diff --git a/.dockerignore b/.dockerignore
index eb47a50..3eb8fac 100644
--- a/.dockerignore
+++ b/.dockerignore
@@ -1,7 +1,10 @@
-.appends
-.git
-.github
-.gitignore
+.git/
+.appends/
+.github/
 .gitattributes
-.dockerignore
+.gitignore
 Dockerfile
+bin/run-in-docker.sh
+bin/run-tests-in-docker.sh
+bin/run-tests.sh
+tests/
diff --git a/.gitattributes b/.gitattributes
new file mode 100644
index 0000000..f913764
--- /dev/null
+++ b/.gitattributes
@@ -0,0 +1,31 @@
+# Scripts
+*.bash     text eol=lf
+*.fish     text eol=lf
+*.sh       text eol=lf
+# These are explicitly windows files and should use crlf
+*.bat      text eol=crlf
+*.cmd      text eol=crlf
+*.ps1      text eol=crlf
+
+# Serialisation
+*.json     text
+
+# Text files where line endings should be preserved
+*.patch    -text
+
+# Docker
+Dockerfile        text
+
+# Documentation
+*.markdown        text
+*.md              text
+*.txt             text
+LICENSE           text
+*README*          text
+
+#
+# Exclude files from exporting
+#
+
+.gitattributes export-ignore
+.gitignore     export-ignore
diff --git a/Dockerfile b/Dockerfile
index 2cd6e90..2b3e5bc 100644
--- a/Dockerfile
+++ b/Dockerfile
@@ -1,8 +1,22 @@
 FROM debian:stable-slim
-RUN apt-get update && apt-get install -y wget
-RUN wget https://www.jsoftware.com/download/j901/install/j901_linux64.tar.gz && \
-      tar -xvf j901_linux64.tar.gz && \
-      mv j901 /opt/j901
+
+# install packages required to run the tests
+RUN apt-get update \
+      && apt-get install -y --no-install-recommends \
+            wget \
+            jq \
+            coreutils \
+            moreutils \
+            ca-certificates \
+      && apt-get clean \
+      && rm -rf /var/lib/apt/lists/*
+
+RUN wget https://www.jsoftware.com/download/j901/install/j901_linux64.tar.gz \
+      && tar -xvf j901_linux64.tar.gz \
+      && mv j901 /opt/j901 \
+      && apt-get -y --purge remove wget ca-certificates \
+      && rm -rf j901_linux64.tar.gz
+
 RUN /opt/j901/bin/jconsole -js \
       "load'pacman'" \
       "'update'jpkg''" \
@@ -11,5 +25,6 @@ RUN /opt/j901/bin/jconsole -js \
       "exit 0"
 
 RUN mkdir /opt/test-runner
-COPY . /opt/test-runner
 WORKDIR /opt/test-runner
+COPY . .
+ENTRYPOINT ["/opt/test-runner/bin/run.sh"]
diff --git a/README b/README
deleted file mode 100644
index 384c830..0000000
--- a/README
+++ /dev/null
@@ -1,4 +0,0 @@
-# -*- mode: org -*-
-
-* J Test Runner
-
diff --git a/README.md b/README.md
new file mode 100644
index 0000000..6b5097b
--- /dev/null
+++ b/README.md
@@ -0,0 +1,51 @@
+# Exercism J Test Runner
+
+The Docker image to automatically run tests on J solutions submitted to [Exercism].
+
+## Run the test runner
+
+To run the tests of an arbitrary exercise, do the following:
+
+1. Open a terminal in the project's root
+2. Run `./bin/run.sh <exercise-slug> <solution-dir> <output-dir>`
+
+Once the test runner has finished, its results will be written to `<output-dir>/results.json`.
+
+## Run the test runner on an exercise using Docker
+
+_This script is provided for testing purposes, as it mimics how test runners run in Exercism's production environment._
+
+To run the tests of an arbitrary exercise using the Docker image, do the following:
+
+1. Open a terminal in the project's root
+2. Run `./bin/run-in-docker.sh <exercise-slug> <solution-dir> <output-dir>`
+
+Once the test runner has finished, its results will be written to `<output-dir>/results.json`.
+
+## Run the tests
+
+To run the tests to verify the behavior of the test runner, do the following:
+
+1. Open a terminal in the project's root
+2. Run `./bin/run-tests.sh`
+
+These are [golden tests][golden] that compare the `results.json` generated by running the current state of the code against the "known good" `tests/<test-name>/results.json`. All files created during the test run itself are discarded.
+
+When you've made modifications to the code that will result in a new "golden" state, you'll need to generate and commit a new `tests/<test-name>/results.json` file.
+
+## Run the tests using Docker
+
+_This script is provided for testing purposes, as it mimics how test runners run in Exercism's production environment._
+
+To run the tests to verify the behavior of the test runner using the Docker image, do the following:
+
+1. Open a terminal in the project's root
+2. Run `./bin/run-tests-in-docker.sh`
+
+These are [golden tests][golden] that compare the `results.json` generated by running the current state of the code against the "known good" `tests/<test-name>/results.json`. All files created during the test run itself are discarded.
+
+When you've made modifications to the code that will result in a new "golden" state, you'll need to generate and commit a new `tests/<test-name>/results.json` file.
+
+[test-runners]: https://github.com/exercism/docs/tree/main/building/tooling/test-runners
+[golden]: https://ro-che.info/articles/2017-12-04-golden-tests
+[exercism]: https://exercism.io
diff --git a/bin/run-in-docker.sh b/bin/run-in-docker.sh
new file mode 100755
index 0000000..8eab863
--- /dev/null
+++ b/bin/run-in-docker.sh
@@ -0,0 +1,46 @@
+#!/usr/bin/env sh
+
+# Synopsis:
+# Run the test runner on a solution using the test runner Docker image.
+# The test runner Docker image is built automatically.
+
+# Arguments:
+# $1: exercise slug
+# $2: path to solution folder
+# $3: path to output directory
+
+# Output:
+# Writes the test results to a results.json file in the passed-in output directory.
+# The test results are formatted according to the specifications at https://github.com/exercism/docs/blob/main/building/tooling/test-runners/interface.md
+
+# Example:
+# ./bin/run-in-docker.sh two-fer path/to/solution/folder/ path/to/output/directory/
+
+# Stop executing when a command returns a non-zero return code
+set -e
+
+# If any required arguments is missing, print the usage and exit
+if [ -z "$1" ] || [ -z "$2" ] || [ -z "$3" ]; then
+    echo "usage: ./bin/run-in-docker.sh exercise-slug path/to/solution/folder/ path/to/output/directory/"
+    exit 1
+fi
+
+slug="$1"
+solution_dir=$(realpath "${2%/}")
+output_dir=$(realpath "${3%/}")
+
+# Create the output directory if it doesn't exist
+mkdir -p "${output_dir}"
+
+# Build the Docker image
+docker build --rm -t exercism/j-test-runner .
+
+# Run the Docker image using the settings mimicking the production environment
+docker run \
+    --rm \
+    --network none \
+    --read-only \
+    --mount type=bind,src="${solution_dir}",dst=/solution \
+    --mount type=bind,src="${output_dir}",dst=/output \
+    --mount type=tmpfs,dst=/tmp \
+    exercism/j-test-runner "${slug}" /solution /output 
diff --git a/bin/run-tests-in-docker.sh b/bin/run-tests-in-docker.sh
new file mode 100755
index 0000000..47780c3
--- /dev/null
+++ b/bin/run-tests-in-docker.sh
@@ -0,0 +1,31 @@
+#!/usr/bin/env sh
+
+# Synopsis:
+# Test the test runner Docker image by running it against a predefined set of 
+# solutions with an expected output.
+# The test runner Docker image is built automatically.
+
+# Output:
+# Outputs the diff of the expected test results against the actual test results
+# generated by the test runner Docker image.
+
+# Example:
+# ./bin/run-tests-in-docker.sh
+
+# Stop executing when a command returns a non-zero return code
+set -e
+
+# Build the Docker image
+docker build --rm -t exercism/j-test-runner .
+
+# Run the Docker image using the settings mimicking the production environment
+docker run \
+    --rm \
+    --network none \
+    --read-only \
+    --mount type=bind,src="${PWD}/tests",dst=/opt/test-runner/tests \
+    --mount type=tmpfs,dst=/tmp \
+    --volume "${PWD}/bin/run-tests.sh:/opt/test-runner/bin/run-tests.sh" \
+    --workdir /opt/test-runner \
+    --entrypoint /opt/test-runner/bin/run-tests.sh \
+    exercism/j-test-runner
diff --git a/bin/run-tests.sh b/bin/run-tests.sh
new file mode 100755
index 0000000..c7f0267
--- /dev/null
+++ b/bin/run-tests.sh
@@ -0,0 +1,37 @@
+#!/usr/bin/env sh
+
+# Synopsis:
+# Test the test runner by running it against a predefined set of solutions 
+# with an expected output.
+
+# Output:
+# Outputs the diff of the expected test results against the actual test results
+# generated by the test runner.
+
+# Example:
+# ./bin/run-tests.sh
+
+exit_code=0
+
+# Iterate over all test directories
+for test_dir in tests/*; do
+    test_dir_name=$(basename "${test_dir}")
+    test_dir_path=$(realpath "${test_dir}")
+
+    bin/run.sh "${test_dir_name}" "${test_dir_path}/" "${test_dir_path}/"
+
+    # OPTIONAL: Normalize the results file
+    # If the results.json file contains information that changes between 
+    # different test runs (e.g. timing information or paths), you should normalize
+    # the results file to allow the diff comparison below to work as expected
+
+    file="results.json"
+    expected_file="expected_${file}"
+    echo "${test_dir_name}: comparing ${file} to ${expected_file}"
+
+    if ! diff "${test_dir_path}/${file}" "${test_dir_path}/${expected_file}"; then
+        exit_code=1
+    fi
+done
+
+exit ${exit_code}
diff --git a/bin/run.ijs b/bin/run.ijs
index b37435f..3005804 100755
--- a/bin/run.ijs
+++ b/bin/run.ijs
@@ -1,30 +1,46 @@
-#!/opt/j901/bin/jconsole
+#! /opt/j901/bin/jconsole
 
 require'convert/json general/unittest'
 
 NB. todo: explore using 9!:24'' NB. security level. prevent student
 NB. solutions from running certain i/o ops
-success=: (;:'status name message'),:'pass';({.,{:)@:;:@:,@:>
-failure=: (;:'status name message'),:'fail';([:>[:{.[:;:0&{::);(8}.2&{::)
-report=: failure`success@.(1=#)
-status=: (;:'fail pass') {~ [: *./ ('pass'-:1 0&{::)S:1
+success=: (;:'status name message') ,: 'pass' ; ({.,{:)@:;:@:,@:>
+failure=: (;:'status name message test_code') ,: 'fail' ; ([: > [: {. [: ;: 0&{::) ; (1&{::) ; (8 }. 2&{::)
+report=:  failure`success@.(1=#)
+status=:  (;:'fail pass') {~ [: *./ ('pass'-:1 0&{::)S:1
+version=: <3
 
 main=: monad define
-'slug indir outdir'=. _3{.ARGV NB. name args to vars and record cd
-1!:44 indir NB. cd to indir
-result=. }.}:<;._2 unittest indir,'test.ijs' NB. run tests
-if. (1<#result) do.
-  if. 'Suite Error:'-:1{::result do. NB. error running test suite
-    output=. enc_json |: ('error';(13!:12'')) ,.~ ;:'status message'
-    output 1!:2 < outdir,'results.json'
-    exit 1
-  end.
-end. NB. else report pass/fail
-output=. <"_1 (report;.1~[:-.[:>('|'={.)&.>) result NB. report per test
-output=. (<,~status) output NB. add status and message
-output=. enc_json |: output ,.~ ;:'status tests' NB. encode json
-output 1!:2 < outdir,'results.json'
-exit 0
+  'slug indir outdir'=. _3{.ARGV NB. name args to vars and record cd
+  indir=. jpathsep indir 
+  outdir=. jpathsep outdir
+  1!:44 indir NB. cd to indir
+  result=. }. }: <;._2 unittest indir,'test.ijs' NB. run tests
+
+  if. (1<#result) do.
+    if. 'Suite Error:'-:1{::result do. NB. error running test suite
+      'message_part err_path'=. (({.,:jpathsep@}.)~ >:@(i:&' ')) 13!:12'' NB. Get the path of the script where the error occured
+      'i_path err_path'=. indir ,: err_path NB. fill indir to conform shapes
+      relative_path=. (-. i_path = err_path) # err_path
+      error_message=. (dltbs message_part), ' ', relative_path
+      output=. enc_json |: (version, 'error' ; error_message) ,.~ ;:'version status message'
+      output 1!:2 < outdir,'/results.json'
+      exit 1
+    end.
+  end. NB. else report pass/fail
+
+  'order tasks'=. |: > cutopen each cutopen 1!:1 < jpath '~temp/helper.txt' NB. get ordering and tasks numbers from temporary helper file
+  1!:55 < jpath '~user/temp/helper.txt' NB. deletes helper file
+  tasks=. |: ,: ,. (<'task_id') ,: <"0 tasks NB. tasks has shape 4 2 1 in order to simplify the merge
+
+
+  output=. (report;.1~ [: -. ('|'={.)@>) result NB. report per test
+  output=. <"_1 output ,."2 tasks NB. Add tasks info
+  output=. (/: order) { (-.&a:"1)each output NB. Remove fill boxes and order
+  output=. (;:'version status tests') ,. version , (status,<) output NB. add version, status, and message
+  output=. enc_json |: output
+  output 1!:2 < outdir,'/results.json'
+  exit 0
 )
 
-main''
\ No newline at end of file
+main'' 
\ No newline at end of file
diff --git a/bin/run.sh b/bin/run.sh
index 342dcfa..dd3cf78 100755
--- a/bin/run.sh
+++ b/bin/run.sh
@@ -1,3 +1,40 @@
 #!/usr/bin/env sh
 
-./bin/run.ijs $1 $2 $3
+# Synopsis:
+# Run the test runner on a solution.
+
+# Arguments:
+# $1: exercise slug
+# $2: path to solution folder
+# $3: path to output directory
+
+# Output:
+# Writes the test results to a results.json file in the passed-in output directory.
+# The test results are formatted according to the specifications at https://github.com/exercism/docs/blob/main/building/tooling/test-runners/interface.md
+
+# Example:
+# ./bin/run.sh two-fer path/to/solution/folder/ path/to/output/directory/
+
+# If any required arguments is missing, print the usage and exit
+if [ -z "$1" ] || [ -z "$2" ] || [ -z "$3" ]; then
+    echo "usage: ./bin/run.sh exercise-slug path/to/solution/folder/ path/to/output/directory/"
+    exit 1
+fi
+
+slug="$1"
+solution_dir=$(realpath "$2")
+output_dir=$(realpath "$3")
+results_file="${output_dir}/results.json"
+
+# Create the output directory if it doesn't exist
+mkdir -p "${output_dir}"
+
+echo "${slug}: testing..."
+
+# Run the tests for the provided implementation file and redirect stdout and
+# stderr to capture it
+test_output=$(/opt/j901/bin/jconsole bin/run.ijs "$slug" "$solution_dir/" "$output_dir/")
+
+jq . ${results_file} | sponge ${results_file}
+
+echo "${slug}: done"
diff --git a/test/nc-error/nucleotide-count.ijs b/test/nc-error/nucleotide-count.ijs
deleted file mode 100644
index a1dd6de..0000000
--- a/test/nc-error/nucleotide-count.ijs
+++ /dev/null
@@ -1 +0,0 @@
-nuc_cnt=: 'syntax error
\ No newline at end of file
diff --git a/test/nc-error/test.ijs b/test/nc-error/test.ijs
deleted file mode 100644
index b988a61..0000000
--- a/test/nc-error/test.ijs
+++ /dev/null
@@ -1,19 +0,0 @@
-load'nucleotide-count.ijs'
-
-test_nuc_cnt1=: monad define
-assert 0 0 0 0-:nuc_cnt''
-)
-
-test_nuc_cnt2=: monad define
-assert 0 0 1 0-:nuc_cnt 1$'G'
-)
-
-test_nuc_cnt3=: monad define
-assert 0 0 7 0-:nuc_cnt'GGGGGGG'
-)
-
-test_nuc_cnt4=: monad define
-assert 20 12 17 21-:nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
-)
-
-REP=: nuc_cnt f.
\ No newline at end of file
diff --git a/test/nc-fail/test.ijs b/test/nc-fail/test.ijs
deleted file mode 100644
index b988a61..0000000
--- a/test/nc-fail/test.ijs
+++ /dev/null
@@ -1,19 +0,0 @@
-load'nucleotide-count.ijs'
-
-test_nuc_cnt1=: monad define
-assert 0 0 0 0-:nuc_cnt''
-)
-
-test_nuc_cnt2=: monad define
-assert 0 0 1 0-:nuc_cnt 1$'G'
-)
-
-test_nuc_cnt3=: monad define
-assert 0 0 7 0-:nuc_cnt'GGGGGGG'
-)
-
-test_nuc_cnt4=: monad define
-assert 20 12 17 21-:nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
-)
-
-REP=: nuc_cnt f.
\ No newline at end of file
diff --git a/test/nc-output/nc-fail/nucleotide-count.ijs b/test/nc-output/nc-fail/nucleotide-count.ijs
deleted file mode 100644
index d3b324c..0000000
--- a/test/nc-output/nc-fail/nucleotide-count.ijs
+++ /dev/null
@@ -1 +0,0 @@
-nuc_cnt=: 0:
\ No newline at end of file
diff --git a/test/nc-output/nc-fail/test.ijs b/test/nc-output/nc-fail/test.ijs
deleted file mode 100644
index b988a61..0000000
--- a/test/nc-output/nc-fail/test.ijs
+++ /dev/null
@@ -1,19 +0,0 @@
-load'nucleotide-count.ijs'
-
-test_nuc_cnt1=: monad define
-assert 0 0 0 0-:nuc_cnt''
-)
-
-test_nuc_cnt2=: monad define
-assert 0 0 1 0-:nuc_cnt 1$'G'
-)
-
-test_nuc_cnt3=: monad define
-assert 0 0 7 0-:nuc_cnt'GGGGGGG'
-)
-
-test_nuc_cnt4=: monad define
-assert 20 12 17 21-:nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
-)
-
-REP=: nuc_cnt f.
\ No newline at end of file
diff --git a/test/nc-output/nucleotide-count.ijs b/test/nc-output/nucleotide-count.ijs
deleted file mode 100644
index a01c1f3..0000000
--- a/test/nc-output/nucleotide-count.ijs
+++ /dev/null
@@ -1,4 +0,0 @@
-nuc_cnt=: monad define
-echo 'help!'
-+/y=/'ACGT'
-)
\ No newline at end of file
diff --git a/test/nc-output/test.ijs b/test/nc-output/test.ijs
deleted file mode 100644
index b988a61..0000000
--- a/test/nc-output/test.ijs
+++ /dev/null
@@ -1,19 +0,0 @@
-load'nucleotide-count.ijs'
-
-test_nuc_cnt1=: monad define
-assert 0 0 0 0-:nuc_cnt''
-)
-
-test_nuc_cnt2=: monad define
-assert 0 0 1 0-:nuc_cnt 1$'G'
-)
-
-test_nuc_cnt3=: monad define
-assert 0 0 7 0-:nuc_cnt'GGGGGGG'
-)
-
-test_nuc_cnt4=: monad define
-assert 20 12 17 21-:nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
-)
-
-REP=: nuc_cnt f.
\ No newline at end of file
diff --git a/test/nc-pass/test.ijs b/test/nc-pass/test.ijs
deleted file mode 100644
index b988a61..0000000
--- a/test/nc-pass/test.ijs
+++ /dev/null
@@ -1,19 +0,0 @@
-load'nucleotide-count.ijs'
-
-test_nuc_cnt1=: monad define
-assert 0 0 0 0-:nuc_cnt''
-)
-
-test_nuc_cnt2=: monad define
-assert 0 0 1 0-:nuc_cnt 1$'G'
-)
-
-test_nuc_cnt3=: monad define
-assert 0 0 7 0-:nuc_cnt'GGGGGGG'
-)
-
-test_nuc_cnt4=: monad define
-assert 20 12 17 21-:nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
-)
-
-REP=: nuc_cnt f.
\ No newline at end of file
diff --git a/test/nc-error/.meta/version b/tests/all-fail/.meta/version
similarity index 100%
rename from test/nc-error/.meta/version
rename to tests/all-fail/.meta/version
diff --git a/test/nc-error/example.ijs b/tests/all-fail/example.ijs
similarity index 100%
rename from test/nc-error/example.ijs
rename to tests/all-fail/example.ijs
diff --git a/tests/all-fail/expected_results.json b/tests/all-fail/expected_results.json
new file mode 100644
index 0000000..7dbe9e6
--- /dev/null
+++ b/tests/all-fail/expected_results.json
@@ -0,0 +1,34 @@
+{
+  "version": 3,
+  "status": "fail",
+  "tests": [
+    {
+      "status": "fail",
+      "name": "nuc_cnt1",
+      "message": "|assertion failure: assert",
+      "test_code": "assert 0 0 0 0-:nuc_cnt''",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt2",
+      "message": "|assertion failure: assert",
+      "test_code": "assert 0 0 1 0-:nuc_cnt 1$'G'",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt3",
+      "message": "|assertion failure: assert",
+      "test_code": "assert 0 0 7 0-:nuc_cnt'GGGGGGG'",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt4",
+      "message": "|assertion failure: assert",
+      "test_code": "assert 20 12 17 21-:nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'",
+      "task_id": "1"
+    }
+  ]
+}
diff --git a/test/nc-fail/nucleotide-count.ijs b/tests/all-fail/nucleotide-count.ijs
similarity index 100%
rename from test/nc-fail/nucleotide-count.ijs
rename to tests/all-fail/nucleotide-count.ijs
diff --git a/tests/all-fail/results.json b/tests/all-fail/results.json
new file mode 100644
index 0000000..7dbe9e6
--- /dev/null
+++ b/tests/all-fail/results.json
@@ -0,0 +1,34 @@
+{
+  "version": 3,
+  "status": "fail",
+  "tests": [
+    {
+      "status": "fail",
+      "name": "nuc_cnt1",
+      "message": "|assertion failure: assert",
+      "test_code": "assert 0 0 0 0-:nuc_cnt''",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt2",
+      "message": "|assertion failure: assert",
+      "test_code": "assert 0 0 1 0-:nuc_cnt 1$'G'",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt3",
+      "message": "|assertion failure: assert",
+      "test_code": "assert 0 0 7 0-:nuc_cnt'GGGGGGG'",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt4",
+      "message": "|assertion failure: assert",
+      "test_code": "assert 20 12 17 21-:nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'",
+      "task_id": "1"
+    }
+  ]
+}
diff --git a/tests/all-fail/test.ijs b/tests/all-fail/test.ijs
new file mode 100644
index 0000000..dd8ff8f
--- /dev/null
+++ b/tests/all-fail/test.ijs
@@ -0,0 +1,42 @@
+load 'nucleotide-count.ijs'
+
+
+temppath=: < jpath '~temp/helper.txt'
+
+
+before_all =: monad define  
+  order=: i.0
+  tasks=: i.0
+)
+
+after_all =: monad define
+  (, LF ,~"1 ":order ,. tasks) 1!:2 temppath
+)
+
+nuc_cnt1_ignore=:0
+test_nuc_cnt1=: monad define
+  order=:order , 1
+  tasks=:tasks , 1
+  assert 0 0 0 0-:nuc_cnt''
+)
+
+nuc_cnt2_ignore=:0
+test_nuc_cnt2=: monad define
+  order=:order , 2
+  tasks=:tasks , 1
+  assert 0 0 1 0-:nuc_cnt 1$'G'
+)
+
+nuc_cnt3_ignore=:0
+test_nuc_cnt3=: monad define
+  order=:order , 3
+  tasks=:tasks , 1
+  assert 0 0 7 0-:nuc_cnt'GGGGGGG'
+)
+
+nuc_cnt4_ignore=:0
+test_nuc_cnt4=: monad define
+  order=:order , 4
+  tasks=:tasks , 1
+  assert 20 12 17 21-:nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
+)
diff --git a/test/nc-fail/.meta/version b/tests/empty-file/.meta/version
similarity index 100%
rename from test/nc-fail/.meta/version
rename to tests/empty-file/.meta/version
diff --git a/test/nc-fail/example.ijs b/tests/empty-file/example.ijs
similarity index 100%
rename from test/nc-fail/example.ijs
rename to tests/empty-file/example.ijs
diff --git a/tests/empty-file/expected_results.json b/tests/empty-file/expected_results.json
new file mode 100644
index 0000000..a3557a1
--- /dev/null
+++ b/tests/empty-file/expected_results.json
@@ -0,0 +1,34 @@
+{
+  "version": 3,
+  "status": "fail",
+  "tests": [
+    {
+      "status": "fail",
+      "name": "nuc_cnt1",
+      "message": "|value error: nuc_cnt",
+      "test_code": "rt 0 0 0 0-:    nuc_cnt''",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt2",
+      "message": "|value error: nuc_cnt",
+      "test_code": "rt 0 0 1 0-:    nuc_cnt 1$'G'",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt3",
+      "message": "|value error: nuc_cnt",
+      "test_code": "rt 0 0 7 0-:    nuc_cnt'GGGGGGG'",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt4",
+      "message": "|value error: nuc_cnt",
+      "test_code": "rt 20 12 17 21-:    nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'",
+      "task_id": "1"
+    }
+  ]
+}
diff --git a/tests/empty-file/nucleotide-count.ijs b/tests/empty-file/nucleotide-count.ijs
new file mode 100644
index 0000000..e69de29
diff --git a/tests/empty-file/results.json b/tests/empty-file/results.json
new file mode 100644
index 0000000..a3557a1
--- /dev/null
+++ b/tests/empty-file/results.json
@@ -0,0 +1,34 @@
+{
+  "version": 3,
+  "status": "fail",
+  "tests": [
+    {
+      "status": "fail",
+      "name": "nuc_cnt1",
+      "message": "|value error: nuc_cnt",
+      "test_code": "rt 0 0 0 0-:    nuc_cnt''",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt2",
+      "message": "|value error: nuc_cnt",
+      "test_code": "rt 0 0 1 0-:    nuc_cnt 1$'G'",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt3",
+      "message": "|value error: nuc_cnt",
+      "test_code": "rt 0 0 7 0-:    nuc_cnt'GGGGGGG'",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt4",
+      "message": "|value error: nuc_cnt",
+      "test_code": "rt 20 12 17 21-:    nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'",
+      "task_id": "1"
+    }
+  ]
+}
diff --git a/tests/empty-file/test.ijs b/tests/empty-file/test.ijs
new file mode 100644
index 0000000..dd8ff8f
--- /dev/null
+++ b/tests/empty-file/test.ijs
@@ -0,0 +1,42 @@
+load 'nucleotide-count.ijs'
+
+
+temppath=: < jpath '~temp/helper.txt'
+
+
+before_all =: monad define  
+  order=: i.0
+  tasks=: i.0
+)
+
+after_all =: monad define
+  (, LF ,~"1 ":order ,. tasks) 1!:2 temppath
+)
+
+nuc_cnt1_ignore=:0
+test_nuc_cnt1=: monad define
+  order=:order , 1
+  tasks=:tasks , 1
+  assert 0 0 0 0-:nuc_cnt''
+)
+
+nuc_cnt2_ignore=:0
+test_nuc_cnt2=: monad define
+  order=:order , 2
+  tasks=:tasks , 1
+  assert 0 0 1 0-:nuc_cnt 1$'G'
+)
+
+nuc_cnt3_ignore=:0
+test_nuc_cnt3=: monad define
+  order=:order , 3
+  tasks=:tasks , 1
+  assert 0 0 7 0-:nuc_cnt'GGGGGGG'
+)
+
+nuc_cnt4_ignore=:0
+test_nuc_cnt4=: monad define
+  order=:order , 4
+  tasks=:tasks , 1
+  assert 20 12 17 21-:nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
+)
diff --git a/tests/multiple-tasks/.docs/instructions.md b/tests/multiple-tasks/.docs/instructions.md
new file mode 100644
index 0000000..c3999e8
--- /dev/null
+++ b/tests/multiple-tasks/.docs/instructions.md
@@ -0,0 +1,17 @@
+# Instructions
+
+Find the difference between the square of the sum and the sum of the squares of the first N natural numbers.
+
+The square of the sum of the first ten natural numbers is
+(1 + 2 + ... + 10)² = 55² = 3025.
+
+The sum of the squares of the first ten natural numbers is
+1² + 2² + ... + 10² = 385.
+
+Hence the difference between the square of the sum of the first
+ten natural numbers and the sum of the squares of the first ten
+natural numbers is 3025 - 385 = 2640.
+
+You are not expected to discover an efficient solution to this yourself from
+first principles; research is allowed, indeed, encouraged. Finding the best
+algorithm for the problem is a key skill in software engineering.
diff --git a/tests/multiple-tasks/.meta/config.json b/tests/multiple-tasks/.meta/config.json
new file mode 100644
index 0000000..f81b5af
--- /dev/null
+++ b/tests/multiple-tasks/.meta/config.json
@@ -0,0 +1,22 @@
+{
+  "blurb": "Find the difference between the square of the sum and the sum of the squares of the first N natural numbers.",
+  "authors": [
+    "jitwit"
+  ],
+  "contributors": [
+    "iHiD"
+  ],
+  "files": {
+    "solution": [
+      "difference-of-squares.ijs"
+    ],
+    "test": [
+      "test.ijs"
+    ],
+    "example": [
+      ".meta/example.ijs"
+    ]
+  },
+  "source": "Problem 6 at Project Euler",
+  "source_url": "http://projecteuler.net/problem=6"
+}
diff --git a/tests/multiple-tasks/.meta/config/auto_approve b/tests/multiple-tasks/.meta/config/auto_approve
new file mode 100644
index 0000000..b1cab17
--- /dev/null
+++ b/tests/multiple-tasks/.meta/config/auto_approve
@@ -0,0 +1 @@
+json_false
diff --git a/tests/multiple-tasks/.meta/config/core b/tests/multiple-tasks/.meta/config/core
new file mode 100644
index 0000000..b1cab17
--- /dev/null
+++ b/tests/multiple-tasks/.meta/config/core
@@ -0,0 +1 @@
+json_false
diff --git a/tests/multiple-tasks/.meta/config/deprecated b/tests/multiple-tasks/.meta/config/deprecated
new file mode 100644
index 0000000..0598f37
--- /dev/null
+++ b/tests/multiple-tasks/.meta/config/deprecated
@@ -0,0 +1 @@
+json_true
diff --git a/tests/multiple-tasks/.meta/config/unlocked_by b/tests/multiple-tasks/.meta/config/unlocked_by
new file mode 100644
index 0000000..48cc97d
--- /dev/null
+++ b/tests/multiple-tasks/.meta/config/unlocked_by
@@ -0,0 +1 @@
+json_null
diff --git a/tests/multiple-tasks/.meta/config/uuid b/tests/multiple-tasks/.meta/config/uuid
new file mode 100644
index 0000000..760a900
--- /dev/null
+++ b/tests/multiple-tasks/.meta/config/uuid
@@ -0,0 +1 @@
+4cc22c3d-766e-4593-96fe-2e26e06682b8
diff --git a/tests/multiple-tasks/.meta/config/version b/tests/multiple-tasks/.meta/config/version
new file mode 100644
index 0000000..867e524
--- /dev/null
+++ b/tests/multiple-tasks/.meta/config/version
@@ -0,0 +1 @@
+1.2.0
\ No newline at end of file
diff --git a/tests/multiple-tasks/.meta/example.ijs b/tests/multiple-tasks/.meta/example.ijs
new file mode 100644
index 0000000..8de48da
--- /dev/null
+++ b/tests/multiple-tasks/.meta/example.ijs
@@ -0,0 +1,3 @@
+square_of_sum=: [: *: +/ @ i. @ >:
+sum_of_square=: [: +/ *: @ i. @ >:
+difference_of_squares =: square_of_sum - sum_of_square
\ No newline at end of file
diff --git a/tests/multiple-tasks/difference-of-squares.ijs b/tests/multiple-tasks/difference-of-squares.ijs
new file mode 100644
index 0000000..8de48da
--- /dev/null
+++ b/tests/multiple-tasks/difference-of-squares.ijs
@@ -0,0 +1,3 @@
+square_of_sum=: [: *: +/ @ i. @ >:
+sum_of_square=: [: +/ *: @ i. @ >:
+difference_of_squares =: square_of_sum - sum_of_square
\ No newline at end of file
diff --git a/tests/multiple-tasks/expected_results.json b/tests/multiple-tasks/expected_results.json
new file mode 100644
index 0000000..94e2e32
--- /dev/null
+++ b/tests/multiple-tasks/expected_results.json
@@ -0,0 +1,54 @@
+{
+  "version": 3,
+  "status": "pass",
+  "tests": [
+    {
+      "status": "pass",
+      "name": "square_of_sum_1",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "square_of_sum_5",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "square_of_sum_100",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "sum_of_square_5",
+      "message": "OK",
+      "task_id": "2"
+    },
+    {
+      "status": "pass",
+      "name": "sum_of_square_100",
+      "message": "OK",
+      "task_id": "2"
+    },
+    {
+      "status": "pass",
+      "name": "difference_of_squares_0",
+      "message": "OK",
+      "task_id": "3"
+    },
+    {
+      "status": "pass",
+      "name": "difference_of_squares_5",
+      "message": "OK",
+      "task_id": "3"
+    },
+    {
+      "status": "pass",
+      "name": "difference_of_squares_100",
+      "message": "OK",
+      "task_id": "3"
+    }
+  ]
+}
diff --git a/tests/multiple-tasks/results.json b/tests/multiple-tasks/results.json
new file mode 100644
index 0000000..94e2e32
--- /dev/null
+++ b/tests/multiple-tasks/results.json
@@ -0,0 +1,54 @@
+{
+  "version": 3,
+  "status": "pass",
+  "tests": [
+    {
+      "status": "pass",
+      "name": "square_of_sum_1",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "square_of_sum_5",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "square_of_sum_100",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "sum_of_square_5",
+      "message": "OK",
+      "task_id": "2"
+    },
+    {
+      "status": "pass",
+      "name": "sum_of_square_100",
+      "message": "OK",
+      "task_id": "2"
+    },
+    {
+      "status": "pass",
+      "name": "difference_of_squares_0",
+      "message": "OK",
+      "task_id": "3"
+    },
+    {
+      "status": "pass",
+      "name": "difference_of_squares_5",
+      "message": "OK",
+      "task_id": "3"
+    },
+    {
+      "status": "pass",
+      "name": "difference_of_squares_100",
+      "message": "OK",
+      "task_id": "3"
+    }
+  ]
+}
diff --git a/tests/multiple-tasks/test.ijs b/tests/multiple-tasks/test.ijs
new file mode 100644
index 0000000..4357a77
--- /dev/null
+++ b/tests/multiple-tasks/test.ijs
@@ -0,0 +1,61 @@
+load 'difference-of-squares.ijs'
+
+
+temppath=: < jpath '~temp/helper.txt'
+
+before_all =: monad define  
+  order=: i.0
+  tasks=: i.0
+)
+
+after_all =: monad define
+  (, LF ,~"1 ":order ,. tasks) 1!:2 temppath
+)
+
+test_square_of_sum_1 =: monad define
+  order=:order , 1
+  tasks=:tasks , 1
+  assert 1 = square_of_sum 1
+)
+
+test_square_of_sum_5 =: monad define
+  order=:order , 2
+  tasks=:tasks , 1
+  assert 225 = square_of_sum 5
+)
+
+test_square_of_sum_100 =: monad define
+  order=:order , 3
+  tasks=:tasks , 1
+  assert 25502500 = square_of_sum 100
+)
+
+test_sum_of_square_5 =: monad define
+  order=:order , 4
+  tasks=:tasks , 2
+  assert 55 = sum_of_square 5
+)
+
+test_sum_of_square_100 =: monad define
+  order=:order , 5
+  tasks=:tasks , 2
+  assert 338350 = sum_of_square 100
+)
+
+test_difference_of_squares_0 =: monad define
+  order=:order , 6
+  tasks=:tasks , 3
+  assert 0 = difference_of_squares 0
+)
+
+test_difference_of_squares_5 =: monad define
+  order=:order , 7
+  tasks=:tasks , 3
+  assert 170 = difference_of_squares 5
+)
+
+test_difference_of_squares_100 =: monad define
+  order=:order , 8
+  tasks=:tasks , 3
+  assert 25164150 = difference_of_squares 100
+)
diff --git a/test/nc-output/.meta/version b/tests/partial-fail/.meta/version
similarity index 100%
rename from test/nc-output/.meta/version
rename to tests/partial-fail/.meta/version
diff --git a/test/nc-output/example.ijs b/tests/partial-fail/example.ijs
similarity index 100%
rename from test/nc-output/example.ijs
rename to tests/partial-fail/example.ijs
diff --git a/tests/partial-fail/expected_results.json b/tests/partial-fail/expected_results.json
new file mode 100644
index 0000000..d1a0ab8
--- /dev/null
+++ b/tests/partial-fail/expected_results.json
@@ -0,0 +1,31 @@
+{
+  "version": 3,
+  "status": "fail",
+  "tests": [
+    {
+      "status": "pass",
+      "name": "nuc_cnt1",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt2",
+      "message": "|assertion failure: assert",
+      "test_code": "assert 0 0 1 0-:1,nuc_cnt 1$'G'",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "nuc_cnt3",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "nuc_cnt4",
+      "message": "OK",
+      "task_id": "1"
+    }
+  ]
+}
diff --git a/test/nc-pass/nucleotide-count.ijs b/tests/partial-fail/nucleotide-count.ijs
similarity index 100%
rename from test/nc-pass/nucleotide-count.ijs
rename to tests/partial-fail/nucleotide-count.ijs
diff --git a/tests/partial-fail/results.json b/tests/partial-fail/results.json
new file mode 100644
index 0000000..d1a0ab8
--- /dev/null
+++ b/tests/partial-fail/results.json
@@ -0,0 +1,31 @@
+{
+  "version": 3,
+  "status": "fail",
+  "tests": [
+    {
+      "status": "pass",
+      "name": "nuc_cnt1",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "fail",
+      "name": "nuc_cnt2",
+      "message": "|assertion failure: assert",
+      "test_code": "assert 0 0 1 0-:1,nuc_cnt 1$'G'",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "nuc_cnt3",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "nuc_cnt4",
+      "message": "OK",
+      "task_id": "1"
+    }
+  ]
+}
diff --git a/tests/partial-fail/test.ijs b/tests/partial-fail/test.ijs
new file mode 100644
index 0000000..8ed4904
--- /dev/null
+++ b/tests/partial-fail/test.ijs
@@ -0,0 +1,42 @@
+load 'nucleotide-count.ijs'
+
+
+temppath=: < jpath '~temp/helper.txt'
+
+
+before_all =: monad define  
+  order=: i.0
+  tasks=: i.0
+)
+
+after_all =: monad define
+  (, LF ,~"1 ":order ,. tasks) 1!:2 temppath
+)
+
+nuc_cnt1_ignore=:0
+test_nuc_cnt1=: monad define
+  order=:order , 1
+  tasks=:tasks , 1
+  assert 0 0 0 0-:nuc_cnt''
+)
+
+nuc_cnt2_ignore=:0
+test_nuc_cnt2=: monad define
+  order=:order , 2
+  tasks=:tasks , 1
+  assert 0 0 1 0-: 1 , nuc_cnt 1$'G' NB. This test should fail
+)
+
+nuc_cnt3_ignore=:0
+test_nuc_cnt3=: monad define
+  order=:order , 3
+  tasks=:tasks , 1
+  assert 0 0 7 0-:nuc_cnt'GGGGGGG'
+)
+
+nuc_cnt4_ignore=:0
+test_nuc_cnt4=: monad define
+  order=:order , 4
+  tasks=:tasks , 1
+  assert 20 12 17 21-:nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
+)
diff --git a/test/nc-output/nc-fail/.meta/version b/tests/success/.meta/version
similarity index 100%
rename from test/nc-output/nc-fail/.meta/version
rename to tests/success/.meta/version
diff --git a/test/nc-output/nc-fail/example.ijs b/tests/success/example.ijs
similarity index 100%
rename from test/nc-output/nc-fail/example.ijs
rename to tests/success/example.ijs
diff --git a/tests/success/expected_results.json b/tests/success/expected_results.json
new file mode 100644
index 0000000..dcd688d
--- /dev/null
+++ b/tests/success/expected_results.json
@@ -0,0 +1,30 @@
+{
+  "version": 3,
+  "status": "pass",
+  "tests": [
+    {
+      "status": "pass",
+      "name": "nuc_cnt1",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "nuc_cnt2",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "nuc_cnt3",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "nuc_cnt4",
+      "message": "OK",
+      "task_id": "1"
+    }
+  ]
+}
diff --git a/test/nc-pass/example.ijs b/tests/success/nucleotide-count.ijs
similarity index 100%
rename from test/nc-pass/example.ijs
rename to tests/success/nucleotide-count.ijs
diff --git a/tests/success/results.json b/tests/success/results.json
new file mode 100644
index 0000000..dcd688d
--- /dev/null
+++ b/tests/success/results.json
@@ -0,0 +1,30 @@
+{
+  "version": 3,
+  "status": "pass",
+  "tests": [
+    {
+      "status": "pass",
+      "name": "nuc_cnt1",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "nuc_cnt2",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "nuc_cnt3",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "nuc_cnt4",
+      "message": "OK",
+      "task_id": "1"
+    }
+  ]
+}
diff --git a/tests/success/test.ijs b/tests/success/test.ijs
new file mode 100644
index 0000000..dd8ff8f
--- /dev/null
+++ b/tests/success/test.ijs
@@ -0,0 +1,42 @@
+load 'nucleotide-count.ijs'
+
+
+temppath=: < jpath '~temp/helper.txt'
+
+
+before_all =: monad define  
+  order=: i.0
+  tasks=: i.0
+)
+
+after_all =: monad define
+  (, LF ,~"1 ":order ,. tasks) 1!:2 temppath
+)
+
+nuc_cnt1_ignore=:0
+test_nuc_cnt1=: monad define
+  order=:order , 1
+  tasks=:tasks , 1
+  assert 0 0 0 0-:nuc_cnt''
+)
+
+nuc_cnt2_ignore=:0
+test_nuc_cnt2=: monad define
+  order=:order , 2
+  tasks=:tasks , 1
+  assert 0 0 1 0-:nuc_cnt 1$'G'
+)
+
+nuc_cnt3_ignore=:0
+test_nuc_cnt3=: monad define
+  order=:order , 3
+  tasks=:tasks , 1
+  assert 0 0 7 0-:nuc_cnt'GGGGGGG'
+)
+
+nuc_cnt4_ignore=:0
+test_nuc_cnt4=: monad define
+  order=:order , 4
+  tasks=:tasks , 1
+  assert 20 12 17 21-:nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
+)
diff --git a/test/nc-pass/.meta/version b/tests/syntax-error/.meta/version
similarity index 100%
rename from test/nc-pass/.meta/version
rename to tests/syntax-error/.meta/version
diff --git a/tests/syntax-error/example.ijs b/tests/syntax-error/example.ijs
new file mode 100644
index 0000000..cc78be6
--- /dev/null
+++ b/tests/syntax-error/example.ijs
@@ -0,0 +1 @@
+nuc_cnt=: [: +/ =/&'ACGT'
\ No newline at end of file
diff --git a/tests/syntax-error/expected_results.json b/tests/syntax-error/expected_results.json
new file mode 100644
index 0000000..c1eef58
--- /dev/null
+++ b/tests/syntax-error/expected_results.json
@@ -0,0 +1,5 @@
+{
+  "version": 3,
+  "status": "error",
+  "message": "|syntax error: script\n|   nuc_cnt=:    ''<\n|[-0] nucleotide-count.ijs\n"
+}
diff --git a/tests/syntax-error/nucleotide-count.ijs b/tests/syntax-error/nucleotide-count.ijs
new file mode 100644
index 0000000..2394789
--- /dev/null
+++ b/tests/syntax-error/nucleotide-count.ijs
@@ -0,0 +1 @@
+nuc_cnt=: '' < NB. 'syntax error
\ No newline at end of file
diff --git a/tests/syntax-error/results.json b/tests/syntax-error/results.json
new file mode 100644
index 0000000..c1eef58
--- /dev/null
+++ b/tests/syntax-error/results.json
@@ -0,0 +1,5 @@
+{
+  "version": 3,
+  "status": "error",
+  "message": "|syntax error: script\n|   nuc_cnt=:    ''<\n|[-0] nucleotide-count.ijs\n"
+}
diff --git a/tests/syntax-error/test.ijs b/tests/syntax-error/test.ijs
new file mode 100644
index 0000000..dd8ff8f
--- /dev/null
+++ b/tests/syntax-error/test.ijs
@@ -0,0 +1,42 @@
+load 'nucleotide-count.ijs'
+
+
+temppath=: < jpath '~temp/helper.txt'
+
+
+before_all =: monad define  
+  order=: i.0
+  tasks=: i.0
+)
+
+after_all =: monad define
+  (, LF ,~"1 ":order ,. tasks) 1!:2 temppath
+)
+
+nuc_cnt1_ignore=:0
+test_nuc_cnt1=: monad define
+  order=:order , 1
+  tasks=:tasks , 1
+  assert 0 0 0 0-:nuc_cnt''
+)
+
+nuc_cnt2_ignore=:0
+test_nuc_cnt2=: monad define
+  order=:order , 2
+  tasks=:tasks , 1
+  assert 0 0 1 0-:nuc_cnt 1$'G'
+)
+
+nuc_cnt3_ignore=:0
+test_nuc_cnt3=: monad define
+  order=:order , 3
+  tasks=:tasks , 1
+  assert 0 0 7 0-:nuc_cnt'GGGGGGG'
+)
+
+nuc_cnt4_ignore=:0
+test_nuc_cnt4=: monad define
+  order=:order , 4
+  tasks=:tasks , 1
+  assert 20 12 17 21-:nuc_cnt'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
+)
diff --git a/tests/unordered/.docs/instructions.md b/tests/unordered/.docs/instructions.md
new file mode 100644
index 0000000..36da381
--- /dev/null
+++ b/tests/unordered/.docs/instructions.md
@@ -0,0 +1,20 @@
+# Instructions
+
+Your task is determine the RNA complement of a given DNA sequence.
+
+Both DNA and RNA strands are a sequence of nucleotides.
+
+The four nucleotides found in DNA are adenine (**A**), cytosine (**C**), guanine (**G**) and thymine (**T**).
+
+The four nucleotides found in RNA are adenine (**A**), cytosine (**C**), guanine (**G**) and uracil (**U**).
+
+Given a DNA strand, its transcribed RNA strand is formed by replacing each nucleotide with its complement:
+
+- `G` -> `C`
+- `C` -> `G`
+- `T` -> `A`
+- `A` -> `U`
+
+~~~~exercism/note
+If you want to look at how the inputs and outputs are structured, take a look at the examples in the test suite.
+~~~~
diff --git a/tests/unordered/.docs/introduction.md b/tests/unordered/.docs/introduction.md
new file mode 100644
index 0000000..6b3f44b
--- /dev/null
+++ b/tests/unordered/.docs/introduction.md
@@ -0,0 +1,16 @@
+# Introduction
+
+You work for a bioengineering company that specializes in developing therapeutic solutions.
+
+Your team has just been given a new project to develop a targeted therapy for a rare type of cancer.
+
+~~~~exercism/note
+It's all very complicated, but the basic idea is that sometimes people's bodies produce too much of a given protein.
+That can cause all sorts of havoc.
+
+But if you can create a very specific molecule (called a micro-RNA), it can prevent the protein from being produced.
+
+This technique is called [RNA Interference][rnai].
+
+[rnai]: https://admin.acceleratingscience.com/ask-a-scientist/what-is-rnai/
+~~~~
diff --git a/tests/unordered/.meta/config.json b/tests/unordered/.meta/config.json
new file mode 100644
index 0000000..fc6f6c4
--- /dev/null
+++ b/tests/unordered/.meta/config.json
@@ -0,0 +1,22 @@
+{
+  "authors": [
+    "jitwit"
+  ],
+  "contributors": [
+    "iHiD"
+  ],
+  "files": {
+    "solution": [
+      "rna-transcription.ijs"
+    ],
+    "test": [
+      "test.ijs"
+    ],
+    "example": [
+      ".meta/example.ijs"
+    ]
+  },
+  "blurb": "Given a DNA strand, return its RNA Complement Transcription.",
+  "source": "Hyperphysics",
+  "source_url": "https://web.archive.org/web/20220408112140/http://hyperphysics.phy-astr.gsu.edu/hbase/Organic/transcription.html"
+}
diff --git a/tests/unordered/.meta/config/auto_approve b/tests/unordered/.meta/config/auto_approve
new file mode 100644
index 0000000..b1cab17
--- /dev/null
+++ b/tests/unordered/.meta/config/auto_approve
@@ -0,0 +1 @@
+json_false
diff --git a/tests/unordered/.meta/config/core b/tests/unordered/.meta/config/core
new file mode 100644
index 0000000..0598f37
--- /dev/null
+++ b/tests/unordered/.meta/config/core
@@ -0,0 +1 @@
+json_true
diff --git a/tests/unordered/.meta/config/deprecated b/tests/unordered/.meta/config/deprecated
new file mode 100644
index 0000000..b1cab17
--- /dev/null
+++ b/tests/unordered/.meta/config/deprecated
@@ -0,0 +1 @@
+json_false
diff --git a/tests/unordered/.meta/config/unlocked_by b/tests/unordered/.meta/config/unlocked_by
new file mode 100644
index 0000000..48cc97d
--- /dev/null
+++ b/tests/unordered/.meta/config/unlocked_by
@@ -0,0 +1 @@
+json_null
diff --git a/tests/unordered/.meta/config/uuid b/tests/unordered/.meta/config/uuid
new file mode 100644
index 0000000..d4e1c3c
--- /dev/null
+++ b/tests/unordered/.meta/config/uuid
@@ -0,0 +1 @@
+b6570e32-ed50-4ff9-bc9d-0202aa39b344
diff --git a/tests/unordered/.meta/config/version b/tests/unordered/.meta/config/version
new file mode 100644
index 0000000..589268e
--- /dev/null
+++ b/tests/unordered/.meta/config/version
@@ -0,0 +1 @@
+1.3.0
\ No newline at end of file
diff --git a/tests/unordered/.meta/example.ijs b/tests/unordered/.meta/example.ijs
new file mode 100644
index 0000000..2529234
--- /dev/null
+++ b/tests/unordered/.meta/example.ijs
@@ -0,0 +1 @@
+rna=: 'UGCA' {~ 'ACGT'&i.
\ No newline at end of file
diff --git a/tests/unordered/.meta/tests.toml b/tests/unordered/.meta/tests.toml
new file mode 100644
index 0000000..6800514
--- /dev/null
+++ b/tests/unordered/.meta/tests.toml
@@ -0,0 +1,28 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[b4631f82-c98c-4a2f-90b3-c5c2b6c6f661]
+description = "Empty RNA sequence"
+
+[a9558a3c-318c-4240-9256-5d5ed47005a6]
+description = "RNA complement of cytosine is guanine"
+
+[6eedbb5c-12cb-4c8b-9f51-f8320b4dc2e7]
+description = "RNA complement of guanine is cytosine"
+
+[870bd3ec-8487-471d-8d9a-a25046488d3e]
+description = "RNA complement of thymine is adenine"
+
+[aade8964-02e1-4073-872f-42d3ffd74c5f]
+description = "RNA complement of adenine is uracil"
+
+[79ed2757-f018-4f47-a1d7-34a559392dbf]
+description = "RNA complement"
diff --git a/tests/unordered/expected_results.json b/tests/unordered/expected_results.json
new file mode 100644
index 0000000..d31fe68
--- /dev/null
+++ b/tests/unordered/expected_results.json
@@ -0,0 +1,42 @@
+{
+  "version": 3,
+  "status": "pass",
+  "tests": [
+    {
+      "status": "pass",
+      "name": "empty_rna_sequence",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "rna_complement_of_cytosine_is_guanine",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "rna_complement_of_guanine_is_cytosine",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "rna_complement_of_thymine_is_adenine",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "rna_complement_of_adenine_is_uracil",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "rna_complement",
+      "message": "OK",
+      "task_id": "1"
+    }
+  ]
+}
diff --git a/tests/unordered/results.json b/tests/unordered/results.json
new file mode 100644
index 0000000..d31fe68
--- /dev/null
+++ b/tests/unordered/results.json
@@ -0,0 +1,42 @@
+{
+  "version": 3,
+  "status": "pass",
+  "tests": [
+    {
+      "status": "pass",
+      "name": "empty_rna_sequence",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "rna_complement_of_cytosine_is_guanine",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "rna_complement_of_guanine_is_cytosine",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "rna_complement_of_thymine_is_adenine",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "rna_complement_of_adenine_is_uracil",
+      "message": "OK",
+      "task_id": "1"
+    },
+    {
+      "status": "pass",
+      "name": "rna_complement",
+      "message": "OK",
+      "task_id": "1"
+    }
+  ]
+}
diff --git a/tests/unordered/rna-transcription.ijs b/tests/unordered/rna-transcription.ijs
new file mode 100644
index 0000000..2529234
--- /dev/null
+++ b/tests/unordered/rna-transcription.ijs
@@ -0,0 +1 @@
+rna=: 'UGCA' {~ 'ACGT'&i.
\ No newline at end of file
diff --git a/tests/unordered/test.ijs b/tests/unordered/test.ijs
new file mode 100644
index 0000000..9448920
--- /dev/null
+++ b/tests/unordered/test.ijs
@@ -0,0 +1,50 @@
+load 'rna-transcription.ijs'
+
+
+temppath=: < jpath '~temp/helper.txt'
+
+
+before_all=: monad define  
+  order=: i.0
+  tasks=: i.0
+)
+
+after_all=: monad define
+  (, LF ,~"1 ":order ,. tasks) 1!:2 temppath
+)
+
+test_empty_rna_sequence=: monad define
+  order=:order , 1
+  tasks=: tasks, 1
+  assert ''-:rna''
+)
+
+test_rna_complement_of_cytosine_is_guanine=: monad define
+  order=:order , 2
+  tasks=: tasks, 1
+  assert 'C'-:rna'G'
+)
+
+test_rna_complement_of_guanine_is_cytosine=: monad define
+  order=:order , 3
+  tasks=: tasks, 1
+  assert 'G'-:rna'C'
+)
+
+test_rna_complement_of_thymine_is_adenine=: monad define
+  order=:order , 4
+  tasks=: tasks, 1
+  assert 'A'-:rna'T'
+)
+
+test_rna_complement_of_adenine_is_uracil=: monad define
+  order=:order , 5
+  tasks=: tasks, 1
+  assert 'U'-:rna'A'
+)
+
+test_rna_complement=: monad define
+  order=:order , 6
+  tasks=: tasks, 1
+  assert 'UGCACCAGAAUU'-:rna'ACGTGGTCTTAA'
+)