 
+# Mopwata
 - type: weightedRandomFillSolution
   id: RandomFillMopwata
   fills:
@@ -112,7 +124,6 @@
     - Mold
     - SpaceLube
     - SpaceGlue
-    - SoapyWater
     - SpaceCleaner
     - MilkSpoiled
     - FourteenLoko
@@ -135,5 +146,21 @@
   - type: RandomFillSolution
     solution: drink
     weightedRandomId: RandomFillMopwata
+  - type: Appearance
+  - type: GenericVisualizer
+    visuals:
+      enum.OpenableVisuals.Opened:
+        enum.OpenableVisuals.Layer:
+          True: {state: "icon_open"}
+          False: {state: "icon_empty"}
   - type: Sprite
-    sprite: Objects/Consumable/Drinks/mopwata.rsi
\ No newline at end of file
+    sprite: Objects/Consumable/Drinks/mopwata.rsi
+    layers:
+      - state: icon
+        map: ["enum.OpenableVisuals.Layer"]
+      - state: fill-1
+        map: ["enum.SolutionContainerLayers.Fill"]
+        visible: false
+  - type: SolutionContainerVisuals
+    maxFillLevels: 5
+    fillBaseName: fill-
diff --git a/Resources/Prototypes/Entities/Objects/Consumable/Food/Baked/donkpocket.yml b/Resources/Prototypes/Entities/Objects/Consumable/Food/Baked/donkpocket.yml
index 2e034053051..e8efb194356 100644
--- a/Resources/Prototypes/Entities/Objects/Consumable/Food/Baked/donkpocket.yml
+++ b/Resources/Prototypes/Entities/Objects/Consumable/Food/Baked/donkpocket.yml
@@ -292,6 +292,80 @@
         - ReagentId: Sugar
           Quantity: 2
 
+- type: entity
+  name: stonk-pocket
+  parent: FoodDonkpocketBase
+  id: FoodDonkpocketStonk
+  description: Tasty, but a sad reminder of the great crash of '24
+  components:
+  - type: FlavorProfile
+    flavors:
+      - profits
+      - cheap
+  - type: SolutionContainerManager
+    solutions:
+      food:
+        reagents:
+        - ReagentId: Nutriment
+          Quantity: 5
+  - type: Sprite
+    state: stonk
+
+- type: entity
+  name: warm stonk-pocket
+  parent: FoodDonkpocketStonk
+  id: FoodDonkpocketStonkWarm
+  components:
+  - type: FlavorProfile
+    flavors:
+      - profits
+      - cheap
+  - type: SolutionContainerManager
+    solutions:
+      food:
+        reagents:
+        - ReagentId: Nutriment
+          Quantity: 10
+        - ReagentId: Omnizine
+          Quantity: 2
+
+- type: entity
+  name: carp-pocket
+  parent: FoodDonkpocketBase
+  id: FoodDonkpocketCarp
+  description: A long-lost edition of donk pocket, made specifically for hard-working salvagers.
+  components:
+  - type: FlavorProfile
+    flavors:
+    - cheap
+    - fishops
+  - type: SolutionContainerManager
+    solutions:
+      food:
+        reagents:
+        - ReagentId: Nutriment
+          Quantity: 5
+  - type: Sprite
+    state: carp
+
+- type: entity
+  name: warm carp-pocket
+  parent: FoodDonkpocketCarp
+  id: FoodDonkpocketCarpWarm
+  components:
+  - type: FlavorProfile
+    flavors:
+    - cheap
+    - fishops
+  - type: SolutionContainerManager
+    solutions:
+      food:
+        reagents:
+        - ReagentId: Nutriment
+          Quantity: 10
+        - ReagentId: Omnizine
+          Quantity: 2
+
 - type: entity
   name: dink-pocket
   parent: FoodDonkpocketBase
diff --git a/Resources/Prototypes/Entities/Objects/Consumable/Food/Containers/box.yml b/Resources/Prototypes/Entities/Objects/Consumable/Food/Containers/box.yml
index bec5f3ee08c..2efa2a59ec7 100644
--- a/Resources/Prototypes/Entities/Objects/Consumable/Food/Containers/box.yml
+++ b/Resources/Prototypes/Entities/Objects/Consumable/Food/Containers/box.yml
@@ -387,6 +387,32 @@
     - id: FoodDonkpocketPizza
       amount: 6
 
+- type: entity
+  parent: FoodBoxDonkpocket
+  id: FoodBoxDonkpocketStonk
+  name: box of limited edition stonk-pockets
+  components:
+  - type: Sprite
+    state: stonk-box
+  - type: Item
+    sprite: Objects/Consumable/Food/Baked/donkpocket.rsi
+  - type: StorageFill
+    contents:
+    - id: FoodDonkpocketStonk
+      amount: 6
+
+- type: entity
+  parent: FoodBoxDonkpocket
+  id: FoodBoxDonkpocketCarp
+  name: box of carp-pockets
+  components:
+  - type: Sprite
+    state: carp-box
+  - type: StorageFill
+    contents:
+    - id: FoodDonkpocketCarp
+      amount: 6
+
 - type: entity
   parent: FoodBoxDonkpocket
   id: FoodBoxDonkpocketBerry
diff --git a/Resources/Prototypes/Entities/Objects/Consumable/Food/Containers/condiments.yml b/Resources/Prototypes/Entities/Objects/Consumable/Food/Containers/condiments.yml
index 5ae992319a3..197e7ea9829 100644
--- a/Resources/Prototypes/Entities/Objects/Consumable/Food/Containers/condiments.yml
+++ b/Resources/Prototypes/Entities/Objects/Consumable/Food/Containers/condiments.yml
@@ -49,7 +49,19 @@
   - type: SolutionTransfer
     maxTransferAmount: 10
   - type: Sprite
-    state: packet-empty
+    layers:
+      - state: packet-trans-2
+        map: ["enum.SolutionContainerLayers.Fill"]
+        visible: true
+      - state: packet-layer
+        map: ["enum.OpenableVisuals.Layer"]
+      - state: packet-label
+  - type: GenericVisualizer
+    visuals:
+      enum.OpenableVisuals.Opened:
+        enum.OpenableVisuals.Layer:
+          True: {state: "packet-layer-open"}
+          False: {state: "packet-layer"}
   - type: Icon
     state: packet-empty
   - type: PhysicalComposition
@@ -77,7 +89,9 @@
       - state: packet-trans-2
         map: ["enum.SolutionContainerLayers.Fill"]
         visible: true
-      - state: packet-astrotame
+      - state: packet-layer
+        map: ["enum.OpenableVisuals.Layer"]
+      - state: packet-label-a
   - type: Icon
     state: packet-astrotame
   - type: Appearance
@@ -98,12 +112,6 @@
         reagents:
         - ReagentId: BbqSauce
           Quantity: 10
-  - type: Sprite
-    layers:
-      - state: packet-trans-2
-        map: ["enum.SolutionContainerLayers.Fill"]
-        visible: true
-      - state: packet-layer
   - type: Icon
     state: packet-bbq
   - type: Appearance
@@ -124,12 +132,6 @@
         reagents:
         - ReagentId: Cornoil
           Quantity: 10
-  - type: Sprite
-    layers:
-      - state: packet-trans-2
-        map: ["enum.SolutionContainerLayers.Fill"]
-        visible: true
-      - state: packet-layer
   - type: Icon
     state: packet-cornoil
   - type: Appearance
@@ -150,12 +152,6 @@
         reagents:
         - ReagentId: Frostoil
           Quantity: 10
-  - type: Sprite
-    layers:
-      - state: packet-trans-2
-        map: ["enum.SolutionContainerLayers.Fill"]
-        visible: true
-      - state: packet-layer
   - type: Icon
     state: packet-frostoil
   - type: Appearance
@@ -176,12 +172,6 @@
         reagents:
         - ReagentId: HorseradishSauce
           Quantity: 10
-  - type: Sprite
-    layers:
-      - state: packet-solid-2
-        map: ["enum.SolutionContainerLayers.Fill"]
-        visible: true
-      - state: packet-layer
   - type: Icon
     state: packet-greygoo
   - type: Appearance
@@ -202,12 +192,6 @@
         reagents:
         - ReagentId: Hotsauce
           Quantity: 10
-  - type: Sprite
-    layers:
-      - state: packet-trans-2
-        map: ["enum.SolutionContainerLayers.Fill"]
-        visible: true
-      - state: packet-layer
   - type: Icon
     state: packet-hotsauce
   - type: Appearance
@@ -228,11 +212,6 @@
         - ReagentId: Ketchup
           Quantity: 10
   - type: Sprite
-    layers:
-      - state: packet-solid-2
-        map: ["enum.SolutionContainerLayers.Fill"]
-        visible: true
-      - state: packet-layer
   - type: Icon
     state: packet-ketchup
   - type: Appearance
@@ -252,12 +231,6 @@
         reagents:
         - ReagentId: Mustard
           Quantity: 10
-  - type: Sprite
-    layers:
-      - state: packet-solid-2
-        map: ["enum.SolutionContainerLayers.Fill"]
-        visible: true
-      - state: packet-layer
   - type: Icon
     state: packet-mustard
   - type: Appearance
@@ -277,12 +250,6 @@
         reagents:
         - ReagentId: Blackpepper
           Quantity: 10
-  - type: Sprite
-    layers:
-      - state: packet-solid-2
-        map: ["enum.SolutionContainerLayers.Fill"]
-        visible: true
-      - state: packet-layer
   - type: Icon
     state: packet-pepper
   - type: Appearance
@@ -308,6 +275,7 @@
         map: ["enum.SolutionContainerLayers.Fill"]
         visible: true
       - state: packet-layer
+        map: ["enum.OpenableVisuals.Layer"]
       - state: packet-label
         color: black
   - type: Icon
@@ -329,12 +297,6 @@
         reagents:
         - ReagentId: Soysauce
           Quantity: 10
-  - type: Sprite
-    layers:
-      - state: packet-solid-2
-        map: ["enum.SolutionContainerLayers.Fill"]
-        visible: true
-      - state: packet-layer
   - type: Icon
     state: packet-soysauce
   - type: Appearance
@@ -354,12 +316,6 @@
         reagents:
         - ReagentId: Sugar
           Quantity: 10
-  - type: Sprite
-    layers:
-      - state: packet-solid-2
-        map: ["enum.SolutionContainerLayers.Fill"]
-        visible: true
-      - state: packet-layer
   - type: Icon
     state: packet-sugar
   - type: Appearance
@@ -399,6 +355,12 @@
   - type: SolutionContainerVisuals
     maxFillLevels: 6
     fillBaseName: bottle-alpha-
+  - type: GenericVisualizer
+    visuals:
+      enum.OpenableVisuals.Opened:
+        enum.OpenableVisuals.Layer:
+          True: {state: "bottle-open"}
+          False: {state: "bottle-empty"}
   - type: PhysicalComposition
     materialComposition:
       Glass: 50
@@ -418,6 +380,7 @@
   - type: Sprite
     layers:
     - state: bottle-empty
+      map: ["enum.OpenableVisuals.Layer"]
     - state: label-c
     - state: bottle-alpha-6
       map: ["enum.SolutionContainerLayers.Fill"]
@@ -443,6 +406,7 @@
   - type: Sprite
     layers:
     - state: bottle-empty
+      map: ["enum.OpenableVisuals.Layer"]
     - state: label-e
     - state: bottle-alpha-6
       map: ["enum.SolutionContainerLayers.Fill"]
@@ -468,6 +432,7 @@
   - type: Sprite
     layers:
     - state: bottle-empty
+      map: ["enum.OpenableVisuals.Layer"]
     - state: label-v
     - state: bottle-alpha-6
       map: ["enum.SolutionContainerLayers.Fill"]
@@ -490,6 +455,7 @@
   - type: Sprite
     layers:
     - state: bottle-empty
+      map: ["enum.OpenableVisuals.Layer"]
     - state: label-h
     - state: bottle-alpha-6
       map: ["enum.SolutionContainerLayers.Fill"]
@@ -515,6 +481,7 @@
   - type: Sprite
     layers:
     - state: bottle-empty
+      map: ["enum.OpenableVisuals.Layer"]
     - state: label-k
     - state: bottle-alpha-6
       map: ["enum.SolutionContainerLayers.Fill"]
@@ -540,6 +507,7 @@
   - type: Sprite
     layers:
     - state: bottle-empty
+      map: ["enum.OpenableVisuals.Layer"]
     - state: label-b
     - state: bottle-alpha-6
       map: ["enum.SolutionContainerLayers.Fill"]
diff --git a/Resources/Prototypes/Entities/Objects/Consumable/Food/egg.yml b/Resources/Prototypes/Entities/Objects/Consumable/Food/egg.yml
index 449b996dac4..8cd2fa70ee5 100644
--- a/Resources/Prototypes/Entities/Objects/Consumable/Food/egg.yml
+++ b/Resources/Prototypes/Entities/Objects/Consumable/Food/egg.yml
@@ -30,7 +30,6 @@
     sourceSolution: food
     ignoreEmpty: true
     popup: spike-solution-egg
-  - type: DeleteOnTrigger
   # egg fragile
   - type: DamageOnHighSpeedImpact
     minimumSpeed: 0.1
diff --git a/Resources/Prototypes/Entities/Objects/Consumable/Food/produce.yml b/Resources/Prototypes/Entities/Objects/Consumable/Food/produce.yml
index b137cadae0d..24788bb3cc9 100644
--- a/Resources/Prototypes/Entities/Objects/Consumable/Food/produce.yml
+++ b/Resources/Prototypes/Entities/Objects/Consumable/Food/produce.yml
@@ -52,6 +52,9 @@
           Quantity: 10
   - type: Produce
     seedId: wheat
+  - type: Tag
+    tags:
+    - Wheat 
 
 - type: entity
   name: oat bushel
@@ -92,6 +95,36 @@
   - type: Produce
     seedId: sugarcane
 
+- type: entity
+  parent: FoodProduceBase
+  id: FoodLaughinPeaPod
+  name: laughin' pea pod
+  description: The clown's favorite plant.
+  components:
+  - type: FlavorProfile
+    flavors:
+      - peas
+  - type: SolutionContainerManager
+    solutions:
+      food:
+        maxVol: 7
+        reagents:
+        - ReagentId: Nutriment
+          Quantity: 3
+        - ReagentId: Sugar
+          Quantity: 2
+        - ReagentId: Laughter
+          Quantity: 2
+  - type: Extractable
+    juiceSolution:
+      reagents:
+      - ReagentId: LaughinSyrup
+        Quantity: 5
+  - type: Sprite
+    sprite: Objects/Specific/Hydroponics/laughin_pea.rsi
+  - type: Produce
+    seedId: laughinPea
+
 - type: entity
   name: tower-cap log
   description: It's better than bad, it's good!
diff --git a/Resources/Prototypes/Entities/Objects/Decoration/present.yml b/Resources/Prototypes/Entities/Objects/Decoration/present.yml
index 66065d69587..5087e53980f 100644
--- a/Resources/Prototypes/Entities/Objects/Decoration/present.yml
+++ b/Resources/Prototypes/Entities/Objects/Decoration/present.yml
@@ -260,6 +260,10 @@
         orGroup: GiftPool
       - id: FoodBoxDonkpocketPizza
         orGroup: GiftPool
+      - id: FoodBoxDonkpocketStonk
+        orGroup: GiftPool
+      - id: FoodBoxDonkpocketCarp
+        orGroup: GiftPool
       - id: FoodBoxDonkpocketBerry
         orGroup: GiftPool
       - id: FoodBoxDonkpocketHonk
diff --git a/Resources/Prototypes/Entities/Objects/Devices/encryption_keys.yml b/Resources/Prototypes/Entities/Objects/Devices/encryption_keys.yml
index a47d9c8d610..75cca712214 100644
--- a/Resources/Prototypes/Entities/Objects/Devices/encryption_keys.yml
+++ b/Resources/Prototypes/Entities/Objects/Devices/encryption_keys.yml
@@ -203,7 +203,7 @@
   parent: EncryptionKey
   id: EncryptionKeySyndie
   name: blood-red encryption key
-  description: An encryption key used by... wait... Who is owner of this chip?
+  description: An encryption key used by... wait... Who is the owner of this chip?
   components:
   - type: EncryptionKey
     channels:
diff --git a/Resources/Prototypes/Entities/Objects/Devices/station_beacon.yml b/Resources/Prototypes/Entities/Objects/Devices/station_beacon.yml
index 39754d28e78..6cf66ba0421 100644
--- a/Resources/Prototypes/Entities/Objects/Devices/station_beacon.yml
+++ b/Resources/Prototypes/Entities/Objects/Devices/station_beacon.yml
@@ -624,3 +624,10 @@
   - type: NavMapBeacon
     text: station-beacon-cryosleep
 
+- type: entity
+  parent: DefaultStationBeacon
+  id: DefaultStationBeaconEscapePod
+  suffix: Escape Pod
+  components:
+  - type: NavMapBeacon
+    text: station-beacon-escape-pod
diff --git a/Resources/Prototypes/Entities/Objects/Fun/toys.yml b/Resources/Prototypes/Entities/Objects/Fun/toys.yml
index 80e177542ef..480db86441a 100644
--- a/Resources/Prototypes/Entities/Objects/Fun/toys.yml
+++ b/Resources/Prototypes/Entities/Objects/Fun/toys.yml
@@ -1213,7 +1213,16 @@
   - type: Sprite
     sprite: Objects/Fun/glue.rsi
     state: icon
+    layers:
+      - state: icon
+        map: ["enum.OpenableVisuals.Layer"]
   - type: Appearance
+  - type: GenericVisualizer
+    visuals:
+      enum.OpenableVisuals.Opened:
+        enum.OpenableVisuals.Layer:
+          True: {state: "icon_open"}
+          False: {state: "icon"}
   - type: Glue
     consumptionUnit: 10
   - type: Item
diff --git a/Resources/Prototypes/Entities/Objects/Materials/Sheets/glass.yml b/Resources/Prototypes/Entities/Objects/Materials/Sheets/glass.yml
index dc98780792e..f99b9cf0741 100644
--- a/Resources/Prototypes/Entities/Objects/Materials/Sheets/glass.yml
+++ b/Resources/Prototypes/Entities/Objects/Materials/Sheets/glass.yml
@@ -197,6 +197,7 @@
         - ReagentId: Carbon
           Quantity: 0.5
         canReact: false
+        
 - type: entity
   parent: SheetGlassBase
   id: SheetPGlass
diff --git a/Resources/Prototypes/Entities/Objects/Misc/paper.yml b/Resources/Prototypes/Entities/Objects/Misc/paper.yml
index 08f92bf1d0f..aeef66624be 100644
--- a/Resources/Prototypes/Entities/Objects/Misc/paper.yml
+++ b/Resources/Prototypes/Entities/Objects/Misc/paper.yml
@@ -61,6 +61,7 @@
     solution: food
     delay: 7
     forceFeedDelay: 7
+  - type: BadFood
   - type: SolutionContainerManager
     solutions:
       food:
@@ -280,6 +281,21 @@
     materialComposition:
       Steel: 25
 
+- type: entity
+  parent: Pen
+  id: PenEmbeddable
+  abstract: true
+  components:
+  - type: EmbeddableProjectile
+    offset: 0.3,0.0
+    removalTime: 0.0
+  - type: ThrowingAngle
+    angle: 315
+  - type: DamageOtherOnHit
+    damage:
+      types:
+        Piercing: 3
+
 #TODO: I want the luxury pen to write a cool font like Merriweather in the future.
 
 - type: entity
@@ -295,9 +311,9 @@
 
 - type: entity
   name: Cybersun pen
-  parent: Pen
+  parent: PenEmbeddable
   id: CyberPen
-  description: A high-tech pen straight from Cybersun's legal department, capable of refracting hard-light at impossible angles through its diamond tip in order to write.
+  description: A high-tech pen straight from Cybersun's legal department, capable of refracting hard-light at impossible angles through its diamond tip in order to write. So powerful, it's even able to rewrite officially stamped documents should the need arise.
   components:
   - type: Tag
     tags:
@@ -324,7 +340,7 @@
 
 - type: entity
   name: captain's fountain pen
-  parent: Pen
+  parent: PenEmbeddable
   id: PenCap
   description: 'A luxurious fountain pen for the captain of the station.'
   components:
@@ -347,7 +363,7 @@
 
 - type: entity
   name: hop's fountain pen
-  parent: Pen
+  parent: PenEmbeddable
   id: PenHop
   description: 'A luxurious fountain pen for the hop of the station.'
   components:
diff --git a/Resources/Prototypes/Entities/Objects/Misc/tiles.yml b/Resources/Prototypes/Entities/Objects/Misc/tiles.yml
index 361efb52663..445e2c7b5b1 100644
--- a/Resources/Prototypes/Entities/Objects/Misc/tiles.yml
+++ b/Resources/Prototypes/Entities/Objects/Misc/tiles.yml
@@ -745,6 +745,38 @@
   - type: Stack
     stackType: FloorTileStackShuttleRed
 
+- type: entity
+  name: grey shuttle floor
+  parent: FloorTileItemBase
+  id: FloorTileItemShuttleGrey
+  components:
+  - type: Sprite
+    state: shuttlegrey
+  - type: Item
+    heldPrefix: shuttlegrey
+  - type: FloorTile
+    outputs:
+      - Plating
+      - FloorShuttleGrey
+  - type: Stack
+    stackType: FloorTileStackShuttleGrey
+
+- type: entity
+  name: black shuttle floor
+  parent: FloorTileItemBase
+  id: FloorTileItemShuttleBlack
+  components:
+  - type: Sprite
+    state: shuttleblack
+  - type: Item
+    heldPrefix: shuttleblack
+  - type: FloorTile
+    outputs:
+      - Plating
+      - FloorShuttleBlack
+  - type: Stack
+    stackType: FloorTileStackShuttleBlack
+
 # Materials
 - type: entity
   name: gold floor
diff --git a/Resources/Prototypes/Entities/Objects/Specific/Hydroponics/seeds.yml b/Resources/Prototypes/Entities/Objects/Specific/Hydroponics/seeds.yml
index 2bbb720259d..affdc79defa 100644
--- a/Resources/Prototypes/Entities/Objects/Specific/Hydroponics/seeds.yml
+++ b/Resources/Prototypes/Entities/Objects/Specific/Hydroponics/seeds.yml
@@ -82,6 +82,17 @@
     - type: Sprite
       sprite: Objects/Specific/Hydroponics/garlic.rsi
 
+- type: entity
+  parent: SeedBase
+  id: LaughinPeaSeeds
+  name: packet of laughin' pea pods
+  description: "These seeds give off a very soft purple glow.. they should grow into Laughin' Peas."
+  components:
+    - type: Seed
+      seedId: laughinPea
+    - type: Sprite
+      sprite: Objects/Specific/Hydroponics/laughin_pea.rsi
+
 - type: entity
   parent: SeedBase
   name: packet of lemon seeds
diff --git a/Resources/Prototypes/Entities/Objects/Specific/Janitorial/janitor.yml b/Resources/Prototypes/Entities/Objects/Specific/Janitorial/janitor.yml
index 06cf99cc316..ce4eef7453a 100644
--- a/Resources/Prototypes/Entities/Objects/Specific/Janitorial/janitor.yml
+++ b/Resources/Prototypes/Entities/Objects/Specific/Janitorial/janitor.yml
@@ -172,6 +172,16 @@
   - type: GuideHelp
     guides:
     - Janitorial
+  - type: Damageable
+    damageContainer: Inorganic
+  - type: Destructible
+    thresholds:
+    - trigger:
+        !type:DamageTrigger
+        damage: 70
+      behaviors:
+      - !type:DoActsBehavior
+        acts: ["Destruction"]
 
 - type: entity
   name: mop bucket
diff --git a/Resources/Prototypes/Entities/Objects/Specific/Medical/healing.yml b/Resources/Prototypes/Entities/Objects/Specific/Medical/healing.yml
index 0165557f83c..6cf5f57c1b2 100644
--- a/Resources/Prototypes/Entities/Objects/Specific/Medical/healing.yml
+++ b/Resources/Prototypes/Entities/Objects/Specific/Medical/healing.yml
@@ -224,7 +224,32 @@
   components:
   - type: Stack
     lingering: true
-
+- type: entity
+  parent: BaseHealingItem
+  id: Tourniquet
+  name: tourniquet
+  description: Stops bleeding! Hopefully.
+  components:
+    - type: Tag
+      tags:
+        - SecBeltEquip
+    - type: Sprite
+      state: tourniquet
+    - type: Healing
+      damageContainers:
+        - Biological
+      damage:
+        groups:
+          Brute: 5 # Tourniquets HURT!
+        types:
+          Asphyxiation: 5 # Essentially Stopping all blood reaching a part of your body
+      bloodlossModifier: -10 # Tourniquets stop bleeding
+      delay: 0.5
+      healingBeginSound:
+        path: "/Audio/Items/Medical/brutepack_begin.ogg"
+      healingEndSound:
+        path: "/Audio/Items/Medical/brutepack_end.ogg"
+        
 - type: entity
   name: roll of gauze
   description: Some sterile gauze to wrap around bloody stumps.
diff --git a/Resources/Prototypes/Entities/Objects/Specific/Medical/healthanalyzer.yml b/Resources/Prototypes/Entities/Objects/Specific/Medical/healthanalyzer.yml
index 752f98740ad..64bd04569b5 100644
--- a/Resources/Prototypes/Entities/Objects/Specific/Medical/healthanalyzer.yml
+++ b/Resources/Prototypes/Entities/Objects/Specific/Medical/healthanalyzer.yml
@@ -45,8 +45,7 @@
   suffix: Powered
   components:
   - type: PowerCellDraw
-    drawRate: 0
-    useRate: 20
+    drawRate: 1.2 #Calculated for 5 minutes on a small cell
   - type: ActivatableUIRequiresPowerCell
 
 - type: entity
diff --git a/Resources/Prototypes/Entities/Objects/Specific/Medical/morgue.yml b/Resources/Prototypes/Entities/Objects/Specific/Medical/morgue.yml
index c34ca70c457..9d1398c6cae 100644
--- a/Resources/Prototypes/Entities/Objects/Specific/Medical/morgue.yml
+++ b/Resources/Prototypes/Entities/Objects/Specific/Medical/morgue.yml
@@ -118,7 +118,6 @@
   - type: SolutionSpiker
     sourceSolution: food
     ignoreEmpty: true
-  - type: DeleteOnTrigger
   - type: Extractable
     grindableSolutionName: food
 
@@ -141,9 +140,9 @@
           maxVol: 50
           reagents:
             - ReagentId: Ash
-              Quantity: 5
-            - ReagentId: SpaceLube
-              Quantity: 5
+              Quantity: 25
+            - ReagentId: Necrosol
+              Quantity: 25
     - type: GuideHelp
       guides:
       - MinorAntagonists
diff --git a/Resources/Prototypes/Entities/Objects/Specific/Robotics/borg_modules.yml b/Resources/Prototypes/Entities/Objects/Specific/Robotics/borg_modules.yml
index 5bdaddda238..56fe96973d0 100644
--- a/Resources/Prototypes/Entities/Objects/Specific/Robotics/borg_modules.yml
+++ b/Resources/Prototypes/Entities/Objects/Specific/Robotics/borg_modules.yml
@@ -205,6 +205,7 @@
     - Shovel
     - OreBag
     - Crowbar
+    - RadioHandheld
 
 - type: entity
   id: BorgModuleGrapplingGun
@@ -219,6 +220,7 @@
     items:
     - WeaponGrapplingGun
     - WeaponCrusherDagger
+    - HandheldGPSBasic
 
 # engineering modules
 - type: entity
@@ -235,22 +237,9 @@
     - Omnitool
     - WelderExperimental
     - NetworkConfigurator
-
-- type: entity
-  id: BorgModuleGasAnalyzer
-  parent: [ BaseBorgModuleEngineering, BaseProviderBorgModule ]
-  name: gas analyzer cyborg module
-  components:
-  - type: Sprite
-    layers:
-    - state: engineering
-    - state: icon-gas-analyzer
-  - type: ItemBorgModule
-    items:
-    - GasAnalyzer
-    - trayScanner
-    - Crowbar
-    - Wrench
+    - RemoteSignaller
+    - GasAnalyzer   
+    - GeigerCounter
 
 - type: entity
   id: BorgModuleConstruction
@@ -326,6 +315,7 @@
     - AdvMopItem
     - HoloprojectorBorg
     - SprayBottleSpaceCleaner
+    - Dropper
 
 # medical modules
 - type: entity
@@ -437,7 +427,7 @@
     - HandLabeler
     - Lighter
     - DrinkShaker
-    - Syringe
+    - BorgDropper
 
 - type: entity
   id: BorgModuleMusique
diff --git a/Resources/Prototypes/Entities/Objects/Specific/chemistry.yml b/Resources/Prototypes/Entities/Objects/Specific/chemistry.yml
index a8acc5ff9c4..ab65940fabc 100644
--- a/Resources/Prototypes/Entities/Objects/Specific/chemistry.yml
+++ b/Resources/Prototypes/Entities/Objects/Specific/chemistry.yml
@@ -454,7 +454,6 @@
         maxVol: 20
   - type: SolutionSpiker
     sourceSolution: food
-  - type: DeleteOnTrigger
   - type: Extractable
     grindableSolutionName: food
   - type: StaticPrice
diff --git a/Resources/Prototypes/Entities/Objects/Weapons/Bombs/pen.yml b/Resources/Prototypes/Entities/Objects/Weapons/Bombs/pen.yml
index 029649ab370..c6c37d36424 100644
--- a/Resources/Prototypes/Entities/Objects/Weapons/Bombs/pen.yml
+++ b/Resources/Prototypes/Entities/Objects/Weapons/Bombs/pen.yml
@@ -1,7 +1,7 @@
 - type: entity
   name: pen
   suffix: Exploding
-  parent: Pen
+  parent: PenEmbeddable
   description: A dark ink pen.
   id: PenExploding
   components:
diff --git a/Resources/Prototypes/Entities/Objects/Weapons/Guns/Ammunition/Projectiles/shotgun.yml b/Resources/Prototypes/Entities/Objects/Weapons/Guns/Ammunition/Projectiles/shotgun.yml
index 36b1b2a99f1..e62fb9115e3 100644
--- a/Resources/Prototypes/Entities/Objects/Weapons/Guns/Ammunition/Projectiles/shotgun.yml
+++ b/Resources/Prototypes/Entities/Objects/Weapons/Guns/Ammunition/Projectiles/shotgun.yml
@@ -1,4 +1,4 @@
-- type: entity
+- type: entity
   id: PelletShotgunSlug
   name: pellet (.50 slug)
   noSpawn: true
@@ -26,7 +26,7 @@
       types:
         Blunt: 10
   - type: StaminaDamageOnCollide
-    damage: 55 # 2 hits to stun
+    damage: 40 # 3 hits to stun
 
 - type: entity
   id: PelletShotgun
diff --git a/Resources/Prototypes/Entities/Structures/Doors/Airlocks/assembly.yml b/Resources/Prototypes/Entities/Structures/Doors/Airlocks/assembly.yml
index 2fc5817287f..bb9d5cccdd6 100644
--- a/Resources/Prototypes/Entities/Structures/Doors/Airlocks/assembly.yml
+++ b/Resources/Prototypes/Entities/Structures/Doors/Airlocks/assembly.yml
@@ -2,7 +2,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyAtmospherics
-  name: airlock assembly
   suffix: Atmospherics
   components:
   - type: Sprite
@@ -12,7 +11,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyAtmosphericsGlass
-  name: airlock assembly
   suffix: Atmospherics, Glass
   components:
   - type: Sprite
@@ -23,7 +21,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyCargo
-  name: airlock assembly
   suffix: Cargo
   components:
   - type: Sprite
@@ -33,7 +30,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyCargoGlass
-  name: airlock assembly
   suffix: Cargo, Glass
   components:
   - type: Sprite
@@ -44,7 +40,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyCommand
-  name: airlock assembly
   suffix: Command
   components:
   - type: Sprite
@@ -54,7 +49,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyCommandGlass
-  name: airlock assembly
   suffix: Command, Glass
   components:
   - type: Sprite
@@ -65,7 +59,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyEngineering
-  name: airlock assembly
   suffix: Engineering
   components:
   - type: Sprite
@@ -75,7 +68,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyEngineeringGlass
-  name: airlock assembly
   suffix: Engineering, Glass
   components:
   - type: Sprite
@@ -86,7 +78,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyExternal
-  name: airlock assembly
   suffix: External
   components:
   - type: Sprite
@@ -96,7 +87,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyExternalGlass
-  name: airlock assembly
   suffix: External, Glass
   components:
   - type: Sprite
@@ -107,7 +97,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyGlass
-  name: airlock assembly
   suffix: Glass
   components:
   - type: Sprite
@@ -118,7 +107,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyFreezer
-  name: airlock assembly
   suffix: Freezer
   components:
   - type: Sprite
@@ -129,7 +117,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyMaintenance
-  name: airlock assembly
   suffix: Maintenance
   components:
   - type: Sprite
@@ -139,7 +126,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyMaintenanceGlass
-  name: airlock assembly
   suffix: Maintenance, Glass
   components:
   - type: Sprite
@@ -150,7 +136,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyMedical
-  name: airlock assembly
   suffix: Medical
   components:
   - type: Sprite
@@ -160,7 +145,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyMedicalGlass
-  name: airlock assembly
   suffix: Medical, Glass
   components:
   - type: Sprite
@@ -171,7 +155,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyScience
-  name: airlock assembly
   suffix: Science
   components:
   - type: Sprite
@@ -181,7 +164,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyScienceGlass
-  name: airlock assembly
   suffix: Science, Glass
   components:
   - type: Sprite
@@ -192,7 +174,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblySecurity
-  name: airlock assembly
   suffix: Security
   components:
   - type: Sprite
@@ -202,7 +183,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblySecurityGlass
-  name: airlock assembly
   suffix: Security, Glass
   components:
   - type: Sprite
@@ -213,7 +193,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyShuttle
-  name: airlock assembly
   suffix: Shuttle
   components:
   - type: Sprite
@@ -223,7 +202,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyShuttleGlass
-  name: airlock assembly
   suffix: Shuttle, Glass
   components:
   - type: Sprite
@@ -234,7 +212,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyVirology
-  name: airlock assembly
   suffix: Virology
   components:
   - type: Sprite
@@ -244,7 +221,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyVirologyGlass
-  name: airlock assembly
   suffix: Virology, Glass
   components:
   - type: Sprite
@@ -255,7 +231,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyCentralCommand
-  name: airlock assembly
   suffix: CentralCommand
   components:
   - type: Sprite
@@ -265,7 +240,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyCentralCommandGlass
-  name: airlock assembly
   suffix: CentralCommand, Glass
   components:
   - type: Sprite
@@ -276,7 +250,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyMining
-  name: airlock assembly
   suffix: Mining
   components:
   - type: Sprite
@@ -286,7 +259,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyMiningGlass
-  name: airlock assembly
   suffix: Mining, Glass
   components:
   - type: Sprite
@@ -297,7 +269,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblySyndicate
-  name: airlock assembly
   suffix: Syndicate
   components:
   - type: Sprite
@@ -307,7 +278,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblySyndicateGlass
-  name: airlock assembly
   suffix: Syndicate, Glass
   components:
   - type: Sprite
@@ -318,7 +288,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyShuttleSyndicate
-  name: airlock assembly
   suffix: ShuttleSyndicate
   components:
   - type: Sprite
@@ -328,7 +297,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyShuttleSyndicateGlass
-  name: airlock assembly
   suffix: ShuttleSyndicate, Glass
   components:
   - type: Sprite
@@ -339,7 +307,6 @@
 - type: entity
   parent: AirlockAssembly
   id: AirlockAssemblyHighSec
-  name: airlock assembly
   suffix: HighSec
   components:
   - type: Sprite
diff --git a/Resources/Prototypes/Entities/Structures/Machines/Computers/computers.yml b/Resources/Prototypes/Entities/Structures/Machines/Computers/computers.yml
index 5aa1680aaea..c9cbb34d63e 100644
--- a/Resources/Prototypes/Entities/Structures/Machines/Computers/computers.yml
+++ b/Resources/Prototypes/Entities/Structures/Machines/Computers/computers.yml
@@ -285,8 +285,15 @@
   parent: BaseComputer
   id: ComputerCriminalRecords
   name: criminal records computer
-  description: This can be used to check criminal records.
+  description: This can be used to check criminal records. Only security can modify them.
   components:
+  - type: CriminalRecordsConsole
+  - type: UserInterface
+    interfaces:
+    - key: enum.CriminalRecordsConsoleKey.Key
+      type: CriminalRecordsConsoleBoundUserInterface
+  - type: ActivatableUI
+    key: enum.CriminalRecordsConsoleKey.Key
   - type: Sprite
     layers:
     - map: ["computerLayerBody"]
@@ -303,6 +310,11 @@
     color: "#1f8c28"
   - type: Computer
     board: CriminalRecordsComputerCircuitboard
+  - type: AccessReader
+    access: [["Security"]]
+  - type: GuideHelp
+    guides:
+    - CriminalRecords
 
 - type: entity
   parent: BaseComputer
diff --git a/Resources/Prototypes/Entities/Structures/Machines/lathe.yml b/Resources/Prototypes/Entities/Structures/Machines/lathe.yml
index f83151c0de4..7f812119a9d 100644
--- a/Resources/Prototypes/Entities/Structures/Machines/lathe.yml
+++ b/Resources/Prototypes/Entities/Structures/Machines/lathe.yml
@@ -252,6 +252,10 @@
   - type: Lathe
     idleState: icon
     runningState: building
+    staticRecipes:
+    - LargeBeaker
+    - Dropper
+    - ClothingEyesGlassesChemical
     dynamicRecipes:
       - PowerDrill
       - MiningDrill
@@ -266,11 +270,8 @@
       - HoloprojectorField
       - Saw
       - Hemostat
-      - Beaker
-      - LargeBeaker
       - CryostasisBeaker
       - SyringeCryostasis
-      - Dropper
       - Syringe
       - Implanter
       - PillCanister
@@ -309,7 +310,6 @@
       - ClothingBackpackDuffelHolding
       - WelderExperimental
       - JawsOfLife
-      - ClothingEyesGlassesChemical
       - FauxTileAstroGrass
       - FauxTileAstroIce
       - OreBagOfHolding
@@ -368,11 +368,19 @@
     - MaterialReclaimerMachineCircuitboard
     - ElectrolysisUnitMachineCircuitboard
     - CentrifugeMachineCircuitboard
+    - ChemDispenserMachineCircuitboard
+    - ChemMasterMachineCircuitboard
     - CondenserMachineCircuitBoard
+    - HotplateMachineCircuitboard
     - PrinterDocMachineCircuitboard # Corvax-Printer
     - UniformPrinterMachineCircuitboard
     - FloorGreenCircuit
     - FloorBlueCircuit
+    - MicrowaveMachineCircuitboard
+    - ReagentGrinderMachineCircuitboard
+    - ElectricGrillMachineCircuitboard
+    - BoozeDispenserMachineCircuitboard
+    - SodaDispenserMachineCircuitboard
     dynamicRecipes:
       - ThermomachineFreezerMachineCircuitBoard
       - HellfireFreezerMachineCircuitBoard
@@ -382,8 +390,6 @@
       - CryoPodMachineCircuitboard
       - VaccinatorMachineCircuitboard
       - DiagnoserMachineCircuitboard
-      - ChemMasterMachineCircuitboard
-      - ChemDispenserMachineCircuitboard
       - BiomassReclaimerMachineCircuitboard
       - BiofabricatorMachineCircuitboard
       - SurveillanceCameraRouterCircuitboard
@@ -400,10 +406,6 @@
       - PowerComputerCircuitboard
       - AutolatheHyperConvectionMachineCircuitboard
       - ProtolatheHyperConvectionMachineCircuitboard
-      - ReagentGrinderMachineCircuitboard
-      - HotplateMachineCircuitboard
-      - MicrowaveMachineCircuitboard
-      - ElectricGrillMachineCircuitboard
       - FatExtractorMachineCircuitboard
       - FlatpackerMachineCircuitboard
       - SheetifierMachineCircuitboard
@@ -445,8 +447,6 @@
       - ArtifactAnalyzerMachineCircuitboard
       - TraversalDistorterMachineCircuitboard
       - ArtifactCrusherMachineCircuitboard
-      - BoozeDispenserMachineCircuitboard
-      - SodaDispenserMachineCircuitboard
       - TelecomServerCircuitboard
       - MassMediaCircuitboard
   - type: MaterialStorage
@@ -531,7 +531,6 @@
     - BorgModuleAdvancedCleaning
     - BorgModuleMining
     - BorgModuleGrapplingGun
-    - BorgModuleGasAnalyzer
     - BorgModuleAdvancedTool
     - BorgModuleRCD
     - BorgModuleArtifact
@@ -804,9 +803,13 @@
       - Defibrillator
       - HandheldHealthAnalyzer
       - ClothingHandsGlovesLatex
+      - ClothingHandsGlovesNitrile
       - ClothingMaskSterile
       - DiseaseSwab
       - Beaker
+      - LargeBeaker
+      - Dropper
+      - Jug
       - Syringe
       - Implanter
       - PillCanister
@@ -823,20 +826,18 @@
       - MedkitAdvanced
       - MedkitRadiation
       - MedkitCombat
-    dynamicRecipes:
-      - ClothingHandsGlovesNitrile
-      - CryostasisBeaker
-      - LargeBeaker
-      - Dropper
       - Scalpel
       - Retractor
       - Cautery
       - Drill
       - Saw
       - Hemostat
+      - ClothingEyesGlassesChemical
+    dynamicRecipes:
+      - ChemicalPayload
+      - CryostasisBeaker
       - BluespaceBeaker
       - SyringeBluespace
-      - Jug
       - SyringeCryostasis
   - type: Machine
     board: MedicalTechFabCircuitboard
@@ -929,10 +930,12 @@
       - ClothingUniformJumpsuitPrisoner
       - ClothingUniformJumpskirtPrisoner
       - ClothingHeadHatQMsoft
+      - ClothingHeadHatBeretQM
       - ClothingUniformJumpsuitQM
       - ClothingUniformJumpskirtQM
       - ClothingUniformJumpsuitQMTurtleneck
       - ClothingUniformJumpskirtQMTurtleneck
+      - ClothingUniformJumpsuitQMFormal
       - ClothingHeadHatBeretRND
       - ClothingUniformJumpsuitResearchDirector
       - ClothingUniformJumpskirtResearchDirector
@@ -988,6 +991,15 @@
       - ClothingNeckTieRed
       - ClothingNeckTieDet
       - ClothingNeckTieSci
+      # Scarfs - All scarfs avaible in winterdrobe
+      - ClothingNeckScarfStripedGreen
+      - ClothingNeckScarfStripedBlue
+      - ClothingNeckScarfStripedRed
+      - ClothingNeckScarfStripedBrown
+      - ClothingNeckScarfStripedLightBlue
+      - ClothingNeckScarfStripedOrange
+      - ClothingNeckScarfStripedBlack
+      - ClothingNeckScarfStripedPurple
   - type: EmagLatheRecipes
     emagStaticRecipes:
       - ClothingHeadHatCentcomcap
diff --git a/Resources/Prototypes/Entities/Structures/Machines/research.yml b/Resources/Prototypes/Entities/Structures/Machines/research.yml
index 66ea8e538ad..7b369f62cc9 100644
--- a/Resources/Prototypes/Entities/Structures/Machines/research.yml
+++ b/Resources/Prototypes/Entities/Structures/Machines/research.yml
@@ -15,7 +15,6 @@
   - type: TechnologyDatabase
     supportedDisciplines:
     - Industrial
-    - Biochemical
     - Arsenal
     - Experimental
     - CivilianServices
diff --git a/Resources/Prototypes/Entities/Structures/Power/Generation/Singularity/collector.yml b/Resources/Prototypes/Entities/Structures/Power/Generation/Singularity/collector.yml
index 73ce2217878..3742c037ff5 100644
--- a/Resources/Prototypes/Entities/Structures/Power/Generation/Singularity/collector.yml
+++ b/Resources/Prototypes/Entities/Structures/Power/Generation/Singularity/collector.yml
@@ -62,21 +62,11 @@
       - reactantPrototype: Plasma
         powerGenerationEfficiency: 1
         reactantBreakdownRate: 0.0001
-    # Note that this doesn't matter too much (see next comment)
-    # However it does act as a cap on power receivable via the collector.
-  - type: Battery
-    maxCharge: 100000
-    startingCharge: 0
-  - type: BatteryDischarger
-    # This is JUST a default. It has to be dynamically adjusted to ensure that the battery doesn't discharge "too fast" & run out immediately, while still scaling by input power.
-    activeSupplyRate: 100000
   - type: RadiationReceiver
+  - type: PowerSupplier
   - type: Anchorable
   - type: Rotatable
   - type: Pullable
-  - type: PowerNetworkBattery
-    maxSupply: 1000000000
-    supplyRampTolerance: 1000000000
   - type: GuideHelp
     guides: [ Singularity, Power ]
   - type: ContainerContainer
diff --git a/Resources/Prototypes/Entities/Structures/Storage/Crates/crates.yml b/Resources/Prototypes/Entities/Structures/Storage/Crates/crates.yml
index 31340114da2..c6117ae853b 100644
--- a/Resources/Prototypes/Entities/Structures/Storage/Crates/crates.yml
+++ b/Resources/Prototypes/Entities/Structures/Storage/Crates/crates.yml
@@ -40,6 +40,8 @@
   - type: Sprite
     sprite: Structures/Storage/Crates/freezer.rsi
   - type: AntiRottingContainer
+  - type: ExplosionResistance
+    damageCoefficient: 0.50
 
 - type: entity
   parent: CratePlastic
diff --git a/Resources/Prototypes/Entities/Structures/Storage/glass_box.yml b/Resources/Prototypes/Entities/Structures/Storage/glass_box.yml
new file mode 100644
index 00000000000..bdb02d2bc35
--- /dev/null
+++ b/Resources/Prototypes/Entities/Structures/Storage/glass_box.yml
@@ -0,0 +1,139 @@
+- type: entity
+  id: GlassBoxLaser
+  name: glass box
+  description: A sturdy showcase for an expensive exhibit.
+  parent: BaseStructureDynamic
+  placement:
+    mode: SnapgridCenter
+  components:
+  - type: Anchorable
+    delay: 4
+  - type: Transform
+    anchored: true
+  - type: Damageable
+    damageContainer: Inorganic
+    damageModifierSet: Glass
+  - type: MeleeSound
+    soundGroups:
+      Brute:
+        collection: GlassSmash
+  - type: Physics
+    bodyType: Static
+  - type: Clickable
+  - type: InteractionOutline
+  - type: Sprite
+    sprite: Structures/Storage/glassbox.rsi
+    layers:
+    - state: glassbox
+    - state: caplaser
+      map: ["enum.ItemCabinetVisualLayers.ContainsItem"]
+      visible: true
+    - state: glass
+      map: ["enum.ItemCabinetVisualLayers.Door"]
+  - type: ItemCabinet
+    cabinetSlot:
+      ejectOnInteract: true
+      whitelist:
+        tags:
+        - WeaponAntiqueLaser
+    doorSound:
+      path: /Audio/Machines/machine_switch.ogg
+    openState: glass-up
+    closedState: glass
+  - type: Lock
+  - type: AccessReader
+    access: [["Captain"]]
+  - type: ItemSlots
+  - type: ContainerContainer
+    containers:
+      ItemCabinet: !type:ContainerSlot
+  - type: Repairable
+  - type: Appearance
+  - type: DamageVisuals
+    thresholds: [4, 8, 12]
+    damageDivisor: 7.555
+    trackAllDamage: true
+    damageOverlay:
+      sprite: Structures/Storage/glassbox.rsi
+  - type: Destructible
+    thresholds:
+    - trigger:
+        !type:DamageTrigger
+        damage: 150
+      behaviors:
+        - !type:EmptyAllContainersBehaviour
+        - !type:PlaySoundBehavior
+          sound:
+            collection: WindowShatter
+        - !type:SpawnEntitiesBehavior
+          spawn:
+            ShardGlassReinforced:
+              min: 1
+              max: 1
+            GlassBoxLaserBroken:
+              min: 1
+              max: 1
+        - !type:DoActsBehavior
+          acts: [ "Destruction" ]
+
+- type: entity
+  id: GlassBoxLaserOpen
+  parent: GlassBoxLaser
+  suffix: Open
+  components:
+  - type: ItemCabinet
+    opened: true
+    doorSound:
+      path: /Audio/Machines/machine_switch.ogg
+    openState: glass-up
+    closedState: glass
+
+- type: entity
+  id: GlassBoxLaserFilled
+  parent: GlassBoxLaser
+  suffix: Filled
+  components:
+  - type: ItemCabinet
+    cabinetSlot:
+      startingItem: WeaponAntiqueLaser
+      ejectOnInteract: true
+      whitelist:
+        tags:
+        - WeaponAntiqueLaser
+    doorSound:
+      path: /Audio/Machines/machine_switch.ogg
+    openState: glass-up
+    closedState: glass
+
+- type: entity
+  id: GlassBoxLaserFilledOpen
+  parent: GlassBoxLaserFilled
+  suffix: Filled, Open
+  components:
+  - type: ItemCabinet
+    opened: true
+    doorSound:
+      path: /Audio/Machines/machine_switch.ogg
+    openState: glass-up
+    closedState: glass
+
+- type: entity
+  id: GlassBoxLaserBroken
+  name: broken glass box
+  description: A broken showcase for a stolen expensive exhibit.
+  parent: BaseStructureDynamic
+  suffix: Broken
+  placement:
+    mode: SnapgridCenter
+  components:
+  - type: Transform
+    anchored: true
+  - type: Physics
+    bodyType: Static
+  - type: Sprite
+    sprite: Structures/Storage/glassbox.rsi
+    layers:
+    - state: glassbox
+    - state: glass-4
+  - type: Clickable
+  - type: InteractionOutline
diff --git a/Resources/Prototypes/Flavors/flavors.yml b/Resources/Prototypes/Flavors/flavors.yml
index af83922c44f..e08d73e834f 100644
--- a/Resources/Prototypes/Flavors/flavors.yml
+++ b/Resources/Prototypes/Flavors/flavors.yml
@@ -647,7 +647,7 @@
 - type: flavor
   id: spaceup
   flavorType: Complex
-  description: flavor-complex-root-space-up
+  description: flavor-complex-space-up-soda
 
 - type: flavor
   id: grapesoda
@@ -998,3 +998,13 @@
   id: light
   flavorType: Complex
   description: flavor-complex-light
+
+- type: flavor
+  id: profits
+  flavorType: Complex
+  description: flavor-complex-profits
+
+- type: flavor
+  id: fishops
+  flavorType: Complex
+  description: flavor-complex-fishops
diff --git a/Resources/Prototypes/Guidebook/security.yml b/Resources/Prototypes/Guidebook/security.yml
index 8e734b4d137..f5e34708283 100644
--- a/Resources/Prototypes/Guidebook/security.yml
+++ b/Resources/Prototypes/Guidebook/security.yml
@@ -3,8 +3,9 @@
   name: guide-entry-security
   text: "/ServerInfo/Guidebook/Security/Security.xml"
   children:
-    - Forensics
-    - Defusal
+  - Forensics
+  - Defusal
+  - CriminalRecords
 
 - type: guideEntry
   id: Forensics
@@ -15,3 +16,8 @@
   id: Defusal
   name: guide-entry-defusal
   text: "/ServerInfo/Guidebook/Security/Defusal.xml"
+
+- type: guideEntry
+  id: CriminalRecords
+  name: guide-entry-criminal-records
+  text: "/ServerInfo/Guidebook/Security/CriminalRecords.xml"
diff --git a/Resources/Prototypes/Hydroponics/seeds.yml b/Resources/Prototypes/Hydroponics/seeds.yml
index 7c94546602c..649ffa85224 100644
--- a/Resources/Prototypes/Hydroponics/seeds.yml
+++ b/Resources/Prototypes/Hydroponics/seeds.yml
@@ -136,6 +136,39 @@
       Max: 4
       PotencyDivisor: 25
 
+- type: seed
+  id: laughinPea
+  name: seeds-laughin-pea-name
+  noun: seeds-noun-seeds
+  displayName: seeds-laughin-pea-display-name
+  plantRsi: Objects/Specific/Hydroponics/laughin_pea.rsi
+  packetPrototype: LaughinPeaSeeds
+  productPrototypes:
+    - FoodLaughinPeaPod
+  lifespan: 25
+  growthStages: 3
+  maturation: 8
+  production: 6
+  yield: 3
+  potency: 25
+  idealLight: 8
+  harvestRepeat: Repeat
+  nutrientConsumption: 0.6
+  waterConsumption: 0.6
+  chemicals:
+    Nutriment:
+      Min: 1
+      Max: 3
+      PotencyDivisor: 33
+    Sugar:
+      Min: 1
+      Max: 5
+      PotencyDivisor: 50
+    Laughter:
+      Min: 1
+      Max: 5
+      PotencyDivisor: 50
+
 - type: seed
   id: lemon
   name: seeds-lemon-name
@@ -1344,6 +1377,8 @@
   packetPrototype: PeaSeeds
   productPrototypes:
     - FoodPeaPod
+  mutationPrototypes:
+    - laughinPea
   lifespan: 25
   growthStages: 3
   maturation: 8
diff --git a/Resources/Prototypes/Maps/fland.yml b/Resources/Prototypes/Maps/fland.yml
index 6f9740d9651..70ff5362a4c 100644
--- a/Resources/Prototypes/Maps/fland.yml
+++ b/Resources/Prototypes/Maps/fland.yml
@@ -14,6 +14,8 @@
             prefixCreator: 'B'
         - type: StationEmergencyShuttle
           emergencyShuttlePath: /Maps/Shuttles/emergency_delta.yml
+        - type: StationCargoShuttle
+          path: /Maps/Shuttles/cargo_fland.yml
         - type: StationJobs
           overflowJobs:
             - Passenger
diff --git a/Resources/Prototypes/Palettes/text.yml b/Resources/Prototypes/Palettes/text.yml
index de0a9fb60d9..48d20741532 100644
--- a/Resources/Prototypes/Palettes/text.yml
+++ b/Resources/Prototypes/Palettes/text.yml
@@ -32,4 +32,21 @@
     amber-lighten-2: "#755900"
     amber-darken-2: "#cc8000"
     amber-accent-2: "#7c6200"
-    amber-accent-4: "#996700"
\ No newline at end of file
+    amber-accent-4: "#996700"
+
+- type: palette
+  id: ChatNames
+  name: Chat Names
+  colors:
+    ploink: "#da8bc9"
+    ourple: "#b18bda"
+    us-navy: "#96a4eb"
+    yet-another-blue: "#8cb7e8"
+    cyan: "#8bc9da"
+    fake-color: "#8bdaba"
+    green: "#8bda8e"
+    you-wish-you-were-green: "#a9da8b"
+    piss: "#ceda8b"
+    orange: "#dabc8b"
+    the-orange-she-tells-you-not-to-worry-about: "#daa58b"
+    red: "#da8b8b"
diff --git a/Resources/Prototypes/Procedural/salvage_loot.yml b/Resources/Prototypes/Procedural/salvage_loot.yml
index ed649f54b3a..92b04496baa 100644
--- a/Resources/Prototypes/Procedural/salvage_loot.yml
+++ b/Resources/Prototypes/Procedural/salvage_loot.yml
@@ -27,6 +27,8 @@
         - proto: CloningPodMachineCircuitboard
           cost: 2
         - proto: CognizineChemistryBottle
+        - proto: FoodBoxDonkpocketCarp
+          prob: 0.5
         - proto: CrateSalvageEquipment
           cost: 3
           prob: 0.5
diff --git a/Resources/Prototypes/Reagents/Consumable/Drink/alcohol.yml b/Resources/Prototypes/Reagents/Consumable/Drink/alcohol.yml
index 49d05592ac4..c689d8e2eaa 100644
--- a/Resources/Prototypes/Reagents/Consumable/Drink/alcohol.yml
+++ b/Resources/Prototypes/Reagents/Consumable/Drink/alcohol.yml
@@ -54,7 +54,7 @@
   desc: reagent-desc-blue-curacao
   physicalDesc: reagent-physical-desc-strong-smelling
   flavor: alcohol
-  color: "#0000CD"
+  color: "#0099FF"
   metamorphicSprite:
     sprite: Objects/Consumable/Drinks/curacaoglass.rsi
     state: icon
@@ -204,7 +204,7 @@
   desc: reagent-desc-melon-liquor
   physicalDesc: reagent-physical-desc-strong-smelling
   flavor: watermelon
-  color: "#138808"
+  color: "#00FF33"
   metamorphicSprite:
     sprite: Objects/Consumable/Drinks/emeraldglass.rsi
     state: icon
@@ -254,7 +254,7 @@
   desc: reagent-desc-rum
   physicalDesc: reagent-physical-desc-strong-smelling
   flavor: rum
-  color: "#664300"
+  color: "#f09f42"
   recognizable: true
   metamorphicSprite:
     sprite: Objects/Consumable/Drinks/rumglass.rsi
@@ -334,7 +334,7 @@
   desc: reagent-desc-whiskey
   physicalDesc: reagent-physical-desc-strong-smelling
   flavor: whiskey
-  color: "#664300"
+  color: "#ee7732"
   recognizable: true
   metamorphicSprite:
     sprite: Objects/Consumable/Drinks/whiskeyglass.rsi
diff --git a/Resources/Prototypes/Reagents/Consumable/Drink/soda.yml b/Resources/Prototypes/Reagents/Consumable/Drink/soda.yml
index af1b496a4f6..e3f1a0e8367 100644
--- a/Resources/Prototypes/Reagents/Consumable/Drink/soda.yml
+++ b/Resources/Prototypes/Reagents/Consumable/Drink/soda.yml
@@ -5,7 +5,7 @@
   desc: reagent-desc-cola
   physicalDesc: reagent-physical-desc-fizzy
   flavor: soda
-  color: "#422912"
+  color: "#6c2828"
   recognizable: true
 
 - type: reagent
@@ -117,7 +117,7 @@
   desc: reagent-desc-space-mountain-wind
   physicalDesc: reagent-physical-desc-fizzy
   flavor: sodacitrus
-  color: "#102000"
+  color: "#a6fa5a"
 
 - type: reagent
   id: SpaceUp
@@ -126,7 +126,7 @@
   desc: reagent-desc-space-up
   physicalDesc: reagent-physical-desc-fizzy
   flavor: spaceup
-  color: "#00FF00"
+  color: "#e3e3e37d"
 
 - type: reagent
   id: Starkist
diff --git a/Resources/Prototypes/Reagents/Consumable/Food/condiments.yml b/Resources/Prototypes/Reagents/Consumable/Food/condiments.yml
index f980f5066aa..8fbfd3cd64b 100644
--- a/Resources/Prototypes/Reagents/Consumable/Food/condiments.yml
+++ b/Resources/Prototypes/Reagents/Consumable/Food/condiments.yml
@@ -77,6 +77,16 @@
   color: "#fba399"
   recognizable: true
 
+- type: reagent
+  id: LaughinSyrup
+  name: reagent-name-laughin-syrup
+  group: Foods
+  desc: reagent-desc-laughin-syrup
+  physicalDesc: reagent-physical-desc-funny
+  flavor: sweet
+  color: "#803280"
+  recognizable: true
+
 - type: reagent
   id: Mayo
   name: reagent-name-mayo
diff --git a/Resources/Prototypes/Reagents/cleaning.yml b/Resources/Prototypes/Reagents/cleaning.yml
index 24f0c033cf1..da02fc666d8 100644
--- a/Resources/Prototypes/Reagents/cleaning.yml
+++ b/Resources/Prototypes/Reagents/cleaning.yml
@@ -64,36 +64,6 @@
           min: 6
         probability: 0.20
 
-- type: reagent
-  id: SoapyWater
-  parent: Water
-  name: reagent-name-soapy-water
-  desc: reagent-desc-soapy-water
-  physicalDesc: reagent-physical-desc-soapy
-  flavor: clean
-  color: "#9ec8dc"
-  recognizable: true
-  metabolisms:
-    Drink:
-      effects:
-      - !type:SatiateThirst
-        factor: 3
-      - !type:ChemVomit
-        conditions:
-        - !type:ReagentThreshold
-          min: 6
-        probability: 0.10
-        thirstAmount: -5.0
-        hungerAmount: -5.0
-  plantMetabolism:
-  - !type:PlantAdjustWater
-    amount: .8
-  tileReactions:
-    - !type:CleanDecalsReaction
-      cleanCost: 5
-    - !type:ExtinguishTileReaction { }
-    - !type:SpillIfPuddlePresentTileReaction { }
-
 - type: reagent
   id: SpaceLube
   name: reagent-name-space-lube
diff --git a/Resources/Prototypes/Reagents/fun.yml b/Resources/Prototypes/Reagents/fun.yml
index d22e2213ace..25b0e8da809 100644
--- a/Resources/Prototypes/Reagents/fun.yml
+++ b/Resources/Prototypes/Reagents/fun.yml
@@ -298,3 +298,24 @@
         messages: [ "fresium-effect-frozen"]
         probability: 0.4
 
+- type: reagent
+  id: Laughter
+  name: reagent-name-laughter
+  group: Special
+  desc: reagent-desc-laughter
+  physicalDesc: reagent-physical-desc-funny
+  flavor: funny
+  color: "#FF4DD2"
+  slippery: true #clown juice gotta slip
+  metabolisms:
+    Medicine:
+      effects:
+      - !type:Emote
+        emote: Laugh
+        probability: 0.3
+      - !type:PopupMessage
+        type: Local
+        visualType: Large
+        messages: [ "laughter-effect-control-laughter" ]
+        probability: 0.2
+
diff --git a/Resources/Prototypes/Recipes/Construction/utilities.yml b/Resources/Prototypes/Recipes/Construction/utilities.yml
index bdb0c814a4a..1647e98bcea 100644
--- a/Resources/Prototypes/Recipes/Construction/utilities.yml
+++ b/Resources/Prototypes/Recipes/Construction/utilities.yml
@@ -475,7 +475,6 @@
   - sprite: Structures/Piping/Atmospherics/vent.rsi
     state: vent_off
   conditions:
-    - !type:TileNotBlocked {}
     - !type:NoUnstackableInTile
 
 - type: construction
@@ -497,7 +496,6 @@
   - sprite: Structures/Piping/Atmospherics/vent.rsi
     state: vent_off
   conditions:
-    - !type:TileNotBlocked {}
     - !type:NoUnstackableInTile
 
 - type: construction
@@ -519,7 +517,6 @@
   - sprite: Structures/Piping/Atmospherics/scrubber.rsi
     state: scrub_off
   conditions:
-    - !type:TileNotBlocked {}
     - !type:NoUnstackableInTile
 
 - type: construction
@@ -541,7 +538,6 @@
   - sprite: Structures/Piping/Atmospherics/outletinjector.rsi
     state: injector
   conditions:
-    - !type:TileNotBlocked {}
     - !type:NoUnstackableInTile
 
 # ATMOS BINARY
@@ -564,7 +560,6 @@
   - sprite: Structures/Piping/Atmospherics/pump.rsi
     state: pumpPressure
   conditions:
-    - !type:TileNotBlocked {}
     - !type:NoUnstackableInTile
 
 - type: construction
@@ -586,7 +581,6 @@
   - sprite: Structures/Piping/Atmospherics/pump.rsi
     state: pumpVolume
   conditions:
-    - !type:TileNotBlocked {}
     - !type:NoUnstackableInTile
 
 - type: construction
@@ -608,7 +602,6 @@
   - sprite: Structures/Piping/Atmospherics/pump.rsi
     state: pumpPassiveGate
   conditions:
-    - !type:TileNotBlocked {}
     - !type:NoUnstackableInTile
 
 - type: construction
@@ -630,7 +623,6 @@
   - sprite: Structures/Piping/Atmospherics/pump.rsi
     state: pumpManualValve
   conditions:
-    - !type:TileNotBlocked {}
     - !type:NoUnstackableInTile
 
 - type: construction
@@ -652,7 +644,6 @@
   - sprite: Structures/Piping/Atmospherics/pump.rsi
     state: pumpSignalValve
   conditions:
-  - !type:TileNotBlocked {}
   - !type:NoUnstackableInTile
 
 - type: construction
@@ -674,7 +665,6 @@
   - sprite: Structures/Piping/Atmospherics/gascanisterport.rsi
     state: gasCanisterPort
   conditions:
-    - !type:TileNotBlocked {}
     - !type:NoUnstackableInTile
 
 - type: construction
@@ -695,8 +685,6 @@
     state: pipeStraight
   - sprite: Structures/Piping/Atmospherics/vent.rsi
     state: vent_off
-  conditions:
-    - !type:TileNotBlocked {}
 
 - type: construction
   id: HeatExchanger
@@ -711,8 +699,6 @@
   icon:
     sprite: Structures/Piping/Atmospherics/heatexchanger.rsi
     state: heStraight
-  conditions:
-    - !type:TileNotBlocked {}
 
 # ATMOS TRINARY
 - type: construction
@@ -730,7 +716,6 @@
     state: gasFilter
   mirror: GasFilterFlipped
   conditions:
-    - !type:TileNotBlocked {}
     - !type:NoUnstackableInTile
 
 - type: construction
@@ -749,7 +734,6 @@
     state: gasFilterF
   mirror: GasFilter
   conditions:
-    - !type:TileNotBlocked {}
     - !type:NoUnstackableInTile
 
 - type: construction
@@ -767,7 +751,6 @@
     state: gasMixer
   mirror: GasMixerFlipped
   conditions:
-    - !type:TileNotBlocked {}
     - !type:NoUnstackableInTile
 
 - type: construction
@@ -786,7 +769,6 @@
     state: gasMixerF
   mirror: GasMixer
   conditions:
-    - !type:TileNotBlocked
     - !type:NoUnstackableInTile
 
 - type: construction
@@ -803,7 +785,6 @@
     sprite: Structures/Piping/Atmospherics/pneumaticvalve.rsi
     state: off
   conditions:
-    - !type:TileNotBlocked
     - !type:NoUnstackableInTile
 
 # INTERCOM
diff --git a/Resources/Prototypes/Recipes/Construction/weapons.yml b/Resources/Prototypes/Recipes/Construction/weapons.yml
index 865184fad0c..868a5cb186e 100644
--- a/Resources/Prototypes/Recipes/Construction/weapons.yml
+++ b/Resources/Prototypes/Recipes/Construction/weapons.yml
@@ -39,7 +39,7 @@
   targetNode: spear
   category: construction-category-weapons
   description: A crude uranium spear for when you need to put holes in somebody.
-  icon: { sprite: Objects/Weapons/Melee/plasma_spear.rsi, state: spear }
+  icon: { sprite: Objects/Weapons/Melee/uranium_spear.rsi, state: spear }
   objectType: Item
 
 - type: construction
diff --git a/Resources/Prototypes/Recipes/Cooking/meal_recipes.yml b/Resources/Prototypes/Recipes/Cooking/meal_recipes.yml
index 5a44dd2c231..28761aa779d 100644
--- a/Resources/Prototypes/Recipes/Cooking/meal_recipes.yml
+++ b/Resources/Prototypes/Recipes/Cooking/meal_recipes.yml
@@ -1379,7 +1379,7 @@
   name: cat cake recipe
   result: MobCatCake
   time: 15
-  reagents: 
+  reagents:
     Milk: 15
     Cognizine: 5
   solids:
@@ -1480,6 +1480,23 @@
   solids:
     FoodDonkpocketBerry: 1
 
+- type: microwaveMealRecipe
+  id: RecipeDonkpocketStonk
+  name: warm stonk-pocket recipe
+  result: FoodDonkpocketStonkWarm
+  time: 5
+  solids:
+    FoodDonkpocketStonk: 1
+
+- type: microwaveMealRecipe
+  id: RecipeDonkpocketCarp
+  name: warm carp-pocket recipe
+  result: FoodDonkpocketCarpWarm
+  time: 5
+  solids:
+    FoodDonkpocketCarp: 1
+
+
 - type: microwaveMealRecipe
   id: RecipeHotChili
   name: hot chili recipe
diff --git a/Resources/Prototypes/Recipes/Crafting/Graphs/strawhat.yml b/Resources/Prototypes/Recipes/Crafting/Graphs/strawhat.yml
new file mode 100644
index 00000000000..7203a4fdfb3
--- /dev/null
+++ b/Resources/Prototypes/Recipes/Crafting/Graphs/strawhat.yml
@@ -0,0 +1,31 @@
+- type: constructionGraph
+  id: StrawHat
+  start: start
+  graph:
+    - node: start
+      edges:
+        - to: strawhat
+          steps:
+            - tag: Wheat
+              name: Wheat Bushel
+              icon:
+                sprite: Objects/Specific/Hydroponics/wheat.rsi
+                state: produce
+            - tag: Wheat
+              name: Wheat Bushel
+              icon:
+                sprite: Objects/Specific/Hydroponics/wheat.rsi
+                state: produce
+            - tag: Wheat
+              name: Wheat Bushel
+              icon:
+                sprite: Objects/Specific/Hydroponics/wheat.rsi
+                state: produce
+            - tag: Wheat
+              name: Wheat Bushel
+              icon:
+                sprite: Objects/Specific/Hydroponics/wheat.rsi
+                state: produce
+              doAfter: 10
+    - node: strawhat
+      entity: ClothingHeadHatStrawHat
diff --git a/Resources/Prototypes/Recipes/Crafting/improvised.yml b/Resources/Prototypes/Recipes/Crafting/improvised.yml
index ba4eab57c94..12fbe97e28f 100644
--- a/Resources/Prototypes/Recipes/Crafting/improvised.yml
+++ b/Resources/Prototypes/Recipes/Crafting/improvised.yml
@@ -201,3 +201,16 @@
     sprite: Objects/Materials/materials.rsi
     state: cloth_3
   objectType: Item
+
+- type: construction
+  name: straw hat
+  id: strawHat
+  graph: StrawHat
+  startNode: start
+  targetNode: strawhat
+  category: construction-category-clothing
+  description: A fancy hat for hot days! Not recommended to wear near fires.
+  icon:
+    sprite: Clothing/Head/Hats/straw_hat.rsi
+    state: icon
+  objectType: Item
diff --git a/Resources/Prototypes/Recipes/Lathes/clothing.yml b/Resources/Prototypes/Recipes/Lathes/clothing.yml
index 0b0d36c1304..999907815e1 100644
--- a/Resources/Prototypes/Recipes/Lathes/clothing.yml
+++ b/Resources/Prototypes/Recipes/Lathes/clothing.yml
@@ -474,6 +474,13 @@
   materials:
     Cloth: 300
 
+- type: latheRecipe
+  id: ClothingUniformJumpsuitQMFormal
+  result: ClothingUniformJumpsuitQMFormal
+  completetime: 4
+  materials:
+    Cloth: 300
+
 - type: latheRecipe
   id: ClothingUniformJumpskirtQM
   result: ClothingUniformJumpskirtQM
@@ -990,6 +997,14 @@
     Cloth: 100
     Durathread: 50
 
+- type: latheRecipe
+  id: ClothingHeadHatBeretQM
+  result: ClothingHeadHatBeretQM
+  completetime: 2
+  materials:
+    Cloth: 100
+    Durathread: 50
+
 - type: latheRecipe
   id: ClothingHeadHatBeretCmo
   result: ClothingHeadHatBeretCmo
@@ -1069,7 +1084,7 @@
   completetime: 2
   materials:
     Cloth: 100
-
+# Ties
 - type: latheRecipe
   id: ClothingNeckTieRed
   result: ClothingNeckTieRed
@@ -1090,3 +1105,59 @@
   completetime: 2
   materials:
     Cloth: 50
+# Scarfs
+- type: latheRecipe
+  id: ClothingNeckScarfStripedGreen
+  result: ClothingNeckScarfStripedGreen
+  completetime: 2
+  materials:
+    Cloth: 50
+
+- type: latheRecipe
+  id: ClothingNeckScarfStripedBlue
+  result: ClothingNeckScarfStripedBlue
+  completetime: 2
+  materials:
+    Cloth: 50
+
+- type: latheRecipe
+  id: ClothingNeckScarfStripedRed
+  result: ClothingNeckScarfStripedRed
+  completetime: 2
+  materials:
+    Cloth: 50
+
+- type: latheRecipe
+  id: ClothingNeckScarfStripedBrown
+  result: ClothingNeckScarfStripedBrown
+  completetime: 2
+  materials:
+    Cloth: 50
+
+- type: latheRecipe
+  id: ClothingNeckScarfStripedLightBlue
+  result: ClothingNeckScarfStripedLightBlue
+  completetime: 2
+  materials:
+    Cloth: 50
+
+- type: latheRecipe
+  id: ClothingNeckScarfStripedOrange
+  result: ClothingNeckScarfStripedOrange
+  completetime: 2
+  materials:
+    Cloth: 50
+
+- type: latheRecipe
+  id: ClothingNeckScarfStripedBlack
+  result: ClothingNeckScarfStripedBlack
+  completetime: 2
+  materials:
+    Cloth: 50
+
+- type: latheRecipe
+  id: ClothingNeckScarfStripedPurple
+  result: ClothingNeckScarfStripedPurple
+  completetime: 2
+  materials:
+    Cloth: 50
diff --git a/Resources/Prototypes/Recipes/Lathes/robotics.yml b/Resources/Prototypes/Recipes/Lathes/robotics.yml
index 1d840e3b4cb..44a9e2f0f24 100644
--- a/Resources/Prototypes/Recipes/Lathes/robotics.yml
+++ b/Resources/Prototypes/Recipes/Lathes/robotics.yml
@@ -459,16 +459,6 @@
     Glass: 500
     Plastic: 250
 
-- type: latheRecipe
-  id: BorgModuleGasAnalyzer
-  result: BorgModuleGasAnalyzer
-  category: Robotics
-  completetime: 3
-  materials:
-    Steel: 250
-    Glass: 250
-    Plastic: 250
-
 - type: latheRecipe
   id: BorgModuleRCD
   result: BorgModuleRCD
diff --git a/Resources/Prototypes/Recipes/Reactions/cleaning.yml b/Resources/Prototypes/Recipes/Reactions/cleaning.yml
index df6b8f43154..5c620ea9e79 100644
--- a/Resources/Prototypes/Recipes/Reactions/cleaning.yml
+++ b/Resources/Prototypes/Recipes/Reactions/cleaning.yml
@@ -20,16 +20,6 @@
   products:
     SpaceCleaner: 2
 
-- type: reaction
-  id: SoapyWater
-  reactants:
-    Water:
-      amount: 3
-    SoapReagent:
-      amount: 1
-  products:
-    SoapyWater: 4
-
 - type: reaction
   id: SpaceLube
   impact: Medium
diff --git a/Resources/Prototypes/Recipes/Reactions/fun.yml b/Resources/Prototypes/Recipes/Reactions/fun.yml
index 818030a3b33..a8ccd5f0455 100644
--- a/Resources/Prototypes/Recipes/Reactions/fun.yml
+++ b/Resources/Prototypes/Recipes/Reactions/fun.yml
@@ -161,3 +161,13 @@
     Carbon: 3
     Sugar: 2
 
+- type: reaction
+  id: Laughter
+  reactants:
+    JuiceBanana:
+      amount: 1
+    Sugar:
+      amount: 1
+  products:
+    Laughter: 2
+
diff --git a/Resources/Prototypes/Recipes/Reactions/medicine.yml b/Resources/Prototypes/Recipes/Reactions/medicine.yml
index c123d9306f0..a1ca3ea38e2 100644
--- a/Resources/Prototypes/Recipes/Reactions/medicine.yml
+++ b/Resources/Prototypes/Recipes/Reactions/medicine.yml
@@ -213,7 +213,7 @@
       amount: 1
     Ammonia:
       amount: 1
-    Blood:
+    ZombieBlood:
       amount: 2
   products:
     Ambuzol: 4
@@ -223,11 +223,10 @@
   reactants:
     Ambuzol:
       amount: 5
-    ZombieBlood:
-      amount: 15
+    Omnizine:
+      amount: 5
   products:
-    Blood: 15
-    AmbuzolPlus: 5
+    AmbuzolPlus: 10
 
 - type: reaction
   id: Synaptizine
diff --git a/Resources/Prototypes/Research/arsenal.yml b/Resources/Prototypes/Research/arsenal.yml
index 71e85c691aa..8a0fe5d77cb 100644
--- a/Resources/Prototypes/Research/arsenal.yml
+++ b/Resources/Prototypes/Research/arsenal.yml
@@ -50,6 +50,7 @@
   - TimerTrigger
   - FlashPayload
   - ExplosivePayload
+  - ChemicalPayload
   - Igniter
 
 - type: technology
@@ -207,4 +208,4 @@
   - PowerCageHigh
   - ShuttleGunDusterCircuitboard
   technologyPrerequisites:
-  - BasicShuttleArmament
\ No newline at end of file
+  - BasicShuttleArmament
diff --git a/Resources/Prototypes/Research/biochemical.yml b/Resources/Prototypes/Research/biochemical.yml
deleted file mode 100644
index 78deef6abc1..00000000000
--- a/Resources/Prototypes/Research/biochemical.yml
+++ /dev/null
@@ -1,151 +0,0 @@
-# Tier 1
-
-- type: technology
-  id: Chemistry
-  name: research-technology-chemistry
-  icon:
-    sprite: Objects/Specific/Chemistry/beaker_large.rsi
-    state: beakerlarge
-  discipline: Biochemical
-  tier: 1
-  cost: 5000
-  recipeUnlocks:
-  - LargeBeaker
-  - Dropper
-  - HotplateMachineCircuitboard
-  - ChemicalPayload
-  - ClothingEyesGlassesChemical
-  - Jug
-
-- type: technology
-  id: SurgicalTools
-  name: research-technology-surgical-tools
-  icon:
-    sprite: Objects/Specific/Medical/Surgery/saw.rsi
-    state: saw
-  discipline: Biochemical
-  tier: 1
-  cost: 2500 #this is useless so heavy decrease
-  recipeUnlocks:
-  - Scalpel
-  - Retractor
-  - Cautery
-  - Drill
-  - Saw
-  - Hemostat
-
-- type: technology
-  id: BiochemicalStasis
-  name: research-technology-biochemical-stasis
-  icon:
-    sprite: Structures/Machines/stasis_bed.rsi
-    state: icon
-  discipline: Biochemical
-  tier: 1
-  cost: 7500
-  recipeUnlocks:
-  - CryostasisBeaker
-  - StasisBedMachineCircuitboard
-  - SyringeCryostasis
-
-- type: technology
-  id: MechanizedTreatment
-  name: research-technology-mechanized-treatment
-  icon:
-    sprite: Mobs/Silicon/chassis.rsi
-    state: medical
-  discipline: Biochemical
-  tier: 1
-  cost: 7500
-  recipeUnlocks:
-  - BorgModuleDiagnosis
-  - BorgModuleDefibrillator
-
-# doesn't do anything right now
-#
-#- type: technology
-#  id: Virology
-#  name: research-technology-virology
-#  icon:
-#    sprite: Structures/Machines/diagnoser.rsi
-#    state: icon
-#  discipline: Biochemical
-#  tier: 1
-#  cost: 5000
-#  recipeUnlocks:
-#  - VaccinatorMachineCircuitboard
-#  - DiagnoserMachineCircuitboard
-
-# Tier 2
-
-- type: technology
-  id: Cryopod
-  name: research-technology-cryogenics
-  icon:
-    sprite: Structures/Machines/cryogenics.rsi
-    state: pod-on
-  discipline: Biochemical
-  tier: 2
-  cost: 7500
-  recipeUnlocks:
-  - CryoPodMachineCircuitboard
-
-- type: technology
-  id: Biofabrication
-  name: research-technology-biofabrication
-  icon:
-    sprite: Structures/Machines/biofabricator.rsi
-    state: icon
-  discipline: Biochemical
-  tier: 2
-  cost: 10000
-  recipeUnlocks:
-  - BiofabricatorMachineCircuitboard
-  - BiomassReclaimerMachineCircuitboard
-
-- type: technology
-  id: ChemicalDispensary
-  name: research-technology-chemical-dispensary
-  icon:
-    sprite: Structures/dispensers.rsi
-    state: industrial-working
-  discipline: Biochemical
-  tier: 2
-  cost: 10000
-  recipeUnlocks:
-  - ChemMasterMachineCircuitboard
-  - ChemDispenserMachineCircuitboard
-  - BorgModuleAdvancedTreatment
-  technologyPrerequisites:
-  - Chemistry
-
-# Tier 3
-
-- type: technology
-  id: BluespaceChemistry
-  name: research-technology-bluespace-chemistry
-  icon:
-    sprite: Objects/Specific/Chemistry/beaker_bluespace.rsi
-    state: beakerbluespace
-  discipline: Biochemical
-  tier: 3
-  cost: 10000
-  recipeUnlocks:
-  - BluespaceBeaker
-  - SyringeBluespace
-
-# look into revisiting this later once medical isn't a hellhole
-#- type: technology
-#  id: Cloning
-#  name: research-technology-cloning
-#  icon:
-#    sprite: Structures/Machines/cloning.rsi
-#    state: pod_0
-#  discipline: Biochemical
-#  tier: 3
-#  cost: 15000
-#  recipeUnlocks:
-#  - CloningPodMachineCircuitboard
-#  - MedicalScannerMachineCircuitboard
-#  - CloningConsoleComputerCircuitboard
-#  - BiomassReclaimerMachineCircuitboard
diff --git a/Resources/Prototypes/Research/civilianservices.yml b/Resources/Prototypes/Research/civilianservices.yml
index ffb6383d79b..0ba629c8c5c 100644
--- a/Resources/Prototypes/Research/civilianservices.yml
+++ b/Resources/Prototypes/Research/civilianservices.yml
@@ -35,22 +35,6 @@
   - MechEquipmentGrabberSmall
   - VimHarness
 
-- type: technology
-  id: FoodService
-  name: research-technology-food-service
-  icon:
-    sprite: Structures/Machines/juicer.rsi
-    state: juicer1
-  discipline: CivilianServices
-  tier: 1
-  cost: 7500
-  recipeUnlocks: #remove all of these once we have more kitchen equipment
-  - MicrowaveMachineCircuitboard
-  - ReagentGrinderMachineCircuitboard
-  - ElectricGrillMachineCircuitboard
-  - BoozeDispenserMachineCircuitboard
-  - SodaDispenserMachineCircuitboard
-
 - type: technology
   id: AudioVisualCommunication
   name: research-technology-audio-visual-communication
@@ -107,9 +91,11 @@
     state: display
   discipline: CivilianServices
   tier: 1
-  cost: 5000
+  cost: 7500
   recipeUnlocks:
   - FatExtractorMachineCircuitboard
+  - BiofabricatorMachineCircuitboard
+  - BiomassReclaimerMachineCircuitboard
 
 # Tier 2
 
@@ -126,6 +112,35 @@
   - FauxTileAstroGrass
   - FauxTileAstroIce
 
+- type: technology
+  id: BiochemicalStasis
+  name: research-technology-biochemical-stasis
+  icon:
+    sprite: Structures/Machines/stasis_bed.rsi
+    state: icon
+  discipline: CivilianServices
+  tier: 2
+  cost: 7500
+  recipeUnlocks:
+  - StasisBedMachineCircuitboard
+  - CryoPodMachineCircuitboard
+  - CryostasisBeaker
+  - SyringeCryostasis
+
+- type: technology
+  id: MechanizedTreatment
+  name: research-technology-mechanized-treatment
+  icon:
+    sprite: Mobs/Silicon/chassis.rsi
+    state: medical
+  discipline: CivilianServices
+  tier: 2
+  cost: 7500
+  recipeUnlocks:
+  - BorgModuleAdvancedTreatment
+  - BorgModuleDiagnosis
+  - BorgModuleDefibrillator
+
 - type: technology
   id: AdvancedCleaning
   name: research-technology-advanced-cleaning
@@ -197,3 +212,16 @@
   cost: 10000
   recipeUnlocks:
   - ClothingShoesBootsSpeed
+
+- type: technology
+  id: BluespaceChemistry
+  name: research-technology-bluespace-chemistry
+  icon:
+    sprite: Objects/Specific/Chemistry/beaker_bluespace.rsi
+    state: beakerbluespace
+  discipline: CivilianServices
+  tier: 3
+  cost: 10000
+  recipeUnlocks:
+  - BluespaceBeaker
+  - SyringeBluespace
diff --git a/Resources/Prototypes/Research/disciplines.yml b/Resources/Prototypes/Research/disciplines.yml
index 7ce290d23cb..7a661da1a33 100644
--- a/Resources/Prototypes/Research/disciplines.yml
+++ b/Resources/Prototypes/Research/disciplines.yml
@@ -10,18 +10,6 @@
     2: 0.75
     3: 0.75
 
-- type: techDiscipline
-  id: Biochemical
-  name: research-discipline-biochemical
-  color: "#449ae6"
-  icon:
-    sprite: Interface/Misc/research_disciplines.rsi
-    state: biochemical
-  tierPrerequisites:
-    1: 0
-    2: 0.75
-    3: 0.75
-
 - type: techDiscipline
   id: Arsenal
   name: research-discipline-arsenal
diff --git a/Resources/Prototypes/Research/industrial.yml b/Resources/Prototypes/Research/industrial.yml
index 529c9ebd643..19295948a4a 100644
--- a/Resources/Prototypes/Research/industrial.yml
+++ b/Resources/Prototypes/Research/industrial.yml
@@ -82,7 +82,6 @@
   tier: 1
   cost: 7500
   recipeUnlocks:
-  - BorgModuleGasAnalyzer
   - ThermomachineFreezerMachineCircuitBoard
   - GasRecyclerMachineCircuitboard
 
diff --git a/Resources/Prototypes/Roles/Jobs/Medical/paramedic.yml b/Resources/Prototypes/Roles/Jobs/Medical/paramedic.yml
index a8588006b9b..8aa7c770123 100644
--- a/Resources/Prototypes/Roles/Jobs/Medical/paramedic.yml
+++ b/Resources/Prototypes/Roles/Jobs/Medical/paramedic.yml
@@ -26,7 +26,7 @@
     shoes: ClothingShoesColorBlue
     id: ParamedicPDA
     ears: ClothingHeadsetMedical
-    belt: ClothingBeltParamedicFilled
+    belt: ClothingBeltMedicalEMTFilled
   innerClothingSkirt: ClothingUniformJumpskirtParamedic
   satchel: ClothingBackpackSatchelParamedicFilled
   duffelbag: ClothingBackpackDuffelParamedicFilled
diff --git a/Resources/Prototypes/Stacks/floor_tile_stacks.yml b/Resources/Prototypes/Stacks/floor_tile_stacks.yml
index 5a469823749..01acfd13f84 100644
--- a/Resources/Prototypes/Stacks/floor_tile_stacks.yml
+++ b/Resources/Prototypes/Stacks/floor_tile_stacks.yml
@@ -145,6 +145,20 @@
   maxCount: 30
   itemSize: 5
 
+- type: stack
+  id: FloorTileStackShuttleGrey
+  name: grey shuttle tile
+  spawn: FloorTileItemShuttleGrey
+  maxCount: 30
+  itemSize: 5
+
+- type: stack
+  id: FloorTileStackShuttleBlack
+  name: black shuttle tile
+  spawn: FloorTileItemShuttleBlack
+  maxCount: 30
+  itemSize: 5
+
 - type: stack
   id: FloorTileStackEighties
   name: eighties floor tile
diff --git a/Resources/Prototypes/Tiles/floors.yml b/Resources/Prototypes/Tiles/floors.yml
index d265aa843d5..214ee617e9e 100644
--- a/Resources/Prototypes/Tiles/floors.yml
+++ b/Resources/Prototypes/Tiles/floors.yml
@@ -1183,6 +1183,12 @@
   id: FloorShuttleWhite
   name: tiles-white-shuttle-floor
   sprite: /Textures/Tiles/shuttlewhite.png
+  variants: 4
+  placementVariants:
+  - 1.0
+  - 1.0
+  - 1.0
+  - 1.0
   baseTurf: Plating
   isSubfloor: false
   deconstructTools: [ Prying ]
@@ -1191,10 +1197,52 @@
   itemDrop: FloorTileItemShuttleWhite
   heatCapacity: 10000
 
+- type: tile
+  id: FloorShuttleGrey
+  name: tiles-grey-shuttle-floor
+  sprite: /Textures/Tiles/shuttlegrey.png
+  variants: 4
+  placementVariants:
+  - 1.0
+  - 1.0
+  - 1.0
+  - 1.0
+  baseTurf: Plating
+  isSubfloor: false
+  deconstructTools: [ Prying ]
+  footstepSounds:
+    collection: FootstepFloor
+  itemDrop: FloorTileItemShuttleGrey
+  heatCapacity: 10000
+
+- type: tile
+  id: FloorShuttleBlack
+  name: tiles-black-shuttle-floor
+  sprite: /Textures/Tiles/shuttleblack.png
+  variants: 4
+  placementVariants:
+  - 1.0
+  - 1.0
+  - 1.0
+  - 1.0
+  baseTurf: Plating
+  isSubfloor: false
+  deconstructTools: [ Prying ]
+  footstepSounds:
+    collection: FootstepFloor
+  itemDrop: FloorTileItemShuttleBlack
+  heatCapacity: 10000
+
 - type: tile
   id: FloorShuttleBlue
   name: tiles-blue-shuttle-floor
   sprite: /Textures/Tiles/shuttleblue.png
+  variants: 4
+  placementVariants:
+  - 1.0
+  - 1.0
+  - 1.0
+  - 1.0
   baseTurf: Plating
   isSubfloor: false
   deconstructTools: [ Prying ]
@@ -1207,6 +1255,12 @@
   id: FloorShuttleOrange
   name: tiles-orange-shuttle-floor
   sprite: /Textures/Tiles/shuttleorange.png
+  variants: 4
+  placementVariants:
+  - 1.0
+  - 1.0
+  - 1.0
+  - 1.0
   baseTurf: Plating
   isSubfloor: false
   deconstructTools: [ Prying ]
@@ -1219,6 +1273,12 @@
   id: FloorShuttlePurple
   name: tiles-purple-shuttle-floor
   sprite: /Textures/Tiles/shuttlepurple.png
+  variants: 4
+  placementVariants:
+  - 1.0
+  - 1.0
+  - 1.0
+  - 1.0
   baseTurf: Plating
   isSubfloor: false
   deconstructTools: [ Prying ]
@@ -1231,6 +1291,12 @@
   id: FloorShuttleRed
   name: tiles-red-shuttle-floor
   sprite: /Textures/Tiles/shuttlered.png
+  variants: 4
+  placementVariants:
+  - 1.0
+  - 1.0
+  - 1.0
+  - 1.0
   baseTurf: Plating
   isSubfloor: false
   deconstructTools: [ Prying ]
diff --git a/Resources/Prototypes/game_presets.yml b/Resources/Prototypes/game_presets.yml
index 96992d022da..f1f16ab9b8a 100644
--- a/Resources/Prototypes/game_presets.yml
+++ b/Resources/Prototypes/game_presets.yml
@@ -79,7 +79,7 @@
     - sandbox
   name: sandbox-title
   description: sandbox-description
-  showInVote: true
+  showInVote: false # Not suitable for use without admin intervention, since entity spamming can quickly crash a server
   maxPlayers: 5
   rules:
     - Sandbox
diff --git a/Resources/Prototypes/holidays.yml b/Resources/Prototypes/holidays.yml
index 207378f71e0..235584dd636 100644
--- a/Resources/Prototypes/holidays.yml
+++ b/Resources/Prototypes/holidays.yml
@@ -24,12 +24,6 @@
   beginDay: 2
   beginMonth: February
 
-- type: holiday
-  id: TravisScottDay
-  name: holiday-name-travis-scott-day
-  beginDay: 10
-  beginMonth: February
-
 - type: holiday
   id: ValentinesDay
   name: holiday-name-valentines-day
diff --git a/Resources/Prototypes/tags.yml b/Resources/Prototypes/tags.yml
index f9b207ba6ec..8e94128ce66 100644
--- a/Resources/Prototypes/tags.yml
+++ b/Resources/Prototypes/tags.yml
@@ -1160,6 +1160,9 @@
 - type: Tag
   id: WallmountSubstationElectronics
 
+- type: Tag
+  id: WeaponAntiqueLaser
+
 - type: Tag
   id: WeaponPistolCHIMPUpgradeKit
 
@@ -1169,6 +1172,9 @@
 - type: Tag
   id: WetFloorSign
 
+- type: Tag
+  id: Wheat
+
 - type: Tag
   id: WhitelistChameleon
 
diff --git a/Resources/ServerInfo/Guidebook/Cargo/Cargo.xml b/Resources/ServerInfo/Guidebook/Cargo/Cargo.xml
index d216edea711..c51e6490e93 100644
--- a/Resources/ServerInfo/Guidebook/Cargo/Cargo.xml
+++ b/Resources/ServerInfo/Guidebook/Cargo/Cargo.xml
@@ -9,16 +9,15 @@
   Каждая ваша сделка начинается с [color=#a4885c]консоли заказа грузов[/color], в которой вы можете сделать заказ на определённые товары. Для выполнения любого заказа требуются [color=#118C4F]кредиты[/color], валюта станции. Чтобы сделать заказ, нажмите кнопку "заказать" рядом с тем, что вам нужно, напишите соответствующую причину заказа и нажмите "одобрить", когда он появится под списком запросов.
 
   ## Пилотирование
-  Заказы доставляются на станцию с помощью [color=#a4885c]грузового шаттла[/color] - дистанционно пилотируемого космического корабля, который используется для покупки и продажи товаров. Чтобы переместить шаттл, вы должны сначала найти [color=#a4885c]консоль управления грузовым шаттлом[/color].
+  Заказы доставляются на станцию с помощью [color=#a4885c]Торговой станции[/color], затем транспортируются с помощью грузового шаттла - дистанционно управляемого челнока, который используется для перевозки грузов с торговой станции и обратно. Чтобы переместить шаттл, вам нужно сначала найти [color=#a4885c]компьютер грузового шаттла[/color] на станции или на самом шаттле.
   <Box>
     <GuideEntityEmbed Entity="ComputerCargoShuttle"/>
   </Box>
   После нажатия на компьютер вы должны увидеть изображение шаттла на радаре. Вот шаги по управлению шаттлом туда и обратно:
 
   - Сначала отсоедините все шлюзы, подключенные к доку.
-  - Затем вам предстоит управлять шаттлом. Управление довольно простое: W и S - движение вперед и назад, A и D - движение влево и вправо, Q и E - поворот влево и право, а пробел - тормоз.
-  - Найдите кнопку, обозначающую торговый пост. Нажмите на эту кнопку, и шаттл начнёт движение к нему.
-  - После небольшой задержки снова появится возможность вернуться на станцию с помощью БСС. После этого просто пилотируйте шаттл обратно в грузовой док и возьмите заказанные предметы.
+  - Затем вам предстоит управлять шаттлом. Управление довольно простое: [color=#028ed9]"W"[/color] и [color=#028ed9]"S"[/color] - это движение вперед и назад, [color=#028ed9]"A"[/color] и [color=#028ed9]"D"[/color] - влево и вправо, а [color=#028ed9]"Q"[/color] и [color=#028ed9]"E"[/color] - вращение влево и вправо; а [color=#028ed9]"Пробед"[/color] - тормоз и точное перемещение, удерживая [color=#028ed9]"Пробел"[/color] во время других действий.
+  - Затем направьте шаттл к [textlink="Торговой станции" link="TradeStation"].
 
   ## Продажа
   Вы хотите что-то заказать, но у вас нет на это денег? Вам просто нужно что-то продать! Почти всё на станции имеет экономическую ценность, которую вам может огласить [color=#a4885c]оценочный инструмент[/color].
@@ -26,6 +25,6 @@
     <GuideEntityEmbed Entity="AppraisalTool"/>
     <GuideEntityEmbed Entity="CargoPallet"/>
   </Box>
-  Найдя что-то стоящее, положите это на один из грузовых паллетов шаттла. В следующий раз, когда шаттл будет отправлен на торговый пост, предмет будет продан, а деньги напрямую перечислены на банковский счёт станции. Вы также можете заработать еще больше денег, выполняя [textlink="запросы" link="CargoBounties"] или продавая ценные предметы от [textlink="утилизаторов" link="Salvage"].
+  Найдя что-то стоящее, поместите это на грузовой шаттл, а затем отправьте его на [textlink="Торговую станцию" link="TradeStation"]. Затем продайте предмет и заберите кредиты из терминала. Вы также можете заработать еще больше денег, выполняя [textlink="поручения" link="CargoBounties"] или продавая ценные предметы с [textlink="экспедиций" link="Salvage"].
 
 </Document>
diff --git a/Resources/ServerInfo/Guidebook/Cargo/TradeStation.xml b/Resources/ServerInfo/Guidebook/Cargo/TradeStation.xml
new file mode 100644
index 00000000000..bde0506b17b
--- /dev/null
+++ b/Resources/ServerInfo/Guidebook/Cargo/TradeStation.xml
@@ -0,0 +1,10 @@
+<Document>
+  # Trade Station
+  The Trade Station is seperate from the station, usually floating around in space visible on the scanner and shuttle computer. It is self maintaining, and self powered with solar pannels, so cargo doesn't need to do anything for it to work.
+ 
+  ## Selling
+  Using the [color=#a4885c]cargo shuttle[/color], you are able to transport items and bounties to sell at the trade station by flying the shuttle (explained in [textlink="cargo" link="Cargo"]) and docking it to the trade station. Then you bring the objects to sell over the cargo pallets, go to the computer inbetween the 2 sets of pallets and sell what can be sold. Dont worry, you can't sell yourself! Then [color=#118C4F]Spessos[/color] should come out of the computer, and can be inserted into the Quartermasters Digiboard or the Cargo Computer to be added to the Bank.  
+  
+  ## Collecting Orders
+  All cargo orders are sent to the [color=#a4885c]Trade Station[/color] to be [color=#a4885c]collected[/color], this includes items sent by centcom. To collect them you have to travel to the Trade station and they should be there on the cargo pallets in a crate, ready to be taken back to the station.
+</Document>
diff --git a/Resources/ServerInfo/Guidebook/Medical/Cloning.xml b/Resources/ServerInfo/Guidebook/Medical/Cloning.xml
index 352b2bdd7b9..23f14fd6277 100644
--- a/Resources/ServerInfo/Guidebook/Medical/Cloning.xml
+++ b/Resources/ServerInfo/Guidebook/Medical/Cloning.xml
@@ -4,7 +4,7 @@
 
 Сам по себе процесс клонирования довольно прост (при условии, что всё соединено). Просто вставьте тело в сканер, проверьте консоль клонирования, нажмите кнопку - готово!  Однако если целостность клеток тела нарушена, или же тело успело основательно сгнить, то последствия клонирования могут быть... не очень приятными.
 
-Примечание: клонирование не всегда доступно, и лучше не полагаться на него. Научный отдел может быть не в состоянии организовать клонирование, если оно недоступно.
+Примечание: клонирование не всегда доступно, и лучше не полагаться на него.
 <Box>
 <GuideEntityEmbed Entity="ComputerCloningConsole" Caption="консоль клонирования"/>
 <GuideEntityEmbed Entity="MedicalScanner"/>
diff --git a/Resources/ServerInfo/Guidebook/Medical/Medicine.xml b/Resources/ServerInfo/Guidebook/Medical/Medicine.xml
index 746d9d60ec7..48a979c4735 100644
--- a/Resources/ServerInfo/Guidebook/Medical/Medicine.xml
+++ b/Resources/ServerInfo/Guidebook/Medical/Medicine.xml
@@ -24,7 +24,7 @@
 <GuideReagentEmbed Reagent="Phalanximine"/>
 <GuideReagentEmbed Reagent="Tricordrazine"/>
 <GuideReagentEmbed Reagent="TranexamicAcid"/>
-<GuideReagentEmbed Reagent="Romerol"/>
+<GuideReagentEmbed Reagent="Ambuzol"/>
 <GuideReagentEmbed Reagent="Oculine"/>
 
 # Все лекарства
diff --git a/Resources/ServerInfo/Guidebook/Security/CriminalRecords.xml b/Resources/ServerInfo/Guidebook/Security/CriminalRecords.xml
new file mode 100644
index 00000000000..c7b7ad2098d
--- /dev/null
+++ b/Resources/ServerInfo/Guidebook/Security/CriminalRecords.xml
@@ -0,0 +1,39 @@
+<Document>
+  # Criminal Records
+  The criminal records console is accessible in every station's security department, it serves the purpose of tracking and managing the criminal history and status of anybody part of the crew manifest.
+
+  <Box>
+  <GuideEntityEmbed Entity="ComputerCriminalRecords"/>
+  </Box>
+
+  Anyone can open the console's UI, but only those with Security access can modify anything.
+
+  The UI is composed by the following elements:
+  - A search bar that has a filter next to it that lets you filter the crewmembers by their names, fingerprints or DNA.
+
+  - A list of all the crewmembers in the manifest, selecting one of the entries will make the criminal records of a crewmember appear. The list is filtered by the search bar so make sure it's empty if you want an overall overview!
+
+  - The criminal records themselves
+
+  In the record section you can:
+    - See security-related information about a crewmember like their name, fingerprints and DNA.
+
+    - Change the security status between [color=gray]None[/color], [color=yellow]Wanted[/color] and [color=red]Detained[/color]. When setting it to Wanted you will be asked to write a reason.
+
+    - If they are wanted, you can see the reason given below the status dropdown.
+
+    - Once someone has been arrested, update their status on the console so everyone knows they no longer need to be captured.
+
+    - After they've done their time, release them and update their status to None so nobody thinks they are an escaped convict.
+
+    - Open the Crime History window to check or modify it.
+
+  The Crime History window lists someone's crimes and can be modified in multiple ways:
+    - Automatically, just by setting someone's status to arrested. The reason will be added to "ARRESTED:" so it's easy to see the automated entries.
+
+    - Adding a new line by clicking "Add" and writing something in the input box. When adding a record, remember to mention their crime and sentence, the console will automatically insert the shift's time so you don't need to!
+
+    - Select a line of unwanted history and click "Delete" to remove it. Excellent for keeping records clean from the clown's stolen ID antics.
+
+  Now you can be the desk jockey you've always wanted to be.
+</Document>
diff --git a/Resources/ServerInfo/Guidebook/Survival.xml b/Resources/ServerInfo/Guidebook/Survival.xml
index d5bf4a7fc9a..141528299c1 100644
--- a/Resources/ServerInfo/Guidebook/Survival.xml
+++ b/Resources/ServerInfo/Guidebook/Survival.xml
@@ -1,24 +1,20 @@
 <Document>
 # Выживание
-
-Как правило, разумно избегать ситуаций, которые могут причинить вам вред, потому что врачи смогут подлатать вас лишь немного, когда на пороге стоят Ядерные оперативники.
-
+Как правило, следует избегать ситуаций, которые могут причинить вам вред, потому что медицина может вылечить вас только с помощью ограниченного количества химикатов и медицинских предметов, и особенно когда на вашем пороге стоят ядерные оперативники.
 ## Определение вашего положения
-В своём КПК вы найдёте название вашего судна, манифест действующих членов экипажа, ваше имя и фамилию (на случай, если вы забыли), и должность, за которой вы закреплены. Это всё позволит вам быстро оценить ситуацию.
-
+Ваш КПК содержит название станции и список членов экипажа, работающих в данный момент на вашей станции, напоминание вашего имени в случае необходимости, а также назначенное задание на смену, что позволит вам быстро оценить ситуацию.
 ## Неотложная помощь
-В случае серьезной чрезвычайной ситуации есть несколько вещей, которые помогут вам обеспечить ваше долгосрочное выживание:
-
-- Если вы близки к критическому состоянию, воспользуйтесь экстренным медипеном из вашего аварийного запаса, чтобы не упасть в критическое состояние без возможности что-либо сделать. Экстренный медипен также можно использовать для стабилизации и реанимации упавших на пол в критическом состоянии (в том числе животных), и обеспечить запас времени на борьбу с ядами и т.п.
+В случае серьезной чрезвычайной ситуации вы можете сделать несколько вещей, которые помогут вам выжить в долгосрочной перспективе:
+- Если вы находитесь в критическом состоянии, воспользуйтесь экстренным медипеном из вашего аварийного запаса - он поможет вам не потерять способность что-либо делать. Экстренные медипены также можно использовать для оживления людей, находящихся в критическом состоянии на полу, и для продления времени жизни при борьбе с ядами и т.д.
 <Box>
 <GuideEntityEmbed Entity="EmergencyMedipen"/>
 </Box>
-- В вашем аварийном запасе имеются дыхательная маска и кислородный баллон, которые помогут вам продержаться немного дольше в случае утечки воздуха. Если же вы слаймолюд, то помните, что вы дышите азотом, и баллон с вашего набора вам не поможет.
+- В вашем аварийном запасе находятся дыхательная маска и кислородный баллон, которые помогут вам дольше продержаться в случае утечки воздуха. Если вы слаймолюд, имейте в виду, что азот заменяет вам кислород и что в вашем аварийном запасе будет красный баллон с азотом вместо стандартного сине-желтого баллона с кислородом.
 <Box>
 <GuideEntityEmbed Entity="ClothingMaskBreath"/>
 <GuideEntityEmbed Entity="EmergencyOxygenTankFilled"/>
 </Box>
-- Если у вас кровотечение или вы просто хотите приготовиться, вы можете порезать некоторые элементы одежды, например комбинезон, с помощью ножа или другого острого предмета, и использовать полученную ткань для создания бинта.
+- Если у вас кровотечение или просто хотите подготовиться, можно разрезать ткань ножом или другим острым предметом и использовать полученную ткань для создания бинта в меню ремесла, чтобы остановить кровотечение, однако ткань сама по себе может быть использована с меньшей эффективностью в чрезвычайных ситуациях.
 <Box>
 <GuideEntityEmbed Entity="Gauze"/>
 <GuideEntityEmbed Entity="MaterialCloth"/>
@@ -28,6 +24,6 @@
 - Правильное питание (приготовленная еда, а не из автомата), как правило, гораздо лучше сказывается на общем состоянии здоровья и помогает быстрее заживлять небольшие раны.
 - Простой постельный режим лечит большинство заболеваний, а также позволяет ранам закрыться самостоятельно. Лучше всего для этого подходят медицинские кровати, обеспечивающие стерильную поверхность и поддержку всех поврежденных частей тела, но подойдет любая кровать. Даже сидячее положение помогает, хотя бы немного.
 - Сон на кровати еще больше ускоряет процесс выздоровления.
-- Блюда, содержащие бобовые, красное мясо или просто насыщенные белком, очень помогут вашему организму после сильной кровопотери. Но всё же рекомендуется обратиться к врачу и пройти курс лечения.
+- Блюда, содержащие бобовые, красное мясо или просто насыщенные белком, очень помогут вашему организму после сильной кровопотери. Но все же рекомендуется обратиться к врачу и пройти курс лечения.
 
 </Document>
diff --git a/Resources/Textures/Clothing/Belt/emt.rsi/equipped-BELT.png b/Resources/Textures/Clothing/Belt/emt.rsi/equipped-BELT.png
new file mode 100644
index 00000000000..34698f72858
Binary files /dev/null and b/Resources/Textures/Clothing/Belt/emt.rsi/equipped-BELT.png differ
diff --git a/Resources/Textures/Clothing/Belt/emt.rsi/icon.png b/Resources/Textures/Clothing/Belt/emt.rsi/icon.png
new file mode 100644
index 00000000000..80abde93823
Binary files /dev/null and b/Resources/Textures/Clothing/Belt/emt.rsi/icon.png differ
diff --git a/Resources/Textures/Clothing/Belt/emt.rsi/inhand-left.png b/Resources/Textures/Clothing/Belt/emt.rsi/inhand-left.png
new file mode 100644
index 00000000000..460be7e4849
Binary files /dev/null and b/Resources/Textures/Clothing/Belt/emt.rsi/inhand-left.png differ
diff --git a/Resources/Textures/Clothing/Belt/emt.rsi/inhand-right.png b/Resources/Textures/Clothing/Belt/emt.rsi/inhand-right.png
new file mode 100644
index 00000000000..7222bcf7b3d
Binary files /dev/null and b/Resources/Textures/Clothing/Belt/emt.rsi/inhand-right.png differ
diff --git a/Resources/Textures/Clothing/Head/Soft/paramedicsoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Belt/emt.rsi/meta.json
similarity index 77%
rename from Resources/Textures/Clothing/Head/Soft/paramedicsoft_flipped.rsi/meta.json
rename to Resources/Textures/Clothing/Belt/emt.rsi/meta.json
index 8089773135c..8f6acfe1245 100644
--- a/Resources/Textures/Clothing/Head/Soft/paramedicsoft_flipped.rsi/meta.json
+++ b/Resources/Textures/Clothing/Belt/emt.rsi/meta.json
@@ -1,7 +1,7 @@
 {
   "version": 1,
   "license": "CC-BY-SA-3.0",
-  "copyright": "Made by MagnusCrowe (Github) for SS14",
+  "copyright": "Drawn by Ubaser.",
   "size": {
     "x": 32,
     "y": 32
@@ -11,7 +11,7 @@
       "name": "icon"
     },
     {
-      "name": "equipped-HELMET",
+      "name": "equipped-BELT",
       "directions": 4
     },
     {
diff --git a/Resources/Textures/Clothing/Head/Bandanas/black.rsi/mask-equipped-HELMET.png b/Resources/Textures/Clothing/Head/Bandanas/black.rsi/equipped-MASK.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Bandanas/black.rsi/mask-equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Bandanas/black.rsi/equipped-MASK.png
diff --git a/Resources/Textures/Clothing/Head/Bandanas/black.rsi/meta.json b/Resources/Textures/Clothing/Head/Bandanas/black.rsi/meta.json
index 66dc616e523..a5553690327 100644
--- a/Resources/Textures/Clothing/Head/Bandanas/black.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Bandanas/black.rsi/meta.json
@@ -18,7 +18,7 @@
       "directions": 4
     },
     {
-      "name": "mask-equipped-HELMET",
+      "name": "equipped-MASK",
       "directions": 4
     },
     {
diff --git a/Resources/Textures/Clothing/Head/Bandanas/blue.rsi/mask-equipped-HELMET.png b/Resources/Textures/Clothing/Head/Bandanas/blue.rsi/equipped-MASK.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Bandanas/blue.rsi/mask-equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Bandanas/blue.rsi/equipped-MASK.png
diff --git a/Resources/Textures/Clothing/Head/Bandanas/blue.rsi/meta.json b/Resources/Textures/Clothing/Head/Bandanas/blue.rsi/meta.json
index 66dc616e523..a5553690327 100644
--- a/Resources/Textures/Clothing/Head/Bandanas/blue.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Bandanas/blue.rsi/meta.json
@@ -18,7 +18,7 @@
       "directions": 4
     },
     {
-      "name": "mask-equipped-HELMET",
+      "name": "equipped-MASK",
       "directions": 4
     },
     {
diff --git a/Resources/Textures/Clothing/Head/Bandanas/botany.rsi/mask-equipped-HELMET.png b/Resources/Textures/Clothing/Head/Bandanas/botany.rsi/equipped-MASK.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Bandanas/botany.rsi/mask-equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Bandanas/botany.rsi/equipped-MASK.png
diff --git a/Resources/Textures/Clothing/Head/Bandanas/botany.rsi/meta.json b/Resources/Textures/Clothing/Head/Bandanas/botany.rsi/meta.json
index 22a0c38fde5..a9b3b1556d9 100644
--- a/Resources/Textures/Clothing/Head/Bandanas/botany.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Bandanas/botany.rsi/meta.json
@@ -22,7 +22,7 @@
       "directions": 4
     },
     {
-      "name": "mask-equipped-HELMET",
+      "name": "equipped-MASK",
       "directions": 4
     },
     {
diff --git a/Resources/Textures/Clothing/Head/Bandanas/brown.rsi/mask-equipped-HELMET.png b/Resources/Textures/Clothing/Head/Bandanas/brown.rsi/equipped-MASK.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Bandanas/brown.rsi/mask-equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Bandanas/brown.rsi/equipped-MASK.png
diff --git a/Resources/Textures/Clothing/Head/Bandanas/brown.rsi/meta.json b/Resources/Textures/Clothing/Head/Bandanas/brown.rsi/meta.json
index dc73ff464cd..ae745625601 100644
--- a/Resources/Textures/Clothing/Head/Bandanas/brown.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Bandanas/brown.rsi/meta.json
@@ -18,7 +18,7 @@
       "directions": 4
     },
     {
-      "name": "mask-equipped-HELMET",
+      "name": "equipped-MASK",
       "directions": 4
     },
     {
diff --git a/Resources/Textures/Clothing/Head/Bandanas/gold.rsi/mask-equipped-HELMET.png b/Resources/Textures/Clothing/Head/Bandanas/gold.rsi/equipped-MASK.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Bandanas/gold.rsi/mask-equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Bandanas/gold.rsi/equipped-MASK.png
diff --git a/Resources/Textures/Clothing/Head/Bandanas/gold.rsi/meta.json b/Resources/Textures/Clothing/Head/Bandanas/gold.rsi/meta.json
index 66dc616e523..a5553690327 100644
--- a/Resources/Textures/Clothing/Head/Bandanas/gold.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Bandanas/gold.rsi/meta.json
@@ -18,7 +18,7 @@
       "directions": 4
     },
     {
-      "name": "mask-equipped-HELMET",
+      "name": "equipped-MASK",
       "directions": 4
     },
     {
diff --git a/Resources/Textures/Clothing/Head/Bandanas/green.rsi/mask-equipped-HELMET.png b/Resources/Textures/Clothing/Head/Bandanas/green.rsi/equipped-MASK.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Bandanas/green.rsi/mask-equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Bandanas/green.rsi/equipped-MASK.png
diff --git a/Resources/Textures/Clothing/Head/Bandanas/green.rsi/meta.json b/Resources/Textures/Clothing/Head/Bandanas/green.rsi/meta.json
index 66dc616e523..a5553690327 100644
--- a/Resources/Textures/Clothing/Head/Bandanas/green.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Bandanas/green.rsi/meta.json
@@ -18,7 +18,7 @@
       "directions": 4
     },
     {
-      "name": "mask-equipped-HELMET",
+      "name": "equipped-MASK",
       "directions": 4
     },
     {
diff --git a/Resources/Textures/Clothing/Head/Bandanas/grey.rsi/mask-equipped-HELMET.png b/Resources/Textures/Clothing/Head/Bandanas/grey.rsi/equipped-MASK.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Bandanas/grey.rsi/mask-equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Bandanas/grey.rsi/equipped-MASK.png
diff --git a/Resources/Textures/Clothing/Head/Bandanas/grey.rsi/meta.json b/Resources/Textures/Clothing/Head/Bandanas/grey.rsi/meta.json
index 66dc616e523..a5553690327 100644
--- a/Resources/Textures/Clothing/Head/Bandanas/grey.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Bandanas/grey.rsi/meta.json
@@ -18,7 +18,7 @@
       "directions": 4
     },
     {
-      "name": "mask-equipped-HELMET",
+      "name": "equipped-MASK",
       "directions": 4
     },
     {
diff --git a/Resources/Textures/Clothing/Head/Bandanas/merc.rsi/mask-equipped-HELMET.png b/Resources/Textures/Clothing/Head/Bandanas/merc.rsi/equipped-MASK.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Bandanas/merc.rsi/mask-equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Bandanas/merc.rsi/equipped-MASK.png
diff --git a/Resources/Textures/Clothing/Head/Bandanas/merc.rsi/meta.json b/Resources/Textures/Clothing/Head/Bandanas/merc.rsi/meta.json
index 94ecdbc846b..7912d1eb0f7 100644
--- a/Resources/Textures/Clothing/Head/Bandanas/merc.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Bandanas/merc.rsi/meta.json
@@ -18,7 +18,7 @@
       "directions": 4
     },
     {
-      "name": "mask-equipped-HELMET",
+      "name": "equipped-MASK",
       "directions": 4
     },
     {
diff --git a/Resources/Textures/Clothing/Head/Bandanas/red.rsi/mask-equipped-HELMET.png b/Resources/Textures/Clothing/Head/Bandanas/red.rsi/equipped-MASK.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Bandanas/red.rsi/mask-equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Bandanas/red.rsi/equipped-MASK.png
diff --git a/Resources/Textures/Clothing/Head/Bandanas/red.rsi/meta.json b/Resources/Textures/Clothing/Head/Bandanas/red.rsi/meta.json
index 250965b72db..362e8bc75ad 100644
--- a/Resources/Textures/Clothing/Head/Bandanas/red.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Bandanas/red.rsi/meta.json
@@ -18,7 +18,7 @@
       "directions": 4
     },
     {
-      "name": "mask-equipped-HELMET",
+      "name": "equipped-MASK",
       "directions": 4
     },
     {
diff --git a/Resources/Textures/Clothing/Head/Bandanas/skull.rsi/mask-equipped-HELMET.png b/Resources/Textures/Clothing/Head/Bandanas/skull.rsi/equipped-MASK.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Bandanas/skull.rsi/mask-equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Bandanas/skull.rsi/equipped-MASK.png
diff --git a/Resources/Textures/Clothing/Head/Bandanas/skull.rsi/meta.json b/Resources/Textures/Clothing/Head/Bandanas/skull.rsi/meta.json
index 66dc616e523..a5553690327 100644
--- a/Resources/Textures/Clothing/Head/Bandanas/skull.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Bandanas/skull.rsi/meta.json
@@ -18,7 +18,7 @@
       "directions": 4
     },
     {
-      "name": "mask-equipped-HELMET",
+      "name": "equipped-MASK",
       "directions": 4
     },
     {
diff --git a/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/equipped-HELMET-hamster.png b/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/equipped-HELMET-hamster.png
new file mode 100644
index 00000000000..c9197282c65
Binary files /dev/null and b/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/equipped-HELMET-hamster.png differ
diff --git a/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/equipped-HELMET.png
new file mode 100644
index 00000000000..b03816eeb68
Binary files /dev/null and b/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/equipped-HELMET.png differ
diff --git a/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/icon.png b/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/icon.png
new file mode 100644
index 00000000000..ee1997cc965
Binary files /dev/null and b/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/icon.png differ
diff --git a/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/inhand-left.png
new file mode 100644
index 00000000000..4c59df75503
Binary files /dev/null and b/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/inhand-left.png differ
diff --git a/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/inhand-right.png
new file mode 100644
index 00000000000..1f8ff310244
Binary files /dev/null and b/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/inhand-right.png differ
diff --git a/Resources/Textures/Clothing/Head/Soft/corpsoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/meta.json
similarity index 77%
rename from Resources/Textures/Clothing/Head/Soft/corpsoft_flipped.rsi/meta.json
rename to Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/meta.json
index a470e009443..a067278440e 100644
--- a/Resources/Textures/Clothing/Head/Soft/corpsoft_flipped.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Hats/beret_qm.rsi/meta.json
@@ -1,7 +1,7 @@
 {
   "version": 1,
   "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e",
+  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e, resprite by @mureixlol, recoloured by Hanzdegloker",
   "size": {
     "x": 32,
     "y": 32
@@ -14,6 +14,10 @@
       "name": "equipped-HELMET",
       "directions": 4
     },
+    {
+      "name": "equipped-HELMET-hamster",
+      "directions": 4
+    },
     {
       "name": "inhand-left",
       "directions": 4
diff --git a/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/equipped-HELMET-hamster.png b/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/equipped-HELMET-hamster.png
new file mode 100644
index 00000000000..10a56e316be
Binary files /dev/null and b/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/equipped-HELMET-hamster.png differ
diff --git a/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/equipped-HELMET.png
new file mode 100644
index 00000000000..2ddd8f32097
Binary files /dev/null and b/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/equipped-HELMET.png differ
diff --git a/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/icon.png b/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/icon.png
new file mode 100644
index 00000000000..bf9e3673d61
Binary files /dev/null and b/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/icon.png differ
diff --git a/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/inhand-left.png
new file mode 100644
index 00000000000..5cd89c082b1
Binary files /dev/null and b/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/inhand-left.png differ
diff --git a/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/inhand-right.png
new file mode 100644
index 00000000000..8ad5764d3c3
Binary files /dev/null and b/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/inhand-right.png differ
diff --git a/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/meta.json b/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/meta.json
new file mode 100644
index 00000000000..a3cde84524c
--- /dev/null
+++ b/Resources/Textures/Clothing/Head/Hats/straw_hat.rsi/meta.json
@@ -0,0 +1,30 @@
+{
+    "version": 1,
+    "license": "CC-BY-SA-3.0",
+    "copyright": "Made by Adrian16199",
+    "size": {
+      "x": 32,
+      "y": 32
+    },
+    "states": [
+    {
+    "name": "icon"
+    },
+    {
+    "name": "equipped-HELMET",
+    "directions": 4
+    },
+    {
+    "name": "equipped-HELMET-hamster",
+    "directions": 4
+    },
+    {
+    "name": "inhand-left",
+    "directions": 4
+    },
+    {
+    "name": "inhand-right",
+    "directions": 4
+    }
+  ]
+}
diff --git a/Resources/Textures/Clothing/Head/Soft/bizarresoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/bizarresoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/bizarresoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/bizarresoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/bizarresoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/bizarresoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/bizarresoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/bizarresoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/bizarresoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/bizarresoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/bizarresoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/bizarresoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/bizarresoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/bizarresoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/bizarresoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/bizarresoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/bizarresoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/bizarresoft.rsi/meta.json
index b3513bb5cd0..adf7e7620a5 100644
--- a/Resources/Textures/Clothing/Head/Soft/bizarresoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/bizarresoft.rsi/meta.json
@@ -10,6 +10,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
@@ -21,6 +24,18 @@
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/bizarresoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/bizarresoft_flipped.rsi/meta.json
deleted file mode 100644
index b3513bb5cd0..00000000000
--- a/Resources/Textures/Clothing/Head/Soft/bizarresoft_flipped.rsi/meta.json
+++ /dev/null
@@ -1,26 +0,0 @@
-{
-  "version": 1,
-  "license": "CC-BY-NC-SA-3.0",
-  "copyright": "Taken from civstation at commit https://github.com/Civ13/Civ13/commit/ec52cbb95d59b717d4d8c480b35ac133e5b58088#diff-fba188fb2db5d16e5d41985147336a8f96085f761b903e016fffd869b63e497d",
-  "size": {
-    "x": 32,
-    "y": 32
-  },
-  "states": [
-    {
-      "name": "icon"
-    },
-    {
-      "name": "equipped-HELMET",
-      "directions": 4
-    },
-    {
-      "name": "inhand-left",
-      "directions": 4
-    },
-    {
-      "name": "inhand-right",
-      "directions": 4
-    }
-  ]
-}
diff --git a/Resources/Textures/Clothing/Head/Soft/blacksoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/blacksoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/blacksoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/blacksoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/blacksoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/blacksoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/blacksoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/blacksoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/blacksoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/blacksoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/blacksoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/blacksoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/blacksoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/blacksoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/blacksoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/blacksoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/blacksoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/blacksoft.rsi/meta.json
index a470e009443..a29360acd8b 100644
--- a/Resources/Textures/Clothing/Head/Soft/blacksoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/blacksoft.rsi/meta.json
@@ -10,6 +10,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
@@ -21,6 +24,18 @@
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/bluesoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/bluesoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/bluesoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/bluesoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/bluesoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/bluesoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/bluesoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/bluesoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/bluesoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/bluesoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/bluesoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/bluesoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/bluesoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/bluesoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/bluesoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/bluesoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/bluesoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/bluesoft.rsi/meta.json
index a470e009443..a29360acd8b 100644
--- a/Resources/Textures/Clothing/Head/Soft/bluesoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/bluesoft.rsi/meta.json
@@ -10,6 +10,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
@@ -21,6 +24,18 @@
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/bluesoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/bluesoft_flipped.rsi/meta.json
deleted file mode 100644
index a470e009443..00000000000
--- a/Resources/Textures/Clothing/Head/Soft/bluesoft_flipped.rsi/meta.json
+++ /dev/null
@@ -1,26 +0,0 @@
-{
-  "version": 1,
-  "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e",
-  "size": {
-    "x": 32,
-    "y": 32
-  },
-  "states": [
-    {
-      "name": "icon"
-    },
-    {
-      "name": "equipped-HELMET",
-      "directions": 4
-    },
-    {
-      "name": "inhand-left",
-      "directions": 4
-    },
-    {
-      "name": "inhand-right",
-      "directions": 4
-    }
-  ]
-}
diff --git a/Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/flipped-equipped-HELMET-hamster.png b/Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/flipped-equipped-HELMET-hamster.png
new file mode 100644
index 00000000000..f5372ea5a3b
Binary files /dev/null and b/Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/flipped-equipped-HELMET-hamster.png differ
diff --git a/Resources/Textures/Clothing/Head/Soft/cargosoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/cargosoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/cargosoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/cargosoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/cargosoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/cargosoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/cargosoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/cargosoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/meta.json
index 83a38bf11b9..81d3b938b96 100644
--- a/Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/cargosoft.rsi/meta.json
@@ -10,21 +10,40 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
     },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
     {
       "name": "equipped-HELMET-hamster",
       "directions": 4
     },
+    {
+      "name": "flipped-equipped-HELMET-hamster",
+      "directions": 4
+    },
     {
       "name": "inhand-left",
       "directions": 4
     },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/cargosoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/cargosoft_flipped.rsi/meta.json
deleted file mode 100644
index 86b28c561a8..00000000000
--- a/Resources/Textures/Clothing/Head/Soft/cargosoft_flipped.rsi/meta.json
+++ /dev/null
@@ -1,26 +0,0 @@
-{
-  "version": 1,
-  "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e, repaletted for Space Station 14",
-  "size": {
-    "x": 32,
-    "y": 32
-  },
-  "states": [
-    {
-      "name": "icon"
-    },
-    {
-      "name": "equipped-HELMET",
-      "directions": 4
-    },
-    {
-      "name": "inhand-left",
-      "directions": 4
-    },
-    {
-      "name": "inhand-right",
-      "directions": 4
-    }
-  ]
-}
diff --git a/Resources/Textures/Clothing/Head/Soft/corpsoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/corpsoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/corpsoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/corpsoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/corpsoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/corpsoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/corpsoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/corpsoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/corpsoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/corpsoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/corpsoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/corpsoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/corpsoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/corpsoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/corpsoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/corpsoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/corpsoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/corpsoft.rsi/meta.json
index a470e009443..a29360acd8b 100644
--- a/Resources/Textures/Clothing/Head/Soft/corpsoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/corpsoft.rsi/meta.json
@@ -10,6 +10,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
@@ -21,6 +24,18 @@
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/greensoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/greensoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/greensoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/greensoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/greensoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/greensoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/greensoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/greensoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/greensoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/greensoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/greensoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/greensoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/greensoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/greensoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/greensoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/greensoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/greensoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/greensoft.rsi/meta.json
index a470e009443..a29360acd8b 100644
--- a/Resources/Textures/Clothing/Head/Soft/greensoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/greensoft.rsi/meta.json
@@ -10,6 +10,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
@@ -21,6 +24,18 @@
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/greensoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/greensoft_flipped.rsi/meta.json
deleted file mode 100644
index a470e009443..00000000000
--- a/Resources/Textures/Clothing/Head/Soft/greensoft_flipped.rsi/meta.json
+++ /dev/null
@@ -1,26 +0,0 @@
-{
-  "version": 1,
-  "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e",
-  "size": {
-    "x": 32,
-    "y": 32
-  },
-  "states": [
-    {
-      "name": "icon"
-    },
-    {
-      "name": "equipped-HELMET",
-      "directions": 4
-    },
-    {
-      "name": "inhand-left",
-      "directions": 4
-    },
-    {
-      "name": "inhand-right",
-      "directions": 4
-    }
-  ]
-}
diff --git a/Resources/Textures/Clothing/Head/Soft/greysoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/greysoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/greysoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/greysoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/greysoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/greysoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/greysoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/greysoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/greysoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/greysoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/greysoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/greysoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/greysoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/greysoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/greysoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/greysoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/greysoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/greysoft.rsi/meta.json
index a470e009443..a29360acd8b 100644
--- a/Resources/Textures/Clothing/Head/Soft/greysoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/greysoft.rsi/meta.json
@@ -10,6 +10,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
@@ -21,6 +24,18 @@
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/greysoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/greysoft_flipped.rsi/meta.json
deleted file mode 100644
index a470e009443..00000000000
--- a/Resources/Textures/Clothing/Head/Soft/greysoft_flipped.rsi/meta.json
+++ /dev/null
@@ -1,26 +0,0 @@
-{
-  "version": 1,
-  "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e",
-  "size": {
-    "x": 32,
-    "y": 32
-  },
-  "states": [
-    {
-      "name": "icon"
-    },
-    {
-      "name": "equipped-HELMET",
-      "directions": 4
-    },
-    {
-      "name": "inhand-left",
-      "directions": 4
-    },
-    {
-      "name": "inhand-right",
-      "directions": 4
-    }
-  ]
-}
diff --git a/Resources/Textures/Clothing/Head/Soft/mimesoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/mimesoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/mimesoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/mimesoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/mimesoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/mimesoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/mimesoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/mimesoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/mimesoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/mimesoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/mimesoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/mimesoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/mimesoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/mimesoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/mimesoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/mimesoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/mimesoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/mimesoft.rsi/meta.json
index a470e009443..a29360acd8b 100644
--- a/Resources/Textures/Clothing/Head/Soft/mimesoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/mimesoft.rsi/meta.json
@@ -10,6 +10,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
@@ -21,6 +24,18 @@
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/mimesoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/mimesoft_flipped.rsi/meta.json
deleted file mode 100644
index a470e009443..00000000000
--- a/Resources/Textures/Clothing/Head/Soft/mimesoft_flipped.rsi/meta.json
+++ /dev/null
@@ -1,26 +0,0 @@
-{
-  "version": 1,
-  "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e",
-  "size": {
-    "x": 32,
-    "y": 32
-  },
-  "states": [
-    {
-      "name": "icon"
-    },
-    {
-      "name": "equipped-HELMET",
-      "directions": 4
-    },
-    {
-      "name": "inhand-left",
-      "directions": 4
-    },
-    {
-      "name": "inhand-right",
-      "directions": 4
-    }
-  ]
-}
diff --git a/Resources/Textures/Clothing/Head/Soft/orangesoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/orangesoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/orangesoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/orangesoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/orangesoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/orangesoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/orangesoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/orangesoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/orangesoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/orangesoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/orangesoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/orangesoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/orangesoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/orangesoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/orangesoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/orangesoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/orangesoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/orangesoft.rsi/meta.json
index a470e009443..a29360acd8b 100644
--- a/Resources/Textures/Clothing/Head/Soft/orangesoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/orangesoft.rsi/meta.json
@@ -10,6 +10,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
@@ -21,6 +24,18 @@
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/orangesoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/orangesoft_flipped.rsi/meta.json
deleted file mode 100644
index a470e009443..00000000000
--- a/Resources/Textures/Clothing/Head/Soft/orangesoft_flipped.rsi/meta.json
+++ /dev/null
@@ -1,26 +0,0 @@
-{
-  "version": 1,
-  "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e",
-  "size": {
-    "x": 32,
-    "y": 32
-  },
-  "states": [
-    {
-      "name": "icon"
-    },
-    {
-      "name": "equipped-HELMET",
-      "directions": 4
-    },
-    {
-      "name": "inhand-left",
-      "directions": 4
-    },
-    {
-      "name": "inhand-right",
-      "directions": 4
-    }
-  ]
-}
diff --git a/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/equipped-HELMET-hamster.png b/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/equipped-HELMET-hamster.png
index 79b4d66da04..2f7a32ae935 100644
Binary files a/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/equipped-HELMET-hamster.png and b/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/equipped-HELMET-hamster.png differ
diff --git a/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/flipped-equipped-HELMET-hamster.png b/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/flipped-equipped-HELMET-hamster.png
new file mode 100644
index 00000000000..5a4e035e636
Binary files /dev/null and b/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/flipped-equipped-HELMET-hamster.png differ
diff --git a/Resources/Textures/Clothing/Head/Soft/paramedicsoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/paramedicsoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/paramedicsoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/paramedicsoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/paramedicsoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/paramedicsoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/paramedicsoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/paramedicsoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/meta.json
index 2b73b340e68..b60639b2654 100644
--- a/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/paramedicsoft.rsi/meta.json
@@ -10,21 +10,40 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
     },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
     {
       "name": "equipped-HELMET-hamster",
       "directions": 4
     },
+    {
+      "name": "flipped-equipped-HELMET-hamster",
+      "directions": 4
+    },
     {
       "name": "inhand-left",
       "directions": 4
     },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/flipped-equipped-HELMET-hamster.png b/Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/flipped-equipped-HELMET-hamster.png
new file mode 100644
index 00000000000..140bf71b782
Binary files /dev/null and b/Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/flipped-equipped-HELMET-hamster.png differ
diff --git a/Resources/Textures/Clothing/Head/Soft/purplesoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/purplesoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/purplesoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/purplesoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/purplesoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/purplesoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/purplesoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/purplesoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/meta.json
index ade65863af2..3fb7add363e 100644
--- a/Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/purplesoft.rsi/meta.json
@@ -10,21 +10,40 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
     },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
     {
       "name": "equipped-HELMET-hamster",
       "directions": 4
     },
+    {
+      "name": "flipped-equipped-HELMET-hamster",
+      "directions": 4
+    },
     {
       "name": "inhand-left",
       "directions": 4
     },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/purplesoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/purplesoft_flipped.rsi/meta.json
deleted file mode 100644
index a470e009443..00000000000
--- a/Resources/Textures/Clothing/Head/Soft/purplesoft_flipped.rsi/meta.json
+++ /dev/null
@@ -1,26 +0,0 @@
-{
-  "version": 1,
-  "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e",
-  "size": {
-    "x": 32,
-    "y": 32
-  },
-  "states": [
-    {
-      "name": "icon"
-    },
-    {
-      "name": "equipped-HELMET",
-      "directions": 4
-    },
-    {
-      "name": "inhand-left",
-      "directions": 4
-    },
-    {
-      "name": "inhand-right",
-      "directions": 4
-    }
-  ]
-}
diff --git a/Resources/Textures/Clothing/Head/Soft/qmsoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/qmsoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/qmsoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/qmsoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/qmsoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/qmsoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/qmsoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/qmsoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/qmsoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/qmsoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/qmsoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/qmsoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/qmsoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/qmsoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/qmsoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/qmsoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/qmsoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/qmsoft.rsi/meta.json
index a470e009443..a29360acd8b 100644
--- a/Resources/Textures/Clothing/Head/Soft/qmsoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/qmsoft.rsi/meta.json
@@ -10,6 +10,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
@@ -21,6 +24,18 @@
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/qmsoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/qmsoft_flipped.rsi/meta.json
deleted file mode 100644
index a470e009443..00000000000
--- a/Resources/Textures/Clothing/Head/Soft/qmsoft_flipped.rsi/meta.json
+++ /dev/null
@@ -1,26 +0,0 @@
-{
-  "version": 1,
-  "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e",
-  "size": {
-    "x": 32,
-    "y": 32
-  },
-  "states": [
-    {
-      "name": "icon"
-    },
-    {
-      "name": "equipped-HELMET",
-      "directions": 4
-    },
-    {
-      "name": "inhand-left",
-      "directions": 4
-    },
-    {
-      "name": "inhand-right",
-      "directions": 4
-    }
-  ]
-}
diff --git a/Resources/Textures/Clothing/Head/Soft/redsoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/redsoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/redsoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/redsoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/redsoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/redsoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/redsoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/redsoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/redsoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/redsoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/redsoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/redsoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/redsoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/redsoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/redsoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/redsoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/redsoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/redsoft.rsi/meta.json
index a470e009443..a29360acd8b 100644
--- a/Resources/Textures/Clothing/Head/Soft/redsoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/redsoft.rsi/meta.json
@@ -10,6 +10,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
@@ -21,6 +24,18 @@
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/redsoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/redsoft_flipped.rsi/meta.json
deleted file mode 100644
index a470e009443..00000000000
--- a/Resources/Textures/Clothing/Head/Soft/redsoft_flipped.rsi/meta.json
+++ /dev/null
@@ -1,26 +0,0 @@
-{
-  "version": 1,
-  "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e",
-  "size": {
-    "x": 32,
-    "y": 32
-  },
-  "states": [
-    {
-      "name": "icon"
-    },
-    {
-      "name": "equipped-HELMET",
-      "directions": 4
-    },
-    {
-      "name": "inhand-left",
-      "directions": 4
-    },
-    {
-      "name": "inhand-right",
-      "directions": 4
-    }
-  ]
-}
diff --git a/Resources/Textures/Clothing/Head/Soft/secsoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/secsoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/secsoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/secsoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/secsoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/secsoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/secsoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/secsoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/secsoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/secsoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/secsoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/secsoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/secsoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/secsoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/secsoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/secsoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/secsoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/secsoft.rsi/meta.json
index 739a6fff898..37bf1c40226 100644
--- a/Resources/Textures/Clothing/Head/Soft/secsoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/secsoft.rsi/meta.json
@@ -10,6 +10,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
@@ -21,6 +24,18 @@
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/secsoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/secsoft_flipped.rsi/meta.json
deleted file mode 100644
index 739a6fff898..00000000000
--- a/Resources/Textures/Clothing/Head/Soft/secsoft_flipped.rsi/meta.json
+++ /dev/null
@@ -1,26 +0,0 @@
-{
-  "version": 1,
-  "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e, resprite by @mureixlol",
-  "size": {
-    "x": 32,
-    "y": 32
-  },
-  "states": [
-    {
-      "name": "icon"
-    },
-    {
-      "name": "equipped-HELMET",
-      "directions": 4
-    },
-    {
-      "name": "inhand-left",
-      "directions": 4
-    },
-    {
-      "name": "inhand-right",
-      "directions": 4
-    }
-  ]
-}
diff --git a/Resources/Textures/Clothing/Head/Soft/yellowsoft_flipped.rsi/equipped-HELMET.png b/Resources/Textures/Clothing/Head/Soft/yellowsoft.rsi/flipped-equipped-HELMET.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/yellowsoft_flipped.rsi/equipped-HELMET.png
rename to Resources/Textures/Clothing/Head/Soft/yellowsoft.rsi/flipped-equipped-HELMET.png
diff --git a/Resources/Textures/Clothing/Head/Soft/yellowsoft_flipped.rsi/inhand-left.png b/Resources/Textures/Clothing/Head/Soft/yellowsoft.rsi/flipped-inhand-left.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/yellowsoft_flipped.rsi/inhand-left.png
rename to Resources/Textures/Clothing/Head/Soft/yellowsoft.rsi/flipped-inhand-left.png
diff --git a/Resources/Textures/Clothing/Head/Soft/yellowsoft_flipped.rsi/inhand-right.png b/Resources/Textures/Clothing/Head/Soft/yellowsoft.rsi/flipped-inhand-right.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/yellowsoft_flipped.rsi/inhand-right.png
rename to Resources/Textures/Clothing/Head/Soft/yellowsoft.rsi/flipped-inhand-right.png
diff --git a/Resources/Textures/Clothing/Head/Soft/yellowsoft_flipped.rsi/icon.png b/Resources/Textures/Clothing/Head/Soft/yellowsoft.rsi/icon_flipped.png
similarity index 100%
rename from Resources/Textures/Clothing/Head/Soft/yellowsoft_flipped.rsi/icon.png
rename to Resources/Textures/Clothing/Head/Soft/yellowsoft.rsi/icon_flipped.png
diff --git a/Resources/Textures/Clothing/Head/Soft/yellowsoft.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/yellowsoft.rsi/meta.json
index a470e009443..a29360acd8b 100644
--- a/Resources/Textures/Clothing/Head/Soft/yellowsoft.rsi/meta.json
+++ b/Resources/Textures/Clothing/Head/Soft/yellowsoft.rsi/meta.json
@@ -10,6 +10,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_flipped"
+    },
     {
       "name": "equipped-HELMET",
       "directions": 4
@@ -21,6 +24,18 @@
     {
       "name": "inhand-right",
       "directions": 4
+    },
+    {
+      "name": "flipped-equipped-HELMET",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-left",
+      "directions": 4
+    },
+    {
+      "name": "flipped-inhand-right",
+      "directions": 4
     }
   ]
 }
diff --git a/Resources/Textures/Clothing/Head/Soft/yellowsoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Head/Soft/yellowsoft_flipped.rsi/meta.json
deleted file mode 100644
index a470e009443..00000000000
--- a/Resources/Textures/Clothing/Head/Soft/yellowsoft_flipped.rsi/meta.json
+++ /dev/null
@@ -1,26 +0,0 @@
-{
-  "version": 1,
-  "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e",
-  "size": {
-    "x": 32,
-    "y": 32
-  },
-  "states": [
-    {
-      "name": "icon"
-    },
-    {
-      "name": "equipped-HELMET",
-      "directions": 4
-    },
-    {
-      "name": "inhand-left",
-      "directions": 4
-    },
-    {
-      "name": "inhand-right",
-      "directions": 4
-    }
-  ]
-}
diff --git a/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/equipped-INNERCLOTHING.png b/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/equipped-INNERCLOTHING.png
new file mode 100644
index 00000000000..3fa68c11d46
Binary files /dev/null and b/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/equipped-INNERCLOTHING.png differ
diff --git a/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/icon.png b/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/icon.png
new file mode 100644
index 00000000000..63325952266
Binary files /dev/null and b/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/icon.png differ
diff --git a/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/inhand-left.png b/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/inhand-left.png
new file mode 100644
index 00000000000..e5c39a74eb8
Binary files /dev/null and b/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/inhand-left.png differ
diff --git a/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/inhand-right.png b/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/inhand-right.png
new file mode 100644
index 00000000000..014ac5f9ec6
Binary files /dev/null and b/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/inhand-right.png differ
diff --git a/Resources/Textures/Clothing/Head/Soft/blacksoft_flipped.rsi/meta.json b/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/meta.json
similarity index 64%
rename from Resources/Textures/Clothing/Head/Soft/blacksoft_flipped.rsi/meta.json
rename to Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/meta.json
index a470e009443..7f5c61326f2 100644
--- a/Resources/Textures/Clothing/Head/Soft/blacksoft_flipped.rsi/meta.json
+++ b/Resources/Textures/Clothing/Uniforms/Jumpsuit/qmformal.rsi/meta.json
@@ -1,7 +1,7 @@
 {
   "version": 1,
   "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/4f6190e2895e09116663ef282d3ce1d8b35c032e",
+  "copyright": "Spritework done by Hanzdegloker",
   "size": {
     "x": 32,
     "y": 32
@@ -11,7 +11,7 @@
       "name": "icon"
     },
     {
-      "name": "equipped-HELMET",
+      "name": "equipped-INNERCLOTHING",
       "directions": 4
     },
     {
diff --git a/Resources/Textures/LobbyScreens/skellyvstherev.png b/Resources/Textures/LobbyScreens/skellyvstherev.png
index d2239d50e26..2d4887c5147 100644
Binary files a/Resources/Textures/LobbyScreens/skellyvstherev.png and b/Resources/Textures/LobbyScreens/skellyvstherev.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-1.png
new file mode 100644
index 00000000000..e9d7a95189d
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-2.png
new file mode 100644
index 00000000000..745b1b6087e
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-3.png
new file mode 100644
index 00000000000..7b1add8abad
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-4.png
new file mode 100644
index 00000000000..102c82b37cf
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-5.png
new file mode 100644
index 00000000000..019f5e700a7
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..ecdaec3e51e
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/icon_open.png
new file mode 100644
index 00000000000..55f7440f979
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/meta.json
index e8a2f8c21d0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/absinthebottle.rsi/meta.json
@@ -9,6 +9,27 @@
     "states": [
         {
             "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
         }
     ]
-}
\ No newline at end of file
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-blue.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/alco-blue.rsi/meta.json
deleted file mode 100644
index db0ac608ed0..00000000000
--- a/Resources/Textures/Objects/Consumable/Drinks/alco-blue.rsi/meta.json
+++ /dev/null
@@ -1 +0,0 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-1.png
new file mode 100644
index 00000000000..bbb021eb2ee
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-2.png
new file mode 100644
index 00000000000..b9d62612269
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-3.png
new file mode 100644
index 00000000000..9800a56db3b
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-4.png
new file mode 100644
index 00000000000..34088c12e0c
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-5.png
new file mode 100644
index 00000000000..bbbff3ac084
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-6.png b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-6.png
new file mode 100644
index 00000000000..f2b760876e5
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/fill-6.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-blue.rsi/icon.png b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_blue.png
similarity index 100%
rename from Resources/Textures/Objects/Consumable/Drinks/alco-blue.rsi/icon.png
rename to Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_blue.png
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..851126deae3
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-green.rsi/icon.png b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_green.png
similarity index 100%
rename from Resources/Textures/Objects/Consumable/Drinks/alco-green.rsi/icon.png
rename to Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_green.png
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_open.png
new file mode 100644
index 00000000000..b336e18eb19
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-red.rsi/icon.png b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_red.png
similarity index 100%
rename from Resources/Textures/Objects/Consumable/Drinks/alco-red.rsi/icon.png
rename to Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_red.png
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-white.rsi/icon.png b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_white.png
similarity index 100%
rename from Resources/Textures/Objects/Consumable/Drinks/alco-white.rsi/icon.png
rename to Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/icon_white.png
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/meta.json
new file mode 100644
index 00000000000..f60e29d82ff
--- /dev/null
+++ b/Resources/Textures/Objects/Consumable/Drinks/alco-bottle.rsi/meta.json
@@ -0,0 +1,47 @@
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon_blue"
+        },
+        {
+            "name": "icon_green"
+        },
+        {
+            "name": "icon_red"
+        },
+        {
+            "name": "icon_white"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        },
+        {
+            "name": "fill-6"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-green.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/alco-green.rsi/meta.json
deleted file mode 100644
index db0ac608ed0..00000000000
--- a/Resources/Textures/Objects/Consumable/Drinks/alco-green.rsi/meta.json
+++ /dev/null
@@ -1 +0,0 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-red.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/alco-red.rsi/meta.json
deleted file mode 100644
index db0ac608ed0..00000000000
--- a/Resources/Textures/Objects/Consumable/Drinks/alco-red.rsi/meta.json
+++ /dev/null
@@ -1 +0,0 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alco-white.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/alco-white.rsi/meta.json
deleted file mode 100644
index db0ac608ed0..00000000000
--- a/Resources/Textures/Objects/Consumable/Drinks/alco-white.rsi/meta.json
+++ /dev/null
@@ -1 +0,0 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-1.png
new file mode 100644
index 00000000000..1f619fbaa5d
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-2.png
new file mode 100644
index 00000000000..88227517204
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-3.png
new file mode 100644
index 00000000000..6d10fc3f83f
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-4.png
new file mode 100644
index 00000000000..aa9bafc5795
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-5.png
new file mode 100644
index 00000000000..6cf2364cfd7
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/icon.png b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/icon.png
index b7a9513892f..08afa947bee 100644
Binary files a/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/icon.png and b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/icon.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..435165699ca
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/icon_open.png
new file mode 100644
index 00000000000..b1875071659
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/alebottle.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-1.png
new file mode 100644
index 00000000000..ad1e2bcd42a
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-2.png
new file mode 100644
index 00000000000..427623e18d0
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-3.png
new file mode 100644
index 00000000000..cfdd56ce4dd
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-4.png
new file mode 100644
index 00000000000..914871c0c4b
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-5.png
new file mode 100644
index 00000000000..af50ba4dddf
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/icon_empty.png
new file mode 100644
index 00000000000..e21b03404b8
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/icon_open.png
new file mode 100644
index 00000000000..104b034512e
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/beer.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/bottleofnothing.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/bottleofnothing.rsi/icon_open.png
new file mode 100644
index 00000000000..7796e65b730
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/bottleofnothing.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/bottleofnothing.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/bottleofnothing.rsi/meta.json
index db0ac608ed0..9e1d9a9075d 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/bottleofnothing.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/bottleofnothing.rsi/meta.json
@@ -1 +1,17 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/champagnebottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/champagnebottle.rsi/icon_open.png
new file mode 100644
index 00000000000..24af278a243
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/champagnebottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/champagnebottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/champagnebottle.rsi/meta.json
index 26120dfca27..e00674b3017 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/champagnebottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/champagnebottle.rsi/meta.json
@@ -1 +1,17 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "drawn by givazaa", "states": [{"name": "icon"}]}
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "drawn by givazaa",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/coffeeliqueurbottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/coffeeliqueurbottle.rsi/icon_open.png
new file mode 100644
index 00000000000..551294d38a4
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/coffeeliqueurbottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/coffeeliqueurbottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/coffeeliqueurbottle.rsi/meta.json
index db0ac608ed0..9e1d9a9075d 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/coffeeliqueurbottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/coffeeliqueurbottle.rsi/meta.json
@@ -1 +1,17 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-1.png
new file mode 100644
index 00000000000..c06c1991f4e
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-2.png
new file mode 100644
index 00000000000..2e40321ad09
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-3.png
new file mode 100644
index 00000000000..c3fbdaa6bf7
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-4.png
new file mode 100644
index 00000000000..8740f00aab4
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-5.png
new file mode 100644
index 00000000000..fa851ae0f3b
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..506b9adb05d
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/icon_open.png
new file mode 100644
index 00000000000..04603ddf48c
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/cognacbottle.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-1.png
new file mode 100644
index 00000000000..6fbbd2f8bb9
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-2.png
new file mode 100644
index 00000000000..aea5ea2c092
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-3.png
new file mode 100644
index 00000000000..1f207025925
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-4.png
new file mode 100644
index 00000000000..42fd7dc5d40
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-5.png
new file mode 100644
index 00000000000..945ebf7b491
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..1559e7e97a3
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/icon_open.png
new file mode 100644
index 00000000000..1865d811069
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/colabottle.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/cream.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/cream.rsi/icon_open.png
new file mode 100644
index 00000000000..8ded82d6b16
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/cream.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/cream.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/cream.rsi/meta.json
index db0ac608ed0..9e1d9a9075d 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/cream.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/cream.rsi/meta.json
@@ -1 +1,17 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-1.png
new file mode 100644
index 00000000000..aa09b488ec5
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-2.png
new file mode 100644
index 00000000000..db67a5a9307
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-3.png
new file mode 100644
index 00000000000..5179f6e95c4
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-4.png
new file mode 100644
index 00000000000..9c3b596b30b
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-5.png
new file mode 100644
index 00000000000..ede911766ff
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..cbe035e903b
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/icon_open.png
new file mode 100644
index 00000000000..4608bf002ba
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/gildlagerbottle.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-1.png
new file mode 100644
index 00000000000..830daf63e92
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-2.png
new file mode 100644
index 00000000000..6e51f6f0b2b
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-3.png
new file mode 100644
index 00000000000..7cf0630577e
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-4.png
new file mode 100644
index 00000000000..2d44a181a69
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-5.png
new file mode 100644
index 00000000000..60b0e590050
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..f830bdc9b20
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/icon_open.png
new file mode 100644
index 00000000000..3edd21f8b5a
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/ginbottle.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/glue-tube.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/glue-tube.rsi/icon_open.png
new file mode 100644
index 00000000000..451a3eed0a6
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/glue-tube.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/glue-tube.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/glue-tube.rsi/meta.json
index 734e9e1e649..7319ee88375 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/glue-tube.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/glue-tube.rsi/meta.json
@@ -10,6 +10,9 @@
         {
             "name": "icon"
         },
+        {
+            "name": "icon_open"
+        },
         {
             "name": "icon-front"
         },
diff --git a/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-1.png
new file mode 100644
index 00000000000..09ad1e1b40c
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-2.png
new file mode 100644
index 00000000000..d793961320e
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-3.png
new file mode 100644
index 00000000000..0b279477acb
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-4.png
new file mode 100644
index 00000000000..0b279477acb
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-5.png
new file mode 100644
index 00000000000..334740168cc
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-6.png b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-6.png
new file mode 100644
index 00000000000..666cfd1e139
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/fill-6.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..e1a454f85bd
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/icon_open.png
new file mode 100644
index 00000000000..cf55ed3dc2f
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/meta.json
index db0ac608ed0..6542150423d 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/grenadinebottle.rsi/meta.json
@@ -1 +1,38 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        },
+        {
+            "name": "fill-6"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/limejuice.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/limejuice.rsi/icon_open.png
new file mode 100644
index 00000000000..c35813f1984
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/limejuice.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/limejuice.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/limejuice.rsi/meta.json
index db0ac608ed0..9e1d9a9075d 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/limejuice.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/limejuice.rsi/meta.json
@@ -1 +1,17 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/lube-tube.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/lube-tube.rsi/icon_open.png
new file mode 100644
index 00000000000..4ec59c6cf34
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/lube-tube.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/lube-tube.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/lube-tube.rsi/meta.json
index 734e9e1e649..7319ee88375 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/lube-tube.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/lube-tube.rsi/meta.json
@@ -10,6 +10,9 @@
         {
             "name": "icon"
         },
+        {
+            "name": "icon_open"
+        },
         {
             "name": "icon-front"
         },
diff --git a/Resources/Textures/Objects/Consumable/Drinks/milk.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/milk.rsi/icon_open.png
new file mode 100644
index 00000000000..cb980176272
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/milk.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/milk.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/milk.rsi/meta.json
index db0ac608ed0..9e1d9a9075d 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/milk.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/milk.rsi/meta.json
@@ -1 +1,17 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-1.png
new file mode 100644
index 00000000000..22eb0ee04b8
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-2.png
new file mode 100644
index 00000000000..976b08102ca
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-3.png
new file mode 100644
index 00000000000..976b08102ca
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-4.png
new file mode 100644
index 00000000000..637cd877a5f
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-5.png
new file mode 100644
index 00000000000..593115fb641
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/icon_empty.png
new file mode 100644
index 00000000000..332019fd287
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/icon_open.png
new file mode 100644
index 00000000000..677c9b74dd1
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/mopwata.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/oatmilk.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/oatmilk.rsi/icon_open.png
new file mode 100644
index 00000000000..5cf240ff025
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/oatmilk.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/oatmilk.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/oatmilk.rsi/meta.json
index db0ac608ed0..9e1d9a9075d 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/oatmilk.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/oatmilk.rsi/meta.json
@@ -1 +1,17 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/orangejuice.rsi/icon.png b/Resources/Textures/Objects/Consumable/Drinks/orangejuice.rsi/icon.png
index 360b1a14634..59bfce31f9f 100644
Binary files a/Resources/Textures/Objects/Consumable/Drinks/orangejuice.rsi/icon.png and b/Resources/Textures/Objects/Consumable/Drinks/orangejuice.rsi/icon.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/orangejuice.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/orangejuice.rsi/icon_open.png
new file mode 100644
index 00000000000..97146708042
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/orangejuice.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/orangejuice.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/orangejuice.rsi/meta.json
index db0ac608ed0..9e1d9a9075d 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/orangejuice.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/orangejuice.rsi/meta.json
@@ -1 +1,17 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-1.png
new file mode 100644
index 00000000000..8fdc92f22be
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-2.png
new file mode 100644
index 00000000000..77f01452d0d
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-3.png
new file mode 100644
index 00000000000..58f72cf2d31
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-4.png
new file mode 100644
index 00000000000..627b5410e22
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-5.png
new file mode 100644
index 00000000000..33a96802d6b
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..9dc2e2ffa8e
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/icon_open.png
new file mode 100644
index 00000000000..e137b231ddd
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/patronbottle.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/pwinebottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/pwinebottle.rsi/icon_open.png
new file mode 100644
index 00000000000..46ad7af1561
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/pwinebottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/pwinebottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/pwinebottle.rsi/meta.json
index db0ac608ed0..9e1d9a9075d 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/pwinebottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/pwinebottle.rsi/meta.json
@@ -1 +1,17 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-1.png
new file mode 100644
index 00000000000..edb576e2235
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-2.png
new file mode 100644
index 00000000000..0926cb5d2d5
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-3.png
new file mode 100644
index 00000000000..0926cb5d2d5
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-4.png
new file mode 100644
index 00000000000..7bf2a28acac
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-5.png
new file mode 100644
index 00000000000..6d4f19e9ffb
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..2dd73a7cb5f
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/icon_open.png
new file mode 100644
index 00000000000..27221c4c664
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/rumbottle.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/soymilk.rsi/icon.png b/Resources/Textures/Objects/Consumable/Drinks/soymilk.rsi/icon.png
index 307ff9a9d0d..168410f3310 100644
Binary files a/Resources/Textures/Objects/Consumable/Drinks/soymilk.rsi/icon.png and b/Resources/Textures/Objects/Consumable/Drinks/soymilk.rsi/icon.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/soymilk.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/soymilk.rsi/icon_open.png
new file mode 100644
index 00000000000..188d07f1d51
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/soymilk.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/soymilk.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/soymilk.rsi/meta.json
index db0ac608ed0..9e1d9a9075d 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/soymilk.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/soymilk.rsi/meta.json
@@ -1 +1,17 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-1.png
new file mode 100644
index 00000000000..6fbbd2f8bb9
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-2.png
new file mode 100644
index 00000000000..aea5ea2c092
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-3.png
new file mode 100644
index 00000000000..1f207025925
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-4.png
new file mode 100644
index 00000000000..42fd7dc5d40
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-5.png
new file mode 100644
index 00000000000..945ebf7b491
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..69a0fd07c89
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/icon_open.png
new file mode 100644
index 00000000000..f9e2861df08
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/space-up_bottle.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-1.png
new file mode 100644
index 00000000000..6fbbd2f8bb9
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-2.png
new file mode 100644
index 00000000000..aea5ea2c092
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-3.png
new file mode 100644
index 00000000000..1f207025925
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-4.png
new file mode 100644
index 00000000000..42fd7dc5d40
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-5.png
new file mode 100644
index 00000000000..945ebf7b491
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..18e42a0f4d9
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/icon_open.png
new file mode 100644
index 00000000000..d74fc8721ab
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/space_mountain_wind_bottle.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-1.png
new file mode 100644
index 00000000000..204e885505a
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-2.png
new file mode 100644
index 00000000000..fa2fa7a1eb6
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-3.png
new file mode 100644
index 00000000000..b72059d7653
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-4.png
new file mode 100644
index 00000000000..f3d24cd95ac
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-5.png
new file mode 100644
index 00000000000..0e0cf52bda6
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..c8e014cc46a
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/icon_open.png
new file mode 100644
index 00000000000..f6bbfd2e8f5
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/tequillabottle.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/tomatojuice.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/tomatojuice.rsi/icon_open.png
new file mode 100644
index 00000000000..fbf113292bb
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/tomatojuice.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/tomatojuice.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/tomatojuice.rsi/meta.json
index db0ac608ed0..9e1d9a9075d 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/tomatojuice.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/tomatojuice.rsi/meta.json
@@ -1 +1,17 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-1.png
new file mode 100644
index 00000000000..be5efc55d81
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-2.png
new file mode 100644
index 00000000000..32eadfa1ce0
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-3.png
new file mode 100644
index 00000000000..d4b964e7cd1
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-4.png
new file mode 100644
index 00000000000..ae4d881c473
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-5.png
new file mode 100644
index 00000000000..ab82bb4b65c
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..3983b282db9
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/icon_open.png
new file mode 100644
index 00000000000..25787f9279b
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/vermouthbottle.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-1.png
new file mode 100644
index 00000000000..345d88ca775
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-2.png
new file mode 100644
index 00000000000..051e61b2d5e
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-3.png
new file mode 100644
index 00000000000..051e61b2d5e
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-4.png
new file mode 100644
index 00000000000..6ff8e90bf3d
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-5.png
new file mode 100644
index 00000000000..fec5c1b2fc3
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..1c7c3765e99
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/icon_open.png
new file mode 100644
index 00000000000..cec7bd047be
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/vodkabottle.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/waterbottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/waterbottle.rsi/icon_open.png
new file mode 100644
index 00000000000..e38ba306507
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/waterbottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/waterbottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/waterbottle.rsi/meta.json
index 0922ee1d1aa..763da96dcbb 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/waterbottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/waterbottle.rsi/meta.json
@@ -11,6 +11,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_open"
+    },
     {
       "name": "icon-1"
     },
diff --git a/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-1.png b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-1.png
new file mode 100644
index 00000000000..d5b0ad0b404
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-1.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-2.png b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-2.png
new file mode 100644
index 00000000000..ff0a6c45d77
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-2.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-3.png b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-3.png
new file mode 100644
index 00000000000..ff0a6c45d77
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-3.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-4.png b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-4.png
new file mode 100644
index 00000000000..cc97fb30d6f
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-4.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-5.png b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-5.png
new file mode 100644
index 00000000000..44a006bcc1b
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/fill-5.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/icon_empty.png b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/icon_empty.png
new file mode 100644
index 00000000000..196022ee1ae
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/icon_empty.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/icon_open.png
new file mode 100644
index 00000000000..31d51b22663
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/meta.json
index db0ac608ed0..960293f615a 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/whiskeybottle.rsi/meta.json
@@ -1 +1,35 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        },
+        {
+            "name": "icon_empty"
+        },
+        {
+            "name": "fill-1"
+        },
+        {
+            "name": "fill-2"
+        },
+        {
+            "name": "fill-3"
+        },
+        {
+            "name": "fill-4"
+        },
+        {
+            "name": "fill-5"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Drinks/winebottle.rsi/icon.png b/Resources/Textures/Objects/Consumable/Drinks/winebottle.rsi/icon.png
index 8929546cb50..e527e5598a9 100644
Binary files a/Resources/Textures/Objects/Consumable/Drinks/winebottle.rsi/icon.png and b/Resources/Textures/Objects/Consumable/Drinks/winebottle.rsi/icon.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/winebottle.rsi/icon_open.png b/Resources/Textures/Objects/Consumable/Drinks/winebottle.rsi/icon_open.png
new file mode 100644
index 00000000000..399e934cd79
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Drinks/winebottle.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Drinks/winebottle.rsi/meta.json b/Resources/Textures/Objects/Consumable/Drinks/winebottle.rsi/meta.json
index db0ac608ed0..9e1d9a9075d 100644
--- a/Resources/Textures/Objects/Consumable/Drinks/winebottle.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Drinks/winebottle.rsi/meta.json
@@ -1 +1,17 @@
-{"version": 1, "size": {"x": 32, "y": 32}, "license": "CC-BY-SA-3.0", "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi", "states": [{"name": "icon"}]}
\ No newline at end of file
+{
+    "version": 1,
+    "size": {
+        "x": 32,
+        "y": 32
+    },
+    "license": "CC-BY-SA-3.0",
+    "copyright": "https://github.com/discordia-space/CEV-Eris/raw/f7aa28fd4b4d0386c3393d829681ebca526f1d2d/icons/obj/drinks.dmi",
+    "states": [
+        {
+            "name": "icon"
+        },
+        {
+            "name": "icon_open"
+        }
+    ]
+}
diff --git a/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/carp-box.png b/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/carp-box.png
new file mode 100644
index 00000000000..aa82f12f19c
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/carp-box.png differ
diff --git a/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/carp.png b/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/carp.png
new file mode 100644
index 00000000000..7009099cf15
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/carp.png differ
diff --git a/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/meta.json b/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/meta.json
index bf4050e45ec..a2228b340ed 100644
--- a/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/meta.json
@@ -1,7 +1,7 @@
 {
   "version": 1,
   "license": "CC-BY-SA-3.0",
-  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/c6e3401f2e7e1e55c57060cdf956a98ef1fefc24",
+  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/c6e3401f2e7e1e55c57060cdf956a98ef1fefc24. Stonk pocket by Tayrtahn on GitHub. Carp pocket by deltanedas (GitHub).",
   "size": {
     "x": 32,
     "y": 32
@@ -46,12 +46,24 @@
     {
       "name": "teriyaki-box"
     },
-	{
+    {
       "name": "dink-box"
     },
-	{
+    {
       "name": "dink"
     },
+    {
+      "name": "stonk-box"
+    },
+    {
+      "name": "stonk"
+    },
+    {
+      "name": "carp-box"
+    },
+    {
+      "name": "carp"
+    },
     {
       "name": "inhand-left",
       "directions": 4
diff --git a/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/stonk-box.png b/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/stonk-box.png
new file mode 100644
index 00000000000..c69cbd91562
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/stonk-box.png differ
diff --git a/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/stonk.png b/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/stonk.png
new file mode 100644
index 00000000000..1f3df9217fc
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Food/Baked/donkpocket.rsi/stonk.png differ
diff --git a/Resources/Textures/Objects/Consumable/Food/condiments.rsi/bottle-open.png b/Resources/Textures/Objects/Consumable/Food/condiments.rsi/bottle-open.png
new file mode 100644
index 00000000000..e4348aebba4
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Food/condiments.rsi/bottle-open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Food/condiments.rsi/meta.json b/Resources/Textures/Objects/Consumable/Food/condiments.rsi/meta.json
index bcba1b89bad..a2398a2fa5f 100644
--- a/Resources/Textures/Objects/Consumable/Food/condiments.rsi/meta.json
+++ b/Resources/Textures/Objects/Consumable/Food/condiments.rsi/meta.json
@@ -16,6 +16,9 @@
     {
       "name": "bottle-empty"
     },
+    {
+      "name": "bottle-open"
+    },
     {
       "name": "bottle-enzyme"
     },
@@ -118,9 +121,15 @@
     {
       "name": "packet-layer"
     },
+    {
+      "name": "packet-layer-open"
+    },
     {
       "name": "packet-label"
     },
+    {
+      "name": "packet-label-a"
+    },
     {
       "name": "packet-trans-1"
     },
diff --git a/Resources/Textures/Objects/Consumable/Food/condiments.rsi/packet-label-a.png b/Resources/Textures/Objects/Consumable/Food/condiments.rsi/packet-label-a.png
new file mode 100644
index 00000000000..1e2fd3afe48
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Food/condiments.rsi/packet-label-a.png differ
diff --git a/Resources/Textures/Objects/Consumable/Food/condiments.rsi/packet-layer-open.png b/Resources/Textures/Objects/Consumable/Food/condiments.rsi/packet-layer-open.png
new file mode 100644
index 00000000000..773cff79607
Binary files /dev/null and b/Resources/Textures/Objects/Consumable/Food/condiments.rsi/packet-layer-open.png differ
diff --git a/Resources/Textures/Objects/Consumable/Food/condiments.rsi/packet-layer.png b/Resources/Textures/Objects/Consumable/Food/condiments.rsi/packet-layer.png
index 91fda9c7061..7b971fa2276 100644
Binary files a/Resources/Textures/Objects/Consumable/Food/condiments.rsi/packet-layer.png and b/Resources/Textures/Objects/Consumable/Food/condiments.rsi/packet-layer.png differ
diff --git a/Resources/Textures/Objects/Consumable/TrashDrinks/whiskeybottle_empty.rsi/icon.png b/Resources/Textures/Objects/Consumable/TrashDrinks/whiskeybottle_empty.rsi/icon.png
index e249a5ce904..c0eafca1081 100644
Binary files a/Resources/Textures/Objects/Consumable/TrashDrinks/whiskeybottle_empty.rsi/icon.png and b/Resources/Textures/Objects/Consumable/TrashDrinks/whiskeybottle_empty.rsi/icon.png differ
diff --git a/Resources/Textures/Objects/Fun/glue.rsi/icon_open.png b/Resources/Textures/Objects/Fun/glue.rsi/icon_open.png
new file mode 100644
index 00000000000..cc2039df905
Binary files /dev/null and b/Resources/Textures/Objects/Fun/glue.rsi/icon_open.png differ
diff --git a/Resources/Textures/Objects/Fun/glue.rsi/meta.json b/Resources/Textures/Objects/Fun/glue.rsi/meta.json
index d2ae18500a5..55fc6227cd4 100644
--- a/Resources/Textures/Objects/Fun/glue.rsi/meta.json
+++ b/Resources/Textures/Objects/Fun/glue.rsi/meta.json
@@ -10,6 +10,9 @@
     {
       "name": "icon"
     },
+    {
+      "name": "icon_open"
+    },
     {
       "name": "inhand-left",
       "directions": 4
diff --git a/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/dead.png b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/dead.png
new file mode 100644
index 00000000000..ded6b2eb773
Binary files /dev/null and b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/dead.png differ
diff --git a/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/harvest.png b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/harvest.png
new file mode 100644
index 00000000000..602809f9005
Binary files /dev/null and b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/harvest.png differ
diff --git a/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/meta.json b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/meta.json
new file mode 100644
index 00000000000..2799387216e
--- /dev/null
+++ b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/meta.json
@@ -0,0 +1,32 @@
+{
+  "version": 1,
+  "license": "CC-BY-SA-3.0",
+  "copyright": "Taken from tgstation at commit https://github.com/tgstation/tgstation/commit/a5e6db8f99b436b643bd3b76fa131ac074dfd856 seed modified by potato1234_x (github) for ss14",
+  "size": {
+    "x": 32,
+    "y": 32
+  },
+  "states": [
+    {
+      "name": "dead"
+    },
+    {
+      "name": "harvest"
+    },
+    {
+      "name": "produce"
+    },
+    {
+      "name": "seed"
+    },
+    {
+      "name": "stage-1"
+    },
+    {
+      "name": "stage-2"
+    },
+    {
+      "name": "stage-3"
+    }
+  ]
+}
diff --git a/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/produce.png b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/produce.png
new file mode 100644
index 00000000000..e4fd37ff960
Binary files /dev/null and b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/produce.png differ
diff --git a/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/seed.png b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/seed.png
new file mode 100644
index 00000000000..a4ad791bb1a
Binary files /dev/null and b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/seed.png differ
diff --git a/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/stage-1.png b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/stage-1.png
new file mode 100644
index 00000000000..1c710f40db2
Binary files /dev/null and b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/stage-1.png differ
diff --git a/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/stage-2.png b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/stage-2.png
new file mode 100644
index 00000000000..157a081b35d
Binary files /dev/null and b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/stage-2.png differ
diff --git a/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/stage-3.png b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/stage-3.png
new file mode 100644
index 00000000000..311098b975a
Binary files /dev/null and b/Resources/Textures/Objects/Specific/Hydroponics/laughin_pea.rsi/stage-3.png differ
diff --git a/Resources/Textures/Objects/Specific/Medical/medical.rsi/meta.json b/Resources/Textures/Objects/Specific/Medical/medical.rsi/meta.json
index 79d08e485b9..e4f039ada9b 100644
--- a/Resources/Textures/Objects/Specific/Medical/medical.rsi/meta.json
+++ b/Resources/Textures/Objects/Specific/Medical/medical.rsi/meta.json
@@ -3,6 +3,7 @@
 	"license": "CC-BY-SA-3.0",
   "copyright": "Taken from cev-eris at https://github.com/discordia-space/CEV-Eris/commit/740ff31a81313086cf16761f3677cf1e2ab46c93 and Taken from tgstation at https://github.com/tgstation/tgstation/blob/623290915c2292b56da11048deb62d758e1e3fb4/icons/obj/bloodpack.dmi, Blood pack redone by Ubaser",
   "copyright": "Taken from https://github.com/tgstation/tgstation/blob/a3568da5634e756d0849480104afda402c6f1c3c/icons/obj/medical/stack_medical.dmi",
+  "copyright": "Tourniquet Sprite by PoorMansDreams",
 	"size": {
 		"x": 32,
 		"y": 32
@@ -25,6 +26,9 @@
 		{
 			"name": "gauze"
 		},
+        {
+            "name": "tourniquet"
+        },
 		{
 			"name": "morphine"
 		},
diff --git a/Resources/Textures/Objects/Specific/Medical/medical.rsi/tourniquet.png b/Resources/Textures/Objects/Specific/Medical/medical.rsi/tourniquet.png
new file mode 100644
index 00000000000..fce355eb9ef
Binary files /dev/null and b/Resources/Textures/Objects/Specific/Medical/medical.rsi/tourniquet.png differ
diff --git a/Resources/Textures/Objects/Tiles/tile.rsi/astrograss.png b/Resources/Textures/Objects/Tiles/tile.rsi/astrograss.png
index 14d2f9ef849..f548ef7ace9 100644
Binary files a/Resources/Textures/Objects/Tiles/tile.rsi/astrograss.png and b/Resources/Textures/Objects/Tiles/tile.rsi/astrograss.png differ
diff --git a/Resources/Textures/Objects/Tiles/tile.rsi/astroice.png b/Resources/Textures/Objects/Tiles/tile.rsi/astroice.png
index e17ee0500b9..e3c0948112e 100644
Binary files a/Resources/Textures/Objects/Tiles/tile.rsi/astroice.png and b/Resources/Textures/Objects/Tiles/tile.rsi/astroice.png differ
diff --git a/Resources/Textures/Objects/Tiles/tile.rsi/meta.json b/Resources/Textures/Objects/Tiles/tile.rsi/meta.json
index 05aeba33fd5..9fc66d78b90 100644
--- a/Resources/Textures/Objects/Tiles/tile.rsi/meta.json
+++ b/Resources/Textures/Objects/Tiles/tile.rsi/meta.json
@@ -195,6 +195,12 @@
     {
       "name": "shuttlered"
     },
+    {
+      "name": "shuttlegrey"
+    },
+    {
+      "name": "shuttleblack"
+    },
     {
       "name": "carpetclown"
     },
diff --git a/Resources/Textures/Objects/Tiles/tile.rsi/shuttleblack.png b/Resources/Textures/Objects/Tiles/tile.rsi/shuttleblack.png
new file mode 100644
index 00000000000..008eeb40e74
Binary files /dev/null and b/Resources/Textures/Objects/Tiles/tile.rsi/shuttleblack.png differ
diff --git a/Resources/Textures/Objects/Tiles/tile.rsi/shuttleblue.png b/Resources/Textures/Objects/Tiles/tile.rsi/shuttleblue.png
index 8fc34f39126..4fc4076aee3 100644
Binary files a/Resources/Textures/Objects/Tiles/tile.rsi/shuttleblue.png and b/Resources/Textures/Objects/Tiles/tile.rsi/shuttleblue.png differ
diff --git a/Resources/Textures/Objects/Tiles/tile.rsi/shuttlegrey.png b/Resources/Textures/Objects/Tiles/tile.rsi/shuttlegrey.png
new file mode 100644
index 00000000000..4fd7069afe6
Binary files /dev/null and b/Resources/Textures/Objects/Tiles/tile.rsi/shuttlegrey.png differ
diff --git a/Resources/Textures/Objects/Tiles/tile.rsi/shuttleorange.png b/Resources/Textures/Objects/Tiles/tile.rsi/shuttleorange.png
index 517da853365..3433d217e27 100644
Binary files a/Resources/Textures/Objects/Tiles/tile.rsi/shuttleorange.png and b/Resources/Textures/Objects/Tiles/tile.rsi/shuttleorange.png differ
diff --git a/Resources/Textures/Objects/Tiles/tile.rsi/shuttlepurple.png b/Resources/Textures/Objects/Tiles/tile.rsi/shuttlepurple.png
index c9459da1e8d..297822ee7f1 100644
Binary files a/Resources/Textures/Objects/Tiles/tile.rsi/shuttlepurple.png and b/Resources/Textures/Objects/Tiles/tile.rsi/shuttlepurple.png differ
diff --git a/Resources/Textures/Objects/Tiles/tile.rsi/shuttlered.png b/Resources/Textures/Objects/Tiles/tile.rsi/shuttlered.png
index e4f073d6dc2..024fef68f1b 100644
Binary files a/Resources/Textures/Objects/Tiles/tile.rsi/shuttlered.png and b/Resources/Textures/Objects/Tiles/tile.rsi/shuttlered.png differ
diff --git a/Resources/Textures/Objects/Tiles/tile.rsi/shuttlewhite.png b/Resources/Textures/Objects/Tiles/tile.rsi/shuttlewhite.png
index fcc482b34b2..ba8440cd33a 100644
Binary files a/Resources/Textures/Objects/Tiles/tile.rsi/shuttlewhite.png and b/Resources/Textures/Objects/Tiles/tile.rsi/shuttlewhite.png differ
diff --git a/Resources/Textures/Objects/Tiles/tile.rsi/snow.png b/Resources/Textures/Objects/Tiles/tile.rsi/snow.png
index 8742892b236..385e2d59ac2 100644
Binary files a/Resources/Textures/Objects/Tiles/tile.rsi/snow.png and b/Resources/Textures/Objects/Tiles/tile.rsi/snow.png differ
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/DamageOverlay_12.png b/Resources/Textures/Structures/Storage/glassbox.rsi/DamageOverlay_12.png
new file mode 100644
index 00000000000..6ed908b6826
Binary files /dev/null and b/Resources/Textures/Structures/Storage/glassbox.rsi/DamageOverlay_12.png differ
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/DamageOverlay_4.png b/Resources/Textures/Structures/Storage/glassbox.rsi/DamageOverlay_4.png
new file mode 100644
index 00000000000..e6a50bde32e
Binary files /dev/null and b/Resources/Textures/Structures/Storage/glassbox.rsi/DamageOverlay_4.png differ
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/DamageOverlay_8.png b/Resources/Textures/Structures/Storage/glassbox.rsi/DamageOverlay_8.png
new file mode 100644
index 00000000000..f1b8f6f5163
Binary files /dev/null and b/Resources/Textures/Structures/Storage/glassbox.rsi/DamageOverlay_8.png differ
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/caplaser.png b/Resources/Textures/Structures/Storage/glassbox.rsi/caplaser.png
new file mode 100644
index 00000000000..4af9023cd0c
Binary files /dev/null and b/Resources/Textures/Structures/Storage/glassbox.rsi/caplaser.png differ
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/glass-4.png b/Resources/Textures/Structures/Storage/glassbox.rsi/glass-4.png
new file mode 100644
index 00000000000..acb2054a66f
Binary files /dev/null and b/Resources/Textures/Structures/Storage/glassbox.rsi/glass-4.png differ
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/glass-up.png b/Resources/Textures/Structures/Storage/glassbox.rsi/glass-up.png
new file mode 100644
index 00000000000..39a32dfef5c
Binary files /dev/null and b/Resources/Textures/Structures/Storage/glassbox.rsi/glass-up.png differ
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/glass.png b/Resources/Textures/Structures/Storage/glassbox.rsi/glass.png
new file mode 100644
index 00000000000..1737ee03bda
Binary files /dev/null and b/Resources/Textures/Structures/Storage/glassbox.rsi/glass.png differ
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/glassbox-empty-open.png b/Resources/Textures/Structures/Storage/glassbox.rsi/glassbox-empty-open.png
new file mode 100644
index 00000000000..3a3bf591ca5
Binary files /dev/null and b/Resources/Textures/Structures/Storage/glassbox.rsi/glassbox-empty-open.png differ
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/glassbox-filled-closed.png b/Resources/Textures/Structures/Storage/glassbox.rsi/glassbox-filled-closed.png
new file mode 100644
index 00000000000..b558cf5212c
Binary files /dev/null and b/Resources/Textures/Structures/Storage/glassbox.rsi/glassbox-filled-closed.png differ
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/glassbox-filled-open.png b/Resources/Textures/Structures/Storage/glassbox.rsi/glassbox-filled-open.png
new file mode 100644
index 00000000000..48db8e88e59
Binary files /dev/null and b/Resources/Textures/Structures/Storage/glassbox.rsi/glassbox-filled-open.png differ
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/glassbox.png b/Resources/Textures/Structures/Storage/glassbox.rsi/glassbox.png
new file mode 100644
index 00000000000..3a3bf591ca5
Binary files /dev/null and b/Resources/Textures/Structures/Storage/glassbox.rsi/glassbox.png differ
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/locked.png b/Resources/Textures/Structures/Storage/glassbox.rsi/locked.png
new file mode 100644
index 00000000000..f5739c80587
Binary files /dev/null and b/Resources/Textures/Structures/Storage/glassbox.rsi/locked.png differ
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/meta.json b/Resources/Textures/Structures/Storage/glassbox.rsi/meta.json
new file mode 100644
index 00000000000..12f1e9bc0a1
--- /dev/null
+++ b/Resources/Textures/Structures/Storage/glassbox.rsi/meta.json
@@ -0,0 +1,50 @@
+{
+  "version": 1,
+  "license": "CC-BY-SA-3.0",
+  "copyright": "Taken from tgstation https://github.com/tgstation/tgstation/commit/0129a094635aac51e00fdc7aa3b4248affc1f49d Sprite modified and updated by Nimfar11 (Github)",
+  "size": {
+    "x": 32,
+    "y": 32
+  },
+  "states": [
+    {
+      "name": "glass"
+    },
+    {
+      "name": "DamageOverlay_4"
+    },
+    {
+      "name": "DamageOverlay_8"
+    },
+    {
+      "name": "DamageOverlay_12"
+    },
+    {
+      "name": "glass-4"
+    },
+    {
+      "name": "glass-up"
+    },
+    {
+      "name": "locked"
+    },
+    {
+      "name": "caplaser"
+    },
+    {
+      "name": "unlocked"
+    },
+    {
+      "name": "glassbox"
+    },
+    {
+      "name": "glassbox-empty-open"
+    },
+    {
+      "name": "glassbox-filled-closed"
+    },
+    {
+      "name": "glassbox-filled-open"
+    }
+  ]
+}
\ No newline at end of file
diff --git a/Resources/Textures/Structures/Storage/glassbox.rsi/unlocked.png b/Resources/Textures/Structures/Storage/glassbox.rsi/unlocked.png
new file mode 100644
index 00000000000..1c929003394
Binary files /dev/null and b/Resources/Textures/Structures/Storage/glassbox.rsi/unlocked.png differ
diff --git a/Resources/Textures/Tiles/attributions.yml b/Resources/Textures/Tiles/attributions.yml
index 1b61fda9706..d3d8a9f9e80 100644
--- a/Resources/Textures/Tiles/attributions.yml
+++ b/Resources/Textures/Tiles/attributions.yml
@@ -71,9 +71,9 @@
   copyright: "Taken from /tg/station at commit 6665eec76c98a4f3f89bebcd10b34b47dcc0b8ae"
   source: "https://github.com/space-wizards/space-station-14/pull/18676"
 
-- files: ["shuttleblue.png", "shuttleorange.png", "shuttlepurple.png", "shuttlered.png", "shuttlewhite.png"]
+- files: ["shuttleblue.png", "shuttleorange.png", "shuttlepurple.png", "shuttlered.png", "shuttlewhite.png", "shuttlegrey.png", "shuttleblack.png"]
   license: "CC-BY-SA-3.0"
-  copyright: "paradisestation commit 69c831afcd9aef25a2889b507e4f36a3a5fc6def, originally from /VG/ eris"
+  copyright: "Modified by Flareguy for Space Station 14. Unmodified sprite from paradisestation commit 69c831afcd9aef25a2889b507e4f36a3a5fc6def, originally from /VG/ eris"
   source: "https://github.com/ParadiseSS13/Paradise"
 
 - files: ["deprecated.png"]
diff --git a/Resources/Textures/Tiles/shuttleblack.png b/Resources/Textures/Tiles/shuttleblack.png
new file mode 100644
index 00000000000..e5dc3ff666f
Binary files /dev/null and b/Resources/Textures/Tiles/shuttleblack.png differ
diff --git a/Resources/Textures/Tiles/shuttleblue.png b/Resources/Textures/Tiles/shuttleblue.png
index da848dec986..8a57cf8b0a1 100644
Binary files a/Resources/Textures/Tiles/shuttleblue.png and b/Resources/Textures/Tiles/shuttleblue.png differ
diff --git a/Resources/Textures/Tiles/shuttlegrey.png b/Resources/Textures/Tiles/shuttlegrey.png
new file mode 100644
index 00000000000..337fef7d30d
Binary files /dev/null and b/Resources/Textures/Tiles/shuttlegrey.png differ
diff --git a/Resources/Textures/Tiles/shuttleorange.png b/Resources/Textures/Tiles/shuttleorange.png
index 46f562b506c..0e42ad3467d 100644
Binary files a/Resources/Textures/Tiles/shuttleorange.png and b/Resources/Textures/Tiles/shuttleorange.png differ
diff --git a/Resources/Textures/Tiles/shuttlepurple.png b/Resources/Textures/Tiles/shuttlepurple.png
index 3e05a9676db..2236948d382 100644
Binary files a/Resources/Textures/Tiles/shuttlepurple.png and b/Resources/Textures/Tiles/shuttlepurple.png differ
diff --git a/Resources/Textures/Tiles/shuttlered.png b/Resources/Textures/Tiles/shuttlered.png
index 49b6665dd27..732cf385d64 100644
Binary files a/Resources/Textures/Tiles/shuttlered.png and b/Resources/Textures/Tiles/shuttlered.png differ
diff --git a/Resources/Textures/Tiles/shuttlewhite.png b/Resources/Textures/Tiles/shuttlewhite.png
index 1e2dd5d0d5e..1308a78d9e4 100644
Binary files a/Resources/Textures/Tiles/shuttlewhite.png and b/Resources/Textures/Tiles/shuttlewhite.png differ