custom barcode support

[bwprice]

Is your feature related to a problem?

We use lots of custom barcode indexes added during PCR of the target gene (e.g. up to 9216 unique combinations of 96 uniquely indexed F and 96 uniquely indexed R primers). Indexes can be between 9bp and 16bp depending on the primer set being used (but always the same length in a single dataset).

Describe the solution you'd like

A modification of the CSV input that allows columns for both forward primer index sequence and reverse primer index sequence, allowing demultiplexing of custom indexes. Columns for primer sequences (including degenerate bases) can be included if needed as in ONTbarcoder:

<style> </style>

F index	R index	F primer	R primer
ATCCGGTCGGAGA	ATCCGGTCGGAGA	GGTCAACAAATCATAAAGATATTGG	TAAACTTCAGGGTGACCAAAAAATCA
CTGAGGTGATCAG	ATCCGGTCGGAGA	GGTCAACAAATCATAAAGATATTGG	TAAACTTCAGGGTGACCAAAAAATCA

Describe alternatives you've considered

I'm not aware of a simple method to do this before running this pipeline. ONTbarcoder does this but does not allow degenerate bases in primer sequences and it means more software to install.

Additional context

No response

[cjw85]

Our bioinformatics workflows do not themselves perform demultiplexing, as it is expected to have been done by the sequencing device or the standalone basecaller.

This has not been an often enough asked feature to add to the workflows for us to have prioritised it.