processing_system_ini_file.md

megSAP - Processing system INI file

The processing system INI file described the wet-lab processing of the sample (adapter sequences, target region, data type, etc) and defines the main parameters for the data analysis:

• name_short - Processing system short name (must be a valid file name).
• name_manufacturer - Processing system full name (can be any name, including characters that are invalid in file names).
• target_file - Target region BED file path. The target region is used to determine where indel realignment and variant calling are done.
• adapter1_p5 - Read 1 adapter sequence (Illumina standard is AGATCGGAAGAGCACACGTCTGAACTCCAGTCA).
• adapter2_p7 - Read 2 adapter sequence (Illumina standard is AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT).
• type - Processing system type: WGS, WES, Panel, Panel Haloplex, Panel MIPs or RNA.
• shotgun - true for randomly-fragmented reads, false for amplicon-based reads.
• umi_type - Unique molecular identifier type: n/a, HaloPlex HS, SureSelect HS, ThruPLEX, Safe-SeqS or MIPs.
• build - Only GRCh38 is supported.

Notes for the RNA analysis pipeline:

• target_file - Target region is only used for mapping quality control.
• build - Basename of the genome build. FASTA, STAR index and GTF annotation have to be present.

Examples

Example processing system INI files are provided here:

• WES: Agilent SureSelectXT Human All Exon V7
• WGS: Illumina TruSeq DNA PCR-Free (for WGS you can use this generic WGS target region independent of the kit)
• lrGS: ONT Amplicon by Ligation ONT SQK-LSK114

Note: For WES and WGS you need to adapt the paths to the target region before using these examples!

back to the start page