Skip to content

Latest commit

 

History

History
25 lines (16 loc) · 1.38 KB

processing_system_ini_file.md

File metadata and controls

25 lines (16 loc) · 1.38 KB
Raw

megSAP - Processing system INI file

The processing system INI file described the wet-lab processing of the sample (adapter sequences, target region, data type, etc) and defines the main parameters for the data analysis:

  • name_short - Processing system short name (must be a valid file name).
  • name_manufacturer - Processing system full name (can be any name, including characters that are invalid in file names).
  • target_file - Target region BED file path. The target region is used to determine where indel realignment and variant calling are done.
  • adapter1_p5 - Read 1 adapter sequence (Illumina standard is AGATCGGAAGAGCACACGTCTGAACTCCAGTCA).
  • adapter2_p7 - Read 2 adapter sequence (Illumina standard is AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT).
  • type - Processing system type: WGS, WES, Panel, Panel Haloplex, Panel MIPs or RNA.
  • shotgun - true for randomly-fragmented reads, false for amplicon-based reads.
  • umi_type - Unique molecular identifier type: n/a, HaloPlex HS, SureSelect HS, ThruPLEX, Safe-SeqS or MIPs.
  • build - Currently only GRCh37 is supported.

Notes for the RNA analysis pipeline:

  • target_file - Target region is only used for mapping quality control.
  • build - Basename of the genome build. FASTA, STAR index and GTF annotation have to be present.

back to the start page