diff --git a/src/samtools/samtools_faidx/config.vsh.yaml b/src/samtools/samtools_faidx/config.vsh.yaml
new file mode 100644
index 00000000..e94ad280
--- /dev/null
+++ b/src/samtools/samtools_faidx/config.vsh.yaml
@@ -0,0 +1,93 @@
+name: samtools_faidx
+namespace: samtools
+description: Indexes FASTA files to enable random access to fasta and fastq files.
+keywords: [ idex, fasta, faidx ]
+links:
+  homepage: https://www.htslib.org/
+  documentation: https://www.htslib.org/doc/faidx.html
+  repository: https://github.com/samtools/samtools
+references: 
+  doi: [10.1093/bioinformatics/btp352, 10.1093/gigascience/giab008]
+license: MIT/Expat
+
+argument_groups:
+  - name: Inputs
+    arguments:
+    - name: --fasta
+      type: file
+      description: |
+        FASTA input file.
+    - name: --length 
+      alternatives: -n
+      type: integer
+      description: |
+        Length of FASTA sequence line.
+      default: 60
+    - name: --region_file
+      alternatives: -r
+      type: file
+      description: |
+        File of regions.  Format is chr:from-to. One per line.
+  - name: Options
+    arguments:
+    - name: --continue
+      type: boolean_true
+      description: |
+        Continue after trying to retrieve missing region.
+    - name: --reverse_complement
+      alternatives: -i
+      type: boolean_true
+      description: |
+        Reverse complement sequences.
+  - name: Outputs 
+    arguments:
+    - name: --output
+      alternatives: -o
+      type: file 
+      description: |
+        Write FASTA to file.
+      required: true
+      direction: output
+      example: output.fasta
+    - name: --mark_strand
+      type: string
+      description: |
+        Add strand indicator to sequence name. Options are:
+        [ rc, no, sign, custom,<pos>,<neg> ]
+      default: rc
+    - name: --fai_idx
+      type: file
+      description: |
+        Name of the index file (default file.fa.fai).
+      direction: output
+      example: file.fa.fai
+    - name: --gzi_idx
+      type: file
+      description: |
+        Name of compressed file index (default file.fa.gz.gzi).
+      direction: output
+      example: file.fa.gz.gzi
+    - name: --fastq
+      type: boolean_true
+      description: |
+        File and index in FASTQ format.
+   
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - type: file
+    path: test_data
+engines:
+  - type: docker
+    image: quay.io/biocontainers/samtools:1.19.2--h50ea8bc_1
+    setup:
+      - type: docker
+        run: |
+          samtools --version 2>&1 | grep -E '^(samtools|Using htslib)' | \
+          sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
+runners:
+- type: executable
+- type: nextflow
diff --git a/src/samtools/samtools_faidx/help.txt b/src/samtools/samtools_faidx/help.txt
new file mode 100644
index 00000000..89320c6f
--- /dev/null
+++ b/src/samtools/samtools_faidx/help.txt
@@ -0,0 +1,19 @@
+```sh
+samtools faidx -h
+```
+Usage: samtools faidx <file.fa|file.fa.gz> [<reg> [...]]
+Option: 
+ -o, --output FILE        Write FASTA to file.
+ -n, --length INT         Length of FASTA sequence line. [60]
+ -c, --continue           Continue after trying to retrieve missing region.
+ -r, --region-file FILE   File of regions.  Format is chr:from-to. One per line.
+ -i, --reverse-complement Reverse complement sequences.
+     --mark-strand TYPE   Add strand indicator to sequence name
+                          TYPE = rc   for /rc on negative strand (default)
+                                 no   for no strand indicator
+                                 sign for (+) / (-)
+                                 custom,<pos>,<neg> for custom indicator
+     --fai-idx      FILE  name of the index file (default file.fa.fai).
+     --gzi-idx      FILE  name of compressed file index (default file.fa.gz.gzi).
+ -f, --fastq              File and index in FASTQ format.
+ -h, --help               This message.
\ No newline at end of file
diff --git a/src/samtools/samtools_faidx/script.sh b/src/samtools/samtools_faidx/script.sh
new file mode 100644
index 00000000..2b2f625a
--- /dev/null
+++ b/src/samtools/samtools_faidx/script.sh
@@ -0,0 +1,24 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+set -e
+
+[[ "$par_continue" == "false" ]] && unset par_continue
+[[ "$par_reverse_complement" == "false" ]] && unset par_reverse_complement
+[[ "$par_fastq" == "false" ]] && unset par_fastq
+
+samtools faidx \
+    "$par_fasta" \
+    -o "$par_output" \
+    ${par_length:+-l "$par_length"} \
+    ${par_continue:+-c} \
+    ${part_region_file:+-r "$par_region_file"} \
+    ${par_revferse_complement:+-r} \
+    ${par_mark_strand:+--mark-strand "$par_mark_strand"} \
+    ${par_fai_idx:+--fai-idx "$par_fai_idx"} \
+    ${par_gzi_idx:+--gzi-idx "$par_gzi_idx"} \
+    ${par_fastq:+-f}
+
+exit 0
\ No newline at end of file
diff --git a/src/samtools/samtools_faidx/test.sh b/src/samtools/samtools_faidx/test.sh
new file mode 100644
index 00000000..5212b35d
--- /dev/null
+++ b/src/samtools/samtools_faidx/test.sh
@@ -0,0 +1,39 @@
+#!/bin/bash
+
+test_dir="${meta_resources_dir}/test_data"
+echo ">>> Testing $meta_functionality_name"
+
+"$meta_executable" \
+  "$test_dir/test.fasta" \
+  --output "$test_dir/test.fasta.fai" \
+  --continue \
+  --fai-idx
+
+echo ">>> Checking whether output exists"
+[ ! -f "$test_dir/test.fasta.fai" ] && echo "File 'test.fasta.fai' does not exist!" && exit 1
+[ ! -f "$test_dir/test.fasta.fai.idx" ] && echo "File 'test.fasta.fai.idx' does not exist!" && exit 1
+[ ! -f "$test_dir/test.fasta.gzi.idx" ] && echo "File 'test.fasta.gzi.idx' does not exist!" && exit 1
+
+echo ">>> Checking whether output is non-empty"
+[ ! -s "$test_dir/test.fasta.fai" ] && echo "File 'test.fasta.fai' is empty!" && exit 1
+[ ! -s "$test_dir/test.fasta.fai.idx" ] && echo "File 'test.fasta.fai.idx' is empty!" && exit 1
+[ ! -s "$test_dir/test.fasta.gzi.idx" ] && echo "File 'test.fasta.gzi.idx' is empty!" && exit 1
+
+echo ">>> Checking whether output is correct"
+diff "$test_dir/a.flagstat" "$test_dir/a_ref.flagstat" || \
+    (echo "Output file a.flagstat does not match expected output" && exit 1)
+
+rm "$test_dir/a.flagstat"
+
+echo ">>> Test 2:"
+
+"$meta_executable" \
+  "$test_dir/test.fasta" \
+  --output "$test_dir/test.fasta.fai" \
+  --length 60 \
+  --continue \
+  --gzi-idx "$test_dir/test.fasta.gz.gzi" \
+
+
+echo "All tests succeeded!"
+exit 0
\ No newline at end of file
diff --git a/src/samtools/samtools_faidx/test_data/script.sh b/src/samtools/samtools_faidx/test_data/script.sh
new file mode 100644
index 00000000..ffd5b789
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/script.sh
@@ -0,0 +1,10 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+wget https://raw.githubusercontent.com/nf-core/test-datasets/rnaseq3/reference/transcriptome.fasta
+
+head -n 23 transcriptome.fasta > test.fasta # kepp only 4 first entries of the file for testing.
+
+rm transcriptome.fasta
\ No newline at end of file
diff --git a/src/samtools/samtools_faidx/test_data/test.fasta b/src/samtools/samtools_faidx/test_data/test.fasta
new file mode 100644
index 00000000..eee04dde
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/test.fasta
@@ -0,0 +1,23 @@
+>YAL069W CDS=1-315
+ATGATCGTAAATAACACACACGTGCTTACCCTACCACTTTATACCACCACCACATGCCATACTCACCCTC
+ACTTGTATACTGATTTTACGTACGCACACGGATGCTACAGTATATACCATCTCAAACTTACCCTACTCTC
+AGATTCCACTTCACTCCATGGCCCATCTCTCACTGAATCAGTACCAAATGCACTCACATCATTATGCACG
+GCACTTGCCTCAGCGGTCTATACCCTGTGCCATTTACCCATAACGCCCATCATTATCCACATTTTGATAT
+CTATATCTCATTCGGCGGTCCCAAATATTGTATAA
+>YAL068W-A CDS=1-255
+ATGCACGGCACTTGCCTCAGCGGTCTATACCCTGTGCCATTTACCCATAACGCCCATCATTATCCACATT
+TTGATATCTATATCTCATTCGGCGGTCCCAAATATTGTATAACTGCCCTTAATACATACGTTATACCACT
+TTTGCACCATATACTTACCACTCCATTTATATACACTTATGTCAATATTACAGAAAAATCCCCACAAAAA
+TCACCTAAACATAAAAATATTCTACTTTTCAACAATAATACATAA
+>YAL068C CDS=1-363
+ATGGTCAAATTAACTTCAATCGCCGCTGGTGTCGCTGCCATCGCTGCTACTGCTTCTGCAACCACCACTC
+TAGCTCAATCTGACGAAAGAGTCAACTTGGTGGAATTGGGTGTCTACGTCTCTGATATCAGAGCTCACTT
+AGCCCAATACTACATGTTCCAAGCCGCCCACCCAACTGAAACCTACCCAGTCGAAGTTGCTGAAGCCGTT
+TTCAACTACGGTGACTTCACCACCATGTTGACCGGTATTGCTCCAGACCAAGTGACCAGAATGATCACCG
+GTGTTCCATGGTACTCCAGCAGATTAAAGCCAGCCATCTCCAGTGCTCTATCCAAGGACGGTATCTACAC
+TATCGCAAACTAG
+>YAL067W-A CDS=1-228
+ATGCCAATTATAGGGGTGCCGAGGTGCCTTATAAAACCCTTTTCTGTGCCTGTGACATTTCCTTTTTCGG
+TCAAAAAGAATATCCGAATTTTAGATTTGGACCCTCGTACAGAAGCTTATTGTCTAAGCCTGAATTCAGT
+CTGCTTTAAACGGCTTCCGCGGAGGAAATATTTCCATCTCTTGAATTCGTACAACATTAAACGTGTGTTG
+GGAGTCGTATACTGTTAG
diff --git a/src/samtools/samtools_faidx/test_data/test.fastq b/src/samtools/samtools_faidx/test_data/test.fastq
new file mode 100644
index 00000000..b8f8c917
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/test.fastq
@@ -0,0 +1,14 @@
+@fastq1
+ATGCATGCATGCATGCATGCATGCATGCAT
+GCATGCATGCATGCATGCATGCATGCATGC
+ATGCAT
++
+FFFA@@FFFFFFFFFFHHB:::@BFFFFGG
+HIHIIIIIIIIIIIIIIIIIIIIIIIFFFF
+8011<<
+@fastq2
+ATGCATGCATGCAT
+GCATGCATGCATGC
++
+IIA94445EEII==
+=>IIIIIIIIICCC
\ No newline at end of file
diff --git a/src/samtools/samtools_faidx/test_data/test1.fasta.fai b/src/samtools/samtools_faidx/test_data/test1.fasta.fai
new file mode 100644
index 00000000..475dde4d
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/test1.fasta.fai
@@ -0,0 +1,4 @@
+YAL069W	315	19	70	71
+YAL068W-A	255	360	70	71
+YAL068C	363	638	70	71
+YAL067W-A	228	1028	70	71
diff --git a/src/samtools/samtools_faidx/test_data/test2.fasta b/src/samtools/samtools_faidx/test_data/test2.fasta
new file mode 100644
index 00000000..475dde4d
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/test2.fasta
@@ -0,0 +1,4 @@
+YAL069W	315	19	70	71
+YAL068W-A	255	360	70	71
+YAL068C	363	638	70	71
+YAL067W-A	228	1028	70	71
diff --git a/src/samtools/samtools_faidx/test_data/test_out.fasta b/src/samtools/samtools_faidx/test_data/test_out.fasta
new file mode 100644
index 00000000..475dde4d
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/test_out.fasta
@@ -0,0 +1,4 @@
+YAL069W	315	19	70	71
+YAL068W-A	255	360	70	71
+YAL068C	363	638	70	71
+YAL067W-A	228	1028	70	71