Skip to content

Latest commit

 

History

History
60 lines (41 loc) · 2.97 KB

16SrRNAqPCR.md

File metadata and controls

60 lines (41 loc) · 2.97 KB

Protocol for qPCR of the 16S rRNA gene for microbe detection in germ-free animals and/or quantification

Version 0.992 19 Feb 2020 J Bisanz incomplete

Background

Checking the germ-free status of animals or quantifying the bacterial numbers in a sample can be carried out in a very sensitive and quantative manor using quantitative PCR. This protocol is using primers targetting the V6 as it (and the V3) have properties that make it intrinsically better for qPCR than V4. The use of multiple DNA extraction and/or environmental controls will help establish the baseline level of background reagent contamination and allow empirical decisions on contamination status and/or bacterial quantity. DNA extraction should be capable of recovery of low levels of bacteria (see 16S_SOP_2017.md) and provide a template free of PCR inhibition. Inhibition can be monitored by creating a dilution series of a positive control to ensure consistent quantification across dilutions.

Materials and Equipment

  • iTaq™ Universal Probes Supermix (BioRad 1725132)
  • CFX384 thermocycler (Biorad)
  • 384 Plates for qPCR (Biorad #HSP3865)
  • Optically clear Plate Seals (Biorad Microseal ‘B’ #MSB1001)
  • 10x Assay mix (prepare 2µM of each oligo below in nuclease-free water)
  • 10-fold dilution series of gDNA (from any bacteria). Use the QuBit DNA concentration to calculate 16S copy number based on genome size to genome copy number and rRNA copy number. For example: 1ng of E. lenta DSM 2243 DNA ~ 2.7E5 genome copies and the 16S rRNA copy number is 3, so the first point on a 10-fold dilution series prepared from 10ng/µL gDNA is 8.1E5 16S rRNA copies/µL.

Oligos

Oligo Sequence Stock [µM] Working [µM] Final [nM]
891F TGGAGCATGTGGTTTAATTCGA 100 2 200
1003R TGCGGGACTTAACCCAACA 100 2 200
1002P [6FAM]CACGAGCTGACGACARCCATGCA[BHQ1] 100 2 200

Setting up qPCR RXNs

The master mix we are using has an antibody-mediated hot-start, and as such can be set up at RT in the PCR flow-hood in a 384 well plate. If quantification is desired, the reactions should be set up in triplicate.

Reaction mixture

Component [stock] µL/rxn [final]
iTaq Supermix 2X 5 1X
10X assay mix 2µM 1 200nM
DNA template variable 4 varable

After setting up the plate, breifly centrifuge to mix and remove air bubbles before transfering to the CFX384.

Cycling Parameters

Cycle Temperature (˚C) Time
Initial Denaturation 95 5min
40 cycles:
Denature 95˚C 5 sec
Anneal/Extend 60˚C 15 sec
Hold 4˚C Hold 0 sec

When setting up the plate using the BioRad software, select the 384 plate template with all channels (not the FAM/SYBR only) and use the Gnoto_qPCR run template. Using the plate editor, change your standard curves from unknown, to standards and enter the copy number you have calculated.

Interpretation