diff --git a/CHANGELOG.md b/CHANGELOG.md
index 29911e86..f35ae603 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -27,6 +27,8 @@
 
 * `lofreq/indelqual`: Insert indel qualities into BAM file (PR #17).
 
+* `multiqc`: Aggregate results from bioinformatics analyses across many samples into a single report (PR #42).
+
 * `star/star_align_reads`: Align reads to a reference genome (PR #22).
 
 * `gffread`: Validate, filter, convert and perform other operations on GFF files (PR #29).  
@@ -36,13 +38,17 @@
     - `salmon/salmon_quant`: Transcript quantification from RNA-seq data (PR #24).
 
 * `samtools`:
-    - `samtools/flagstat`: Counts the number of alignments in SAM/BAM/CRAM files for each FLAG type (PR #31).
-    - `samtools/idxstats`: Reports alignment summary statistics for a SAM/BAM/CRAM file (PR #32).
+    - `samtools/samtools_flagstat`: Counts the number of alignments in SAM/BAM/CRAM files for each FLAG type (PR #31).
+    - `samtools/samtools_idxstats`: Reports alignment summary statistics for a SAM/BAM/CRAM file (PR #32).
     - `samtools/samtools_index`: Index SAM/BAM/CRAM files (PR #35).
     - `samtools/samtools_sort`: Sort SAM/BAM/CRAM files (PR #36).
     - `samtools/samtools_stats`: Reports alignment summary statistics for a BAM file (PR #39).
+    - `samtools/samtools_faidx`: Indexes FASTA files to enable random access to fasta and fastq files (PR #41).
     - `samtools/samtools_view`: Views and converts SAM/BAM/CRAM files (PR #48).
 
+* `falco`: A C++ drop-in replacement of FastQC to assess the quality of sequence read data (PR #43).
+
+
 ## MAJOR CHANGES
 
 ## MINOR CHANGES
@@ -53,4 +59,4 @@
 
 ## DOCUMENTATION
 
-## BUG FIXES
\ No newline at end of file
+## BUG FIXES
diff --git a/_viash.yaml b/_viash.yaml
index a72a1ab7..6d658e2d 100644
--- a/_viash.yaml
+++ b/_viash.yaml
@@ -7,4 +7,7 @@ links:
   issue_tracker: https://github.com/viash-hub/biobase/issues
   repository: https://github.com/viash-hub/biobase
 
-viash_version: 0.9.0-RC2
\ No newline at end of file
+viash_version: 0.9.0-RC2
+
+config_mods: |
+  .requirements.commands := ['ps']
diff --git a/src/bcl_convert/config.vsh.yaml b/src/bcl_convert/config.vsh.yaml
new file mode 100644
index 00000000..7a9bce24
--- /dev/null
+++ b/src/bcl_convert/config.vsh.yaml
@@ -0,0 +1,159 @@
+name: bcl_convert
+description: |
+  Convert bcl files to fastq files using bcl-convert.
+  Information about upgrading from bcl2fastq via
+  https://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html
+  and https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html
+argument_groups:
+  - name: Input arguments
+    arguments:
+      - name: "--bcl_input_directory"
+        alternatives: ["-i"]
+        type: file
+        required: true
+        description: Input run directory
+        example: bcl_dir
+      - name: "--sample_sheet"
+        alternatives: ["-s"]
+        type: file
+        description: Path to SampleSheet.csv file (default searched for in --bcl_input_directory)
+        example: bcl_dir/sample_sheet.csv
+      - name: --run_info
+        type: file
+        description: Path to RunInfo.xml file (default root of BCL input directory)
+        example: bcl_dir/RunInfo.xml
+
+  - name: Lane and tile settings
+    arguments:
+      - name: "--bcl_only_lane"
+        type: integer
+        description: Convert only specified lane number (default all lanes)
+        example: 1
+      - name: --first_tile_only
+        type: boolean
+        description: Only convert first tile of input (for testing & debugging)
+        example: true
+      - name: --tiles
+        type: string
+        description: Process only a subset of tiles by a regular expression
+        example: "s_[0-9]+_1"
+      - name: --exclude_tiles
+        type: string
+        description: Exclude set of tiles by a regular expression
+        example: "s_[0-9]+_1"
+
+  - name: Resource arguments
+    arguments:
+      - name: --shared_thread_odirect_output
+        type: boolean
+        description: Use linux native asynchronous io (io_submit) for file output (Default=false)
+        example: true
+      - name: --bcl_num_parallel_tiles
+        type: integer
+        description: "# of tiles to process in parallel (default 1)"
+        example: 1
+      - name: --bcl_num_conversion_threads
+        type: integer
+        description: "# of threads for conversion (per tile, default # cpu threads)"
+        example: 1
+      - name: --bcl_num_compression_threads
+        type: integer
+        description: "# of threads for fastq.gz output compression (per tile, default # cpu threads, or HW+12)"
+        example: 1
+      - name: --bcl_num_decompression_threads
+        type: integer
+        description:
+          "# of threads for bcl/cbcl input decompression (per tile, default half # cpu threads, or HW+8).
+          Only applies when preloading files"
+        example: 1
+
+  - name: Run arguments
+    arguments:
+      - name: --bcl_only_matched_reads
+        type: boolean
+        description: For pure BCL conversion, do not output files for 'Undetermined' [unmatched] reads (output by default)
+        example: true
+      - name: --no_lane_splitting
+        type: boolean
+        description: Do not split FASTQ file by lane (false by default)
+        example: true
+      - name: --num_unknown_barcodes_reported
+        type: integer
+        description: "# of Top Unknown Barcodes to output (1000 by default)"
+        example: 1000
+      - name: --bcl_validate_sample_sheet_only
+        type: boolean
+        description: Only validate RunInfo.xml & SampleSheet files (produce no FASTQ files)
+        example: true
+      - name: --strict_mode
+        type: boolean
+        description: Abort if any files are missing (false by default)
+        example: true
+      - name: --sample_name_column_enabled
+        type: boolean
+        description: Use sample sheet 'Sample_Name' column when naming fastq files & subdirectories
+        example: true
+
+  - name: Output arguments
+    arguments:
+      - name: "--output_directory"
+        alternatives: ["-o"]
+        type: file
+        direction: output
+        required: true
+        description: Output directory containig fastq files
+        example: fastq_dir
+      - name: --bcl_sampleproject_subdirectories
+        type: boolean
+        description: Output to subdirectories based upon sample sheet 'Sample_Project' column
+        example: true
+      - name: --fastq_gzip_compression_level
+        type: integer
+        description: Set fastq output compression level 0-9 (default 1)
+        example: 1
+      - name: "--reports"
+        type: file
+        direction: output
+        required: false
+        description: Reports directory
+        example: reports_dir
+      - name: "--logs"
+        type: file
+        direction: output
+        required: false
+        description: Reports directory
+        example: logs_dir
+
+# bcl-convert arguments not taken into account
+#   --force
+#   --output-legacy-stats arg              Also output stats in legacy (bcl2fastq2) format (false by default)
+#   --no-sample-sheet arg                  Enable legacy no-sample-sheet operation (No demux or trimming. No settings
+
+resources:
+  - type: bash_script
+    path: script.sh
+
+test_resources:
+  - type: bash_script
+    path: test.sh
+
+engines:
+  - type: docker
+    image: debian:trixie-slim
+    # https://support.illumina.com/sequencing/sequencing_software/bcl-convert/downloads.html
+    setup:
+      - type: apt
+        packages: [wget, gdb, which, hostname, alien, procps]
+      - type: docker
+        run: |
+          wget https://s3.amazonaws.com/webdata.illumina.com/downloads/software/bcl-convert/bcl-convert-4.2.7-2.el8.x86_64.rpm -O /tmp/bcl-convert.rpm && \
+          alien -i /tmp/bcl-convert.rpm && \
+          rm -rf /var/lib/apt/lists/* && \
+          rm /tmp/bcl-convert.rpm
+      - type: docker
+        run: |
+          echo "bcl-convert: \"$(bcl-convert -V 2>&1 >/dev/null | sed -n '/Version/ s/^bcl-convert\ Version //p')\"" > /var/software_versions.txt
+
+runners:
+  - type: executable
+  - type: nextflow
diff --git a/src/bcl_convert/help.txt b/src/bcl_convert/help.txt
new file mode 100644
index 00000000..edb73faf
--- /dev/null
+++ b/src/bcl_convert/help.txt
@@ -0,0 +1,38 @@
+bcl-convert Version 00.000.000.4.2.7
+Copyright (c) 2014-2022 Illumina, Inc.
+
+Run BCL Conversion (BCL directory to *.fastq.gz)
+  bcl-convert --bcl-input-directory <BCL_ROOT_DIR> --output-directory <PATH> [options]
+
+Options:
+  -h [ --help ]                          Print this help message
+  -V [ --version ]                       Print the version and exit
+  --output-directory arg                 Output BCL directory for BCL conversion (must be specified)
+  -f [ --force ]                         Force: allow destination diretory to already exist
+  --bcl-input-directory arg              Input BCL directory for BCL conversion (must be specified)
+  --sample-sheet arg                     Path to SampleSheet.csv file (default searched for in --bcl-input-directory)
+  --bcl-only-lane arg                    Convert only specified lane number (default all lanes)
+  --strict-mode arg                      Abort if any files are missing (false by default)
+  --first-tile-only arg                  Only convert first tile of input (for testing & debugging)
+  --tiles arg                            Process only a subset of tiles by a regular expression
+  --exclude-tiles arg                    Exclude set of tiles by a regular expression
+  --bcl-sampleproject-subdirectories arg Output to subdirectories based upon sample sheet 'Sample_Project' column
+  --sample-name-column-enabled arg       Use sample sheet 'Sample_Name' column when naming fastq files & subdirectories
+  --fastq-gzip-compression-level arg     Set fastq output compression level 0-9 (default 1)
+  --shared-thread-odirect-output arg     Use linux native asynchronous io (io_submit) for file output (Default=false)
+  --bcl-num-parallel-tiles arg           # of tiles to process in parallel (default 1)
+  --bcl-num-conversion-threads arg       # of threads for conversion (per tile, default # cpu threads)
+  --bcl-num-compression-threads arg      # of threads for fastq.gz output compression (per tile, default # cpu threads,
+                                         or HW+12)
+  --bcl-num-decompression-threads arg    # of threads for bcl/cbcl input decompression (per tile, default half # cpu
+                                         threads, or HW+8. Only applies when preloading files)
+  --bcl-only-matched-reads arg           For pure BCL conversion, do not output files for 'Undetermined' [unmatched]
+                                         reads (output by default)
+  --run-info arg                         Path to RunInfo.xml file (default root of BCL input directory)
+  --no-lane-splitting arg                Do not split FASTQ file by lane (false by default)
+  --num-unknown-barcodes-reported arg    # of Top Unknown Barcodes to output (1000 by default)
+  --bcl-validate-sample-sheet-only arg   Only validate RunInfo.xml & SampleSheet files (produce no FASTQ files)
+  --output-legacy-stats arg              Also output stats in legacy (bcl2fastq2) format (false by default)
+  --no-sample-sheet arg                  Enable legacy no-sample-sheet operation (No demux or trimming. No settings
+                                         supported. False by default, not recommended
+
diff --git a/src/bcl_convert/script.sh b/src/bcl_convert/script.sh
new file mode 100644
index 00000000..6a59acd5
--- /dev/null
+++ b/src/bcl_convert/script.sh
@@ -0,0 +1,40 @@
+#!/bin/bash
+
+set -eo pipefail
+
+$(which bcl-convert) \
+ --bcl-input-directory "$par_bcl_input_directory" \
+ --output-directory "$par_output_directory" \
+  ${par_sample_sheet:+ --sample-sheet "$par_sample_sheet"} \
+  ${par_run_info:+ --run-info "$par_run_info"} \
+  ${par_bcl_only_lane:+ --bcl-only-lane "$par_bcl_only_lane"} \
+  ${par_first_tile_only:+ --first-tile-only "$par_first_tile_only"} \
+  ${par_tiles:+ --tiles "$par_tiles"} \
+  ${par_exclude_tiles:+ --exclude-tiles "$par_exclude_tiles"} \
+  ${par_shared_thread_odirect_output:+ --shared-thread-odirect-output "$par_shared_thread_odirect_output"} \
+  ${par_bcl_num_parallel_tiles:+ --bcl-num-parallel-tiles "$par_bcl_num_parallel_tiles"} \
+  ${par_bcl_num_conversion_threads:+ --bcl-num-conversion-threads "$par_bcl_num_conversion_threads"} \
+  ${par_bcl_num_compression_threads:+ --bcl-num-compression-threads "$par_bcl_num_compression_threads"} \
+  ${par_bcl_num_decompression_threads:+ --bcl-num-decompression-threads "$par_bcl_num_decompression_threads"} \
+  ${par_bcl_only_matched_reads:+ --bcl-only-matched-reads "$par_bcl_only_matched_reads"} \
+  ${par_no_lane_splitting:+ --no-lane-splitting "$par_no_lane_splitting"} \
+  ${par_num_unknown_barcodes_reported:+ --num-unknown-barcodes-reported "$par_num_unknown_barcodes_reported"} \
+  ${par_bcl_validate_sample_sheet_only:+ --bcl-validate-sample-sheet-only "$par_bcl_validate_sample_sheet_only"} \
+  ${par_strict_mode:+ --strict-mode "$par_strict_mode"} \
+  ${par_sample_name_column_enabled:+ --sample-name-column-enabled "$par_sample_name_column_enabled"} \
+  ${par_bcl_sampleproject_subdirectories:+ --bcl-sampleproject-subdirectories "$par_bcl_sampleproject_subdirectories"} \
+  ${par_fastq_gzip_compression_level:+ --fastq-gzip-compression-level "$par_fastq_gzip_compression_level"}
+
+if [ ! -z "$par_reports" ]; then
+  echo "Moving reports to their own location"
+  mv "${par_output_directory}/Reports" "$par_reports"
+else
+  echo "Leaving reports alone"
+fi
+
+if [ ! -z "$par_logs" ]; then
+  echo "Moving logs to their own location"
+  mv "${par_output_directory}/Logs" "$par_logs"
+else
+  echo "Leaving logs alone"
+fi
diff --git a/src/bcl_convert/test.sh b/src/bcl_convert/test.sh
new file mode 100644
index 00000000..b46bc9fe
--- /dev/null
+++ b/src/bcl_convert/test.sh
@@ -0,0 +1,70 @@
+#!/bin/bash
+
+# Tests are sourced from:
+#   https://www.10xgenomics.com/support/software/cell-ranger/latest/analysis/inputs/cr-direct-demultiplexing-bcl-convert
+# Test input files are fetched from:
+# https://cf.10xgenomics.com/supp/spatial-exp/demultiplexing/iseq-DI.tar.gz
+# https://cf.10xgenomics.com/supp/spatial-exp/demultiplexing/bcl_convert_samplesheet.csv
+
+set -eo pipefail
+
+echo ">> Fetching and preparing test data"
+data_src="https://cf.10xgenomics.com/supp/spatial-exp/demultiplexing/iseq-DI.tar.gz"
+sample_sheet_src="https://cf.10xgenomics.com/supp/spatial-exp/demultiplexing/bcl_convert_samplesheet.csv"
+test_data_dir="test_data"
+
+mkdir $test_data_dir
+wget -q $data_src -O $test_data_dir/data.tar.gz
+wget -q $sample_sheet_src -O $test_data_dir/sample_sheet.csv
+tar xzf $test_data_dir/data.tar.gz -C $test_data_dir
+rm $test_data_dir/data.tar.gz
+
+echo ">> Execute and verify output"
+
+$meta_executable \
+  --bcl_input_directory "$test_data_dir/iseq-DI" \
+  --sample_sheet "$test_data_dir/sample_sheet.csv" \
+  --output_directory fastq \
+  --reports reports \
+  --logs logs
+
+echo ">>> Checking whether the output dir exists"
+[[ ! -d fastq ]] && echo "Output dir could not be found!" && exit 1
+
+echo ">>> Checking whether output fastq files are created"
+[[ ! -f fastq/Undetermined_S0_L001_R1_001.fastq.gz ]] && echo "Output fastq files could not be found!" && exit 1
+[[ ! -f fastq/iseq-DI_S1_L001_R1_001.fastq.gz ]] && echo "Output fastq files could not be found!" && exit 1
+
+echo ">>> Checking whether the report dir exists"
+[[ ! -d reports ]] && echo "Reports dir could not be found!" && exit 1
+
+echo ">>> Checking whether the log dir exists"
+[[ ! -d logs ]] && echo "Logs dir could not be found!" && exit 1
+
+# print final message
+echo ">>> Test finished successfully"
+
+echo ">> Execute with additional arguments and verify output"
+
+$meta_executable \
+  --bcl_input_directory "$test_data_dir/iseq-DI" \
+  --sample_sheet "$test_data_dir/sample_sheet.csv" \
+  --output_directory fastq1 \
+  --bcl_only_matched_reads true \
+  --bcl_num_compression_threads 1 \
+  --no_lane_splitting false \
+  --fastq_gzip_compression_level 9
+
+echo ">> Checking whether the output dir exists"
+[[ ! -d fastq1 ]] && echo "Output dir could not be found!" && exit 1
+
+echo ">> Checking whether output fastq files are created"
+[[ -f fastq1/Undetermined_S0_L001_R1_001.fastq.gz ]] && echo "Undetermined should not be generated!" && exit 1
+[[ ! -f fastq1/iseq-DI_S1_L001_R1_001.fastq.gz ]] && echo "Output fastq files could not be found!" && exit 1
+
+# print final message
+echo ">> Test finished successfully"
+
+# do not remove this
+# as otherwise your test might exit with a different exit code
+exit 0
diff --git a/src/falco/config.vsh.yaml b/src/falco/config.vsh.yaml
new file mode 100644
index 00000000..4d9cf656
--- /dev/null
+++ b/src/falco/config.vsh.yaml
@@ -0,0 +1,196 @@
+name: falco
+description: A C++ drop-in replacement of FastQC to assess the quality of sequence read data
+keywords: [qc, fastqc, sequencing]
+links:
+  documentation: https://falco.readthedocs.io/en/latest/
+  repository: https://github.com/smithlabcode/falco
+references:
+  doi: 10.12688/f1000research.21142.2
+license: GPL-3.0
+requirements:
+  commands: [falco]
+
+# Notes:
+# - falco as arguments similar to -subsample and we update those to --subsample
+# - The outdir argument is not required
+# - The input argument in falco is positional but we changed this to --input
+argument_groups:
+  - name: Input arguments
+    arguments:
+      - name: --input
+        required: true
+        type: file
+        multiple: true
+        description: input fastq files
+        example: input1.fastq;input2.fastq
+
+  - name: Run arguments
+    arguments:
+      - name: --nogroup
+        type: boolean_true
+        description: |
+          Disable grouping of bases for reads >50bp. 
+          All reports will show data for every base in 
+          the read. WARNING: When using this option, 
+          your plots may end up a ridiculous size. You 
+          have been warned!
+      - name: --contaminents
+        type: file
+        description: |
+          Specifies a non-default file which contains 
+          the list of contaminants to screen 
+          overrepresented sequences against. The file 
+          must contain sets of named contaminants in 
+          the form name[tab]sequence. Lines prefixed 
+          with a hash will be ignored. Default: 
+          https://github.com/smithlabcode/falco/blob/v1.2.2/Configuration/contaminant_list.txt
+      - name: --adapters
+        type: file
+        description: |
+          Specifies a non-default file which contains 
+          the list of adapter sequences which will be 
+          explicity searched against the library. The 
+          file must contain sets of named adapters in 
+          the form name[tab]sequence. Lines prefixed 
+          with a hash will be ignored. Default:
+          https://github.com/smithlabcode/falco/blob/v1.2.2/Configuration/adapter_list.txt
+      - name: --limits
+        type: file
+        description: |
+          Specifies a non-default file which contains 
+          a set of criteria which will be used to 
+          determine the warn/error limits for the 
+          various modules. This file can also be used 
+          to selectively remove some modules from the 
+          output all together. The format needs to 
+          mirror the default limits.txt file found in 
+          the Configuration folder. Default: 
+          https://github.com/smithlabcode/falco/blob/v1.2.2/Configuration/limits.txt
+      - name: --subsample
+        alternatives: [-s]
+        type: integer
+        example: 10
+        description: |
+          [Falco only] makes falco faster (but 
+          possibly less accurate) by only processing 
+          reads that are a multiple of this value (using 
+          0-based indexing to number reads).
+      - name: --bisulfite
+        alternatives: [-b]
+        type: boolean_true
+        description: |
+          [Falco only] reads are whole genome 
+          bisulfite sequencing, and more Ts and fewer 
+          Cs are therefore expected and will be 
+          accounted for in base content.
+      - name: --reverse_complliment
+        alternatives: [-r]
+        type: boolean_true
+        description: |
+          [Falco only] The input is a 
+          reverse-complement. All modules will be 
+          tested by swapping A/T and C/G
+
+  - name: Output arguments
+    arguments:
+      - name: --outdir
+        alternatives: [-o]
+        required: true
+        type: file
+        direction: output
+        description: |
+          Create all output files in the specified 
+          output directory. FALCO-SPECIFIC: If the 
+          directory does not exists, the program will 
+          create it.
+        example: output
+      - name: --format
+        type: string
+        choices: [bam, sam, bam_mapped, sam_mapped, fastq, fq, fastq.gz, fq.gz]
+        alternatives: ["-f"]
+        description: |
+          Bypasses the normal sequence file format 
+          detection and forces the program to use the 
+          specified format. Validformats are bam, sam, 
+          bam_mapped, sam_mapped, fastq, fq, fastq.gz 
+          or fq.gz.
+      - name: --data_filename
+        alternatives: [-D]
+        type: file
+        direction: output
+        description: |
+          [Falco only] Specify filename for FastQC 
+          data output (TXT). If not specified, it will 
+          be called fastq_data.txt in either the input 
+          file's directory or the one specified in the 
+          --output flag. Only available when running 
+          falco with a single input.
+      - name: --report_filename
+        alternatives: [-R]
+        type: file
+        direction: output
+        description: |
+          [Falco only] Specify filename for FastQC 
+          report output (HTML). If not specified, it 
+          will be called fastq_report.html in either 
+          the input file's directory or the one 
+          specified in the --output flag. Only 
+          available when running falco with a single 
+          input.
+      - name: --summary_filename
+        alternatives: [-S]
+        type: file
+        direction: output
+        description: |
+          [Falco only] Specify filename for the short 
+          summary output (TXT). If not specified, it 
+          will be called fastq_report.html in either 
+          the input file's directory or the one 
+          specified in the --output flag. Only 
+          available when running falco with a single 
+          input.
+
+# Arguments not taken into account:
+#
+#       -skip-data           [Falco only] Do not create FastQC data text
+#                            file.
+#       -skip-report         [Falco only] Do not create FastQC report
+#                            HTML file.
+#       -skip-summary        [Falco only] Do not create FastQC summary
+#                            file
+#       -K, -add-call        [Falco only] add the command call call to
+#                            FastQC data output and FastQC report HTML
+#                            (this may break the parse of fastqc_data.txt
+#                            in programs that are very strict about the
+#                            FastQC output format).
+
+resources:
+  - type: bash_script
+    path: script.sh
+
+test_resources:
+  - type: bash_script
+    path: test.sh
+
+engines:
+  - type: docker
+    image: debian:trixie-slim
+    setup:
+      - type: apt
+        packages: [wget, build-essential, g++, zlib1g-dev, procps]
+      - type: docker
+        run: |
+          wget https://github.com/smithlabcode/falco/releases/download/v1.2.2/falco-1.2.2.tar.gz -O /tmp/falco.tar.gz && \
+          cd /tmp && \
+          tar xvf falco.tar.gz && \
+          cd falco-1.2.2 && \
+          ./configure && \
+          make all && \
+          make install
+      - type: docker
+        run: |
+          echo "falco: \"$(falco -v | sed -n 's/^falco //p')\"" > /var/software_versions.txt
+
+runners:
+  - type: executable
+  - type: nextflow
diff --git a/src/falco/help.txt b/src/falco/help.txt
new file mode 100644
index 00000000..eea77972
--- /dev/null
+++ b/src/falco/help.txt
@@ -0,0 +1,156 @@
+Usage: falco [OPTIONS] <seqfile1> <seqfile2> ...
+
+Options:
+  -h, --help               Print this help file and exit  
+  -v, --version            Print the version of the program and exit  
+  -o, --outdir             Create all output files in the specified 
+                           output directory. FALCO-SPECIFIC: If the 
+                           directory does not exists, the program will 
+                           create it. If this option is not set then 
+                           the output file for each sequence file is 
+                           created in the same directory as the 
+                           sequence file which was processed.  
+      --casava             [IGNORED BY FALCO] Files come from raw 
+                           casava output. Files in the same sample 
+                           group (differing only by the group number) 
+                           will be analysed as a set rather than 
+                           individually. Sequences with the filter flag 
+                           set in the header will be excluded from the 
+                           analysis. Files must have the same names 
+                           given to them by casava (including being 
+                           gzipped and ending with .gz) otherwise they 
+                           won't be grouped together correctly.  
+      --nano               [IGNORED BY FALCO] Files come from nanopore 
+                           sequences and are in fast5 format. In this 
+                           mode you can pass in directories to process 
+                           and the program will take in all fast5 files 
+                           within those directories and produce a 
+                           single output file from the sequences found 
+                           in all files.  
+      --nofilter           [IGNORED BY FALCO] If running with --casava 
+                           then don't remove read flagged by casava as 
+                           poor quality when performing the QC 
+                           analysis.  
+      --extract            [ALWAYS ON IN FALCO] If set then the zipped 
+                           output file will be uncompressed in the same 
+                           directory after it has been created. By 
+                           default this option will be set if fastqc is 
+                           run in non-interactive mode.  
+  -j, --java               [IGNORED BY FALCO] Provides the full path to 
+                           the java binary you want to use to launch 
+                           fastqc. If not supplied then java is assumed 
+                           to be in your path.  
+      --noextract          [IGNORED BY FALCO] Do not uncompress the 
+                           output file after creating it. You should 
+                           set this option if you do not wish to 
+                           uncompress the output when running in 
+                           non-interactive mode.  
+      --nogroup            Disable grouping of bases for reads >50bp. 
+                           All reports will show data for every base in 
+                           the read. WARNING: When using this option, 
+                           your plots may end up a ridiculous size. You 
+                           have been warned!  
+      --min_length         [NOT YET IMPLEMENTED IN FALCO] Sets an 
+                           artificial lower limit on the length of the 
+                           sequence to be shown in the report. As long 
+                           as you set this to a value greater or equal 
+                           to your longest read length then this will 
+                           be the sequence length used to create your 
+                           read groups. This can be useful for making 
+                           directly comaparable statistics from 
+                           datasets with somewhat variable read 
+                           lengths.  
+  -f, --format             Bypasses the normal sequence file format 
+                           detection and forces the program to use the 
+                           specified format. Validformats are bam, sam, 
+                           bam_mapped, sam_mapped, fastq, fq, fastq.gz 
+                           or fq.gz.  
+  -t, --threads            [NOT YET IMPLEMENTED IN FALCO] Specifies the 
+                           number of files which can be processed 
+                           simultaneously. Each thread will be 
+                           allocated 250MB of memory so you shouldn't 
+                           run more threads than your available memory 
+                           will cope with, and not more than 6 threads 
+                           on a 32 bit machine [1] 
+  -c, --contaminants       Specifies a non-default file which contains 
+                           the list of contaminants to screen 
+                           overrepresented sequences against. The file 
+                           must contain sets of named contaminants in 
+                           the form name[tab]sequence. Lines prefixed 
+                           with a hash will be ignored. Default: 
+                           /tmp/falco-1.2.2/Configuration/contaminant_list.txt 
+  -a, --adapters           Specifies a non-default file which contains 
+                           the list of adapter sequences which will be 
+                           explicity searched against the library. The 
+                           file must contain sets of named adapters in 
+                           the form name[tab]sequence. Lines prefixed 
+                           with a hash will be ignored. Default: 
+                           /tmp/falco-1.2.2/Configuration/adapter_list.txt 
+  -l, --limits             Specifies a non-default file which contains 
+                           a set of criteria which will be used to 
+                           determine the warn/error limits for the 
+                           various modules. This file can also be used 
+                           to selectively remove some modules from the 
+                           output all together. The format needs to 
+                           mirror the default limits.txt file found in 
+                           the Configuration folder. Default: 
+                           /tmp/falco-1.2.2/Configuration/limits.txt 
+  -k, --kmers              [IGNORED BY FALCO AND ALWAYS SET TO 7] 
+                           Specifies the length of Kmer to look for in 
+                           the Kmer content module. Specified Kmer 
+                           length must be between 2 and 10. Default 
+                           length is 7 if not specified.  
+  -q, --quiet              Supress all progress messages on stdout and 
+                           only report errors.  
+  -d, --dir                [IGNORED: FALCO DOES NOT CREATE TMP FILES] 
+                           Selects a directory to be used for temporary 
+                           files written when generating report images. 
+                           Defaults to system temp directory if not 
+                           specified.  
+  -s, -subsample           [Falco only] makes falco faster (but 
+                           possibly less accurate) by only processing 
+                           reads that are multiple of this value (using 
+                           0-based indexing to number reads). [1] 
+  -b, -bisulfite           [Falco only] reads are whole genome 
+                           bisulfite sequencing, and more Ts and fewer 
+                           Cs are therefore expected and will be 
+                           accounted for in base content.  
+  -r, -reverse-complement  [Falco only] The input is a 
+                           reverse-complement. All modules will be 
+                           tested by swapping A/T and C/G  
+      -skip-data           [Falco only] Do not create FastQC data text 
+                           file.  
+      -skip-report         [Falco only] Do not create FastQC report 
+                           HTML file.  
+      -skip-summary        [Falco only] Do not create FastQC summary 
+                           file  
+  -D, -data-filename       [Falco only] Specify filename for FastQC 
+                           data output (TXT). If not specified, it will 
+                           be called fastq_data.txt in either the input 
+                           file's directory or the one specified in the 
+                           --output flag. Only available when running 
+                           falco with a single input.  
+  -R, -report-filename     [Falco only] Specify filename for FastQC 
+                           report output (HTML). If not specified, it 
+                           will be called fastq_report.html in either 
+                           the input file's directory or the one 
+                           specified in the --output flag. Only 
+                           available when running falco with a single 
+                           input.  
+  -S, -summary-filename    [Falco only] Specify filename for the short 
+                           summary output (TXT). If not specified, it 
+                           will be called fastq_report.html in either 
+                           the input file's directory or the one 
+                           specified in the --output flag. Only 
+                           available when running falco with a single 
+                           input.  
+  -K, -add-call            [Falco only] add the command call call to 
+                           FastQC data output and FastQC report HTML 
+                           (this may break the parse of fastqc_data.txt 
+                           in programs that are very strict about the 
+                           FastQC output format).  
+
+Help options:
+  -?, -help                print this help message  
+      -about               print about message  
+
diff --git a/src/falco/script.sh b/src/falco/script.sh
new file mode 100644
index 00000000..43f5efe5
--- /dev/null
+++ b/src/falco/script.sh
@@ -0,0 +1,24 @@
+#!/bin/bash
+
+set -eo pipefail
+
+[[ "$par_nogroup" == "false" ]] && unset par_nogroup
+[[ "$par_bisulfite" == "false" ]] && unset par_bisulfite
+[[ "$par_reverse_compliment" == "false" ]] && unset par_reverse_compliment
+
+IFS=";" read -ra input <<< $par_input
+
+$(which falco) \
+  ${par_nogroup:+--nogroup} \
+  ${par_contaminants:+--contaminants "$par_contaminants"} \
+  ${par_adapters:+--adapters "$par_adapters"} \
+  ${par_limits:+--limits "$par_limits"} \
+  ${par_subsample:+-subsample $par_subsample} \
+  ${par_bisulfite:+-bisulfite} \
+  ${par_reverse_compliment:+-reverse-compliment} \
+  ${par_outdir:+--outdir "$par_outdir"} \
+  ${par_format:+--format "$par_format"} \
+  ${par_data_filename:+-data-filename "$par_data_filename"} \
+  ${par_report_filename:+-report-filename "$par_report_filename"} \
+  ${par_summary_filename:+-summary-filename "$par_summary_filename"} \
+  ${input[*]}
diff --git a/src/falco/test.sh b/src/falco/test.sh
new file mode 100644
index 00000000..3f1dc47a
--- /dev/null
+++ b/src/falco/test.sh
@@ -0,0 +1,79 @@
+#!/bin/bash
+
+set -e
+
+echo "> Prepare test data"
+
+# We use data from this repo: https://github.com/hartwigmedical/testData
+echo ">> Fetching and preparing test data"
+fastq1="https://github.com/hartwigmedical/testdata/raw/master/100k_reads_hiseq/TESTX/TESTX_H7YRLADXX_S1_L001_R1_001.fastq.gz"
+fastq2="https://github.com/hartwigmedical/testdata/raw/master/100k_reads_hiseq/TESTX/TESTX_H7YRLADXX_S1_L001_R2_001.fastq.gz"
+TMPDIR=$(mktemp -d "$meta_temp_dir/$meta_functionality_name-XXXXXX")
+function clean_up {
+  [[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
+}
+trap clean_up EXIT
+
+test_data_dir="$TMPDIR/test_data"
+
+mkdir $test_data_dir
+wget -q $fastq1 -O $test_data_dir/R1.fastq.gz
+wget -q $fastq2 -O $test_data_dir/R2.fastq.gz
+
+echo ">> Run falco on test data, output to dir"
+echo ">>> Run falco"
+$meta_executable \
+  --input "$test_data_dir/R1.fastq.gz;$test_data_dir/R2.fastq.gz" \
+  --outdir "$TMPDIR/output1"
+
+echo ">>> Checking whether output exists"
+[ ! -d "$TMPDIR/output1" ] && echo "Output directory not created" && exit 1
+[ ! -f "$TMPDIR/output1/R1.fastq.gz_fastqc_report.html" ] && echo "Report not created" && exit 1
+[ ! -f "$TMPDIR/output1/R1.fastq.gz_summary.txt" ] && echo "Summary not created" && exit 1
+[ ! -f "$TMPDIR/output1/R1.fastq.gz_fastqc_data.txt" ] && echo "fastqc_data not created" && exit 1
+[ ! -f "$TMPDIR/output1/R2.fastq.gz_fastqc_report.html" ] && echo "Report not created" && exit 1
+[ ! -f "$TMPDIR/output1/R2.fastq.gz_summary.txt" ] && echo "Summary not created" && exit 1
+[ ! -f "$TMPDIR/output1/R2.fastq.gz_fastqc_data.txt" ] && echo "fastqc_data not created" && exit 1
+
+echo ">>> cleanup"
+rm -rf "$TMPDIR/output1"
+
+echo ">> Run falco on test data, output to individual files"
+echo ">>> Please note this is only possible for 1 input fastq file!"
+echo ">>> Run falco"
+$meta_executable \
+  --input "$test_data_dir/R1.fastq.gz" \
+  --data_filename "$TMPDIR/output2/data.txt" \
+  --report_filename "$TMPDIR/output2/report.html" \
+  --summary_filename "$TMPDIR/output2/summary.txt" \
+  --outdir "$TMPDIR/output2/"
+
+echo ">>> Checking whether output exists"
+[ ! -d "$TMPDIR/output2" ] && echo "Output directory not created" && exit 1
+[ ! -f "$TMPDIR/output2/report.html" ] && echo "Report not created" && exit 1
+[ ! -f "$TMPDIR/output2/summary.txt" ] && echo "Summary not created" && exit 1
+[ ! -f "$TMPDIR/output2/data.txt" ] && echo "fastqc_data not created" && exit 1
+
+echo ">>> cleanup"
+rm -rf $TMPDIR/output2/
+
+echo ">> Run falco on test data, subsample"
+echo ">>> Run falco"
+$meta_executable \
+  --input "$test_data_dir/R1.fastq.gz" \
+  --data_filename "$TMPDIR/output3/data.txt" \
+  --report_filename "$TMPDIR/output3/report.html" \
+  --summary_filename "$TMPDIR/output3/summary.txt" \
+  --subsample 100 \
+  --outdir "$TMPDIR/output3"
+
+echo ">>> Checking whether output exists"
+[ ! -d "$TMPDIR/output3" ] && echo "Output directory not created" && exit 1
+[ ! -f "$TMPDIR/output3/report.html" ] && echo "Report not created" && exit 1
+[ ! -f "$TMPDIR/output3/summary.txt" ] && echo "Summary not created" && exit 1
+[ ! -f "$TMPDIR/output3/data.txt" ] && echo "fastqc_data not created" && exit 1
+
+echo ">>> cleanup"
+rm -rf "$TMPDIR/output3/"
+
+echo "All tests succeeded!"
diff --git a/src/multiqc/config.vsh.yaml b/src/multiqc/config.vsh.yaml
new file mode 100644
index 00000000..0a3a784b
--- /dev/null
+++ b/src/multiqc/config.vsh.yaml
@@ -0,0 +1,229 @@
+name: "multiqc"
+description: |
+  MultiQC aggregates results from bioinformatics analyses across many samples into a single report.
+  It searches a given directory for analysis logs and compiles a HTML report. It's a general use tool, perfect for summarising the output from numerous bioinformatics tools.
+info:
+  keywords: [QC, html report, aggregate analysis]
+  links:
+    homepage: https://multiqc.info/
+    documentation: https://multiqc.info/docs/
+    repository: https://github.com/MultiQC/MultiQC
+  references:
+    doi: 10.1093/bioinformatics/btw354
+  licence: GPL v3 or later
+
+argument_groups:
+  - name: "Input"
+    arguments:
+      - name: "--input"
+        type: file
+        multiple: true
+        required: true
+        example: data/results/
+        description: |
+          File paths to be searched for analysis results to be included in the report.
+
+  - name: "Ouput"
+    arguments:
+      - name: "--output_report"
+        type: file
+        direction: output
+        must_exist: false
+        example: multiqc_report.html
+        description: |
+          Filepath of the generated report.
+      - name: "--output_data"
+        type: file
+        required: false
+        direction: output
+        example: multiqc_data
+        must_exist: false
+        description: |
+          Output directory for parsed data files. If not provided, parsed data will not be published.
+      - name: "--output_plots"
+        type: file
+        required: false
+        direction: output
+        must_exist: false
+        example: multiqc_plots
+        description: |
+          Output directory for generated plots. If not provided, plots will not be published.
+
+  - name: "Modules and analyses to run"
+    arguments:
+      - name: "--include_modules"
+        type: string
+        multiple: true
+        multiple_sep: ","
+        example: fastqc,cutadapt
+        description: Use only these module
+      - name: "--exclude_modules"
+        type: string
+        multiple: true
+        multiple_sep: ","
+        example: fastqc,cutadapt
+        description: Do not use only these modules
+      - name: "--ignore_analysis"
+        type: string
+        multiple: true
+        multiple_sep: ","
+        example: run_one/*,run_two/*
+      - name: "--ignore_samples"
+        type: string
+        multiple: true
+        multiple_sep: ","
+        example: sample_1*,sample_3*
+      - name: "--ignore_symlinks"
+        type: boolean_true
+        description: Ignore symlinked directories and files
+
+  - name: "Sample name handling"
+    arguments:
+      - name: "--dirs"
+        type: boolean_true
+        description: Prepend directory to sample names to avoid clashing filenames
+      - name: "--dirs_depth"
+        type: integer
+        description: Prepend n directories to sample names. Negative number to take from start of path.
+      - name: "--full_names"
+        type: boolean_true
+        description: Do not clean the sample names (leave as full file name)
+      - name: "--fn_as_s_name"
+        type: boolean_true
+        description: Use the log filename as the sample name
+      - name: "--replace_names"
+        type: file
+        example: replace_names.tsv
+        description: TSV file to rename sample names during report generation
+
+  - name: "Report Customisation"
+    arguments:
+      - name: "--title"
+        type: string
+        description: |
+          Report title. Printed as page header, used for filename if not otherwise specified.
+      - name: "--comment"
+        type: string
+        description: |
+          Custom comment, will be printed at the top of the report.
+      - name: "--template"
+        type: string
+        choices: [default, gathered, geo, highcharts, sections, simple]
+        description: |
+          Report template to use.
+      - name: "--sample_names"
+        type: file
+        description: |
+          TSV file containing alternative sample names for renaming buttons in the report.
+        example: sample_names.tsv
+      - name: "--sample_filters"
+        type: file
+        description: |
+          TSV file containing show/hide patterns for the report
+        example: sample_filters.tsv
+      - name: "--custom_css_file"
+        type: file
+        description: |
+          Custom CSS file to add to the final report
+        example: custom_style_sheet.css
+      - name: "--profile_runtime"
+        type: boolean_true
+        description: |
+          Add analysis of how long MultiQC takes to run to the report
+
+  - name: "MultiQC behaviour"
+    arguments:
+      - name: "--verbose"
+        type: boolean_true
+        description: |
+          Increase output verbosity.
+      - name: "--quiet"
+        type: boolean_true
+        description: |
+          Only show log warnings
+      - name: "--strict"
+        type: boolean_true
+        description: |
+          Don't catch exceptions, run additional code checks to help development.
+      - name: "--development"
+        type: boolean_true
+        description: |
+          Development mode. Do not compress and minimise JS, export uncompressed plot data.
+      - name: "--require_logs"
+        type: boolean_true
+        description: |
+          Require all explicitly requested modules to have log files. If not, MultiQC will exit with an error.
+      - name: "--no_megaqc_upload"
+        type: boolean_true
+        description: |
+          Don't upload generated report to MegaQC, even if MegaQC options are found.
+      - name: "--no_ansi"
+        type: boolean_true
+        description: |
+          Disable coloured log output.
+      - name: "--cl_config"
+        type: string
+        required: false
+        description: |
+          YAML formatted string that allows to customize MultiQC behaviour like input file detection.
+        example: "qualimap_config: { general_stats_coverage: [20,40,200] }"
+
+  - name: "Output format"
+    arguments:
+      - name: "--flat"
+        type: boolean_true
+        description: |
+          Use only flat plots (static images).
+      - name: "--interactive"
+        type: boolean_true
+        description: |
+          Use only interactive plots (in-browser Javascript).
+      - name: "--data_dir"
+        type: boolean_true
+        description: |
+          Force the parsed data directory to be created.
+      - name: "--no_data_dir"
+        type: boolean_true
+        description: |
+          Prevent the parsed data directory from being created.
+      - name: "--zip_data_dir"
+        type: boolean_true
+        description: |
+          Compress the data directory.
+      - name: "--data_format"
+        type: string
+        choices: [tsv, csv, json, yaml]
+        description: |
+          Output parsed data in a different format than the default 'txt'.
+      - name: "--pdf"
+        type: boolean_true
+        description: |
+          Creates PDF report with the 'simple' template. Requires Pandoc to be installed.
+
+resources:
+  - type: bash_script
+    path: script.sh
+
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - type: file
+    path: test_data
+
+engines:
+  - type: docker
+    image: quay.io/biocontainers/multiqc:1.21--pyhdfd78af_0
+    setup:
+      - type: docker
+        run: |
+          multiqc --version | sed 's/multiqc, version\s\(.*\)/multiqc: "\1"/' > /var/software_versions.txt
+    test_setup:
+      - type: apt
+        packages:
+          - jq
+
+runners:
+  - type: executable
+  - type: nextflow
+
+
diff --git a/src/multiqc/help.txt b/src/multiqc/help.txt
new file mode 100644
index 00000000..9509e720
--- /dev/null
+++ b/src/multiqc/help.txt
@@ -0,0 +1,67 @@
+ ```bash
+multiqc --help
+```
+
+/// MultiQC 🔍 | v1.20                                                                                                                                                                          
+                                                                                                                                                                                                 
+ Usage: multiqc [OPTIONS] [ANALYSIS DIRECTORY]                                                                                                                                                   
+                                                                                                                                                                                                 
+ MultiQC aggregates results from bioinformatics analyses across many samples into a single report.                                                                                               
+ It searches a given directory for analysis logs and compiles a HTML report. It's a general use tool, perfect for summarising the output from numerous bioinformatics tools.                     
+ To run, supply with one or more directory to scan for analysis results. For example, to run in the current working directory, use 'multiqc .'                                                   
+                                                                                                                                                                                                 
+╭─ Main options ────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╮
+│ --force            -f  Overwrite any existing reports                                                                                                                                         │
+│ --config           -c  Specific config file to load, after those in MultiQC dir / home dir / working dir. (PATH)                                                                              │
+│ --cl-config            Specify MultiQC config YAML on the command line (TEXT)                                                                                                                 │
+│ --filename         -n  Report filename. Use 'stdout' to print to standard out. (TEXT)                                                                                                         │
+│ --outdir           -o  Create report in the specified output directory. (TEXT)                                                                                                                │
+│ --ignore           -x  Ignore analysis files (GLOB EXPRESSION)                                                                                                                                │
+│ --ignore-samples       Ignore sample names (GLOB EXPRESSION)                                                                                                                                  │
+│ --ignore-symlinks      Ignore symlinked directories and files                                                                                                                                 │
+│ --file-list        -l  Supply a file containing a list of file paths to be searched, one per row                                                                                              │
+╰───────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯
+╭─ Choosing modules to run ─────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╮
+│ --module   -m  Use only this module. Can specify multiple times. (MODULE NAME)                                                                                                                │
+│ --exclude  -e  Do not use this module. Can specify multiple times. (MODULE NAME)                                                                                                              │
+╰───────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯
+╭─ Sample handling ─────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╮
+│ --dirs           -d   Prepend directory to sample names                                                                                                                                       │
+│ --dirs-depth     -dd  Prepend n directories to sample names. Negative number to take from start of path. (INTEGER)                                                                            │
+│ --fullnames      -s   Do not clean the sample names (leave as full file name)                                                                                                                 │
+│ --fn_as_s_name        Use the log filename as the sample name                                                                                                                                 │
+│ --replace-names       TSV file to rename sample names during report generation (PATH)                                                                                                         │
+╰───────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯
+╭─ Report customisation ────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╮
+│ --title            -i  Report title. Printed as page header, used for filename if not otherwise specified. (TEXT)                                                                             │
+│ --comment          -b  Custom comment, will be printed at the top of the report. (TEXT)                                                                                                       │
+│ --template         -t  Report template to use. (default|gathered|geo|highcharts|sections|simple)                                                                                              │
+│ --sample-names         TSV file containing alternative sample names for renaming buttons in the report (PATH)                                                                                 │
+│ --sample-filters       TSV file containing show/hide patterns for the report (PATH)                                                                                                           │
+│ --custom-css-file      Custom CSS file to add to the final report (PATH)                                                                                                                      │
+╰───────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯
+╭─ Output files ────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╮
+│ --flat          -fp  Use only flat plots (static images)                                                                                                                                      │
+│ --interactive   -ip  Use only interactive plots (in-browser Javascript)                                                                                                                       │
+│ --export        -p   Export plots as static images in addition to the report                                                                                                                  │
+│ --data-dir           Force the parsed data directory to be created.                                                                                                                           │
+│ --no-data-dir        Prevent the parsed data directory from being created.                                                                                                                    │
+│ --data-format   -k   Output parsed data in a different format. (tsv|csv|json|yaml)                                                                                                            │
+│ --zip-data-dir  -z   Compress the data directory.                                                                                                                                             │
+│ --no-report          Do not generate a report, only export data and plots                                                                                                                     │
+│ --pdf                Creates PDF report with the 'simple' template. Requires Pandoc to be installed.                                                                                          │
+╰───────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯
+╭─ MultiQC behaviour ───────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╮
+│ --verbose            -v  Increase output verbosity. (INTEGER RANGE)                                                                                                                           │
+│ --quiet              -q  Only show log warnings                                                                                                                                               │
+│ --strict                 Don't catch exceptions, run additional code checks to help development.                                                                                              │
+│ --development,--dev      Development mode. Do not compress and minimise JS, export uncompressed plot data                                                                                     │
+│ --require-logs           Require all explicitly requested modules to have log files. If not, MultiQC will exit with an error.                                                                 │
+│ --profile-runtime        Add analysis of how long MultiQC takes to run to the report                                                                                                          │
+│ --no-megaqc-upload       Don't upload generated report to MegaQC, even if MegaQC options are found                                                                                            │
+│ --no-ansi                Disable coloured log output                                                                                                                                          │
+│ --version                Show the version and exit.                                                                                                                                           │
+│ --help               -h  Show this message and exit.                                                                                                                                          │
+╰───────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯
+                                                                                                                                                                                                 
+ See http://multiqc.info for more details.      
\ No newline at end of file
diff --git a/src/multiqc/script.sh b/src/multiqc/script.sh
new file mode 100755
index 00000000..6353eb11
--- /dev/null
+++ b/src/multiqc/script.sh
@@ -0,0 +1,130 @@
+#!/bin/bash
+
+# disable flags
+[[ "$par_ignore_symlinks" == "false" ]] && unset par_ignore_symlinks
+[[ "$par_dirs" == "false" ]] && unset par_dirs
+[[ "$par_full_names" == "false" ]] && unset par_full_names
+[[ "$par_fn_as_s_name" == "false" ]] && unset par_fn_as_s_name
+[[ "$par_profile_runtime" == "false" ]] && unset par_profile_runtime
+[[ "$par_verbose" == "false" ]] && unset par_verbose
+[[ "$par_quiet" == "false" ]] && unset par_quiet
+[[ "$par_strict" == "false" ]] && unset par_strict
+[[ "$par_development" == "false" ]] && unset par_development
+[[ "$par_require_logs" == "false" ]] && unset par_require_logs
+[[ "$par_no_megaqc_upload" == "false" ]] && unset par_no_megaqc_upload
+[[ "$par_no_ansi" == "false" ]] && unset par_no_ansi
+[[ "$par_flat" == "false" ]] && unset par_flat
+[[ "$par_interactive" == "false" ]] && unset par_interactive
+[[ "$par_static_plot_export" == "false" ]] && unset par_static_plot_export
+[[ "$par_data_dir" == "false" ]] && unset par_data_dir
+[[ "$par_no_data_dir" == "false" ]] && unset par_no_data_dir
+[[ "$par_zip_data_dir" == "false" ]] && unset par_zip_data_dir
+[[ "$par_pdf" == "false" ]] && unset par_pdf
+
+
+# handle inputs
+out_dir=$(dirname "$par_output_report")
+output_report_file=$(basename "$par_output_report")
+report_name="${output_report_file%.*}"
+
+# handle outputs
+[[ -z "$par_output_report" ]] && no_report=true
+[[ -z "$par_output_data" ]] && no_data_dir=true
+[[ ! -z "$par_output_data" ]] && data_dir=true
+[[ ! -z "$par_output_plots" ]] && export=true
+
+# handle multiples
+IFS=";" read -ra inputs <<< $par_input
+
+if [[ -n "$par_include_modules" ]]; then
+    include_modules=""
+    IFS="," read -ra incl_modules <<< $par_include_modules
+    for i in "${incl_modules[@]}"; do
+        include_modules+="--include $i "
+    done
+    unset IFS
+fi
+
+if [[ -n "$par_exclude_modules" ]]; then
+    exclude_modules=""
+    IFS="," read -ra excl_modules <<< $par_exclude_modules
+    for i in "${excl_modules[@]}"; do
+        exclude_modules+="--exclude $i"
+    done
+    unset IFS
+fi
+
+if [[ -n "$par_ignore_analysis" ]]; then
+    ignore=""
+    IFS="," read -ra ignore_analysis <<< $par_ignore_analysis
+    for i in "${ignore_analysis[@]}"; do
+        ignore+="--ignore $i "
+    done
+    unset IFS
+fi
+
+if [[ -n "$par_ignore_samples" ]]; then
+    ignore_samples=""
+    IFS="," read -ra ign_samples <<< $par_ignore_samples
+    for i in "${ign_samples[@]}"; do
+        ignore_samples+="--ignore-samples $i"
+    done
+    unset IFS
+fi
+
+# run multiqc
+multiqc \
+    ${par_output_report:+--filename "$report_name"} \
+    ${out_dir:+--outdir "$out_dir"} \
+    ${no_report:+--no-report} \
+    ${no_data_dir:+--no-data-dir} \
+    ${data_dir:+--data-dir} \
+    ${export:+--export} \
+    ${par_title:+--title "$par_title"} \
+    ${par_comment:+--comment "$par_comment"} \
+    ${par_template:+--template "$par_template"} \
+    ${par_sample_names:+--sample-names "$par_sample_names"} \
+    ${par_sample_filters:+--sample-filters "$par_sample_filters"} \
+    ${par_custom_css_file:+--custom-css-file "$par_custom_css_file"} \
+    ${par_profile_runtime:+--profile-runtime} \
+    ${par_dirs:+--dirs} \
+    ${par_dirs_depth:+--dirs-depth "$par_dirs_depth"} \
+    ${par_full_names:+--full-names} \
+    ${par_fn_as_s_name:+--fn-as-s-name} \
+    ${par_ignore_names:+--ignore-names "$par_ignore_names"} \
+    ${par_ignore_symlinks:+--ignore-symlinks} \
+    ${ignore_samples} \
+    ${ignore} \
+    ${exclude_modules} \
+    ${include_modules} \
+    ${par_include_modules:+--include-modules "$par_include_modules"} \
+    ${par_data_format:+--data-format "$par_data_format"} \
+    ${par_cl_config:+--cl-config "$par_cl_config"} \
+    ${par_zip_data_dir:+--zip-data-dir} \
+    ${par_pdf:+--pdf} \
+    ${par_interactive:+--interactive} \
+    ${par_flat:+--flat} \
+    ${par_verbose:+--verbose} \
+    ${par_quiet:+--quiet} \
+    ${par_strict:+--strict} \
+    ${par_no_megaqc_upload:+--no-megaqc-upload} \
+    ${par_no_ansi:+--no-ansi} \
+    ${par_profile_runtime:+--profile-runtime} \
+    ${par_require_logs:+--require-logs} \
+    ${par_development:+--development} \
+    --force \
+    "${inputs[@]}" 
+
+# Move outputs
+
+if [[ -n "$par_output_data" ]] && [[ -d "${out_dir}/${report_name}_data" ]]; then
+    mv "${out_dir}/${report_name}_data" "$par_output_data"
+elif [[ -n "$par_output_data" ]] && [[ ! -d "${out_dir}/${report_name}_data" ]]; then
+    echo "WARNING: Data could not be saved because data folder was not generated by multiqc. This could be due to filtering out of modules or samples."
+fi
+
+if [[ -n "$par_output_plots" ]] && [[ -d "${out_dir}/${report_name}_plots" ]]; then
+    mv "${out_dir}/${report_name}_plots" "$par_output_plots"
+elif [[ -n "$par_output_plots" ]] && [[ ! -d "${out_dir}/${report_name}_plots" ]]; then
+    echo "WARNING: Plots could not be saved because plots folder was not generated by multiqc. This could be due to filtering out of modules or samples."
+fi
diff --git a/src/multiqc/test.sh b/src/multiqc/test.sh
new file mode 100644
index 00000000..a2844f54
--- /dev/null
+++ b/src/multiqc/test.sh
@@ -0,0 +1,44 @@
+#!/bin/bash
+
+echo ">>> Testing input/output handling"
+
+"$meta_executable" \
+  --input "$meta_resources_dir/test_data/" \
+  --output_report test1.html \
+  --output_data data1 \
+  --output_plots plots1 \
+  --quiet
+
+[ ! -f test1.html ] && echo "MultiQC report does not exist!" && exit 1
+[ ! -d data1 ] && echo "MultiQC data directory does not exist!" && exit 1
+[ ! -d plots1 ] && echo "MultiQC plots directory does not exist!" && exit 1
+
+echo ">>> Testing module exclusion"
+
+"$meta_executable" \
+  --input "$meta_resources_dir/test_data/" \
+  --output_report test2.html \
+  --output_data data2 \
+  --output_plots plots2 \
+  --exclude_modules samtools \
+  --quiet
+
+[ -f test2.html ] && echo "MultiQC report should not exist!" && exit 1
+[ -d data2 ] && echo "MultiQC data directory should not exist!" && exit 1
+[ -d plots2 ] && echo "MultiQC plots directory should not exist!" && exit 1
+
+echo ">>> Testing sample exclusion"
+
+"$meta_executable" \
+  --input "$meta_resources_dir/test_data/" \
+  --output_report test3.html \
+  --output_data data3 \
+  --ignore_samples a \
+  --quiet
+
+key_to_check=".report_general_stats_data[0].a"
+json_file="data3/multiqc_data.json"
+[[ $(jq -r "$key_to_check" "$json_file") != null ]] && echo "$key_to_check should not be present in $json_file" && exit 1
+
+echo "All tests succeeded!"
+exit 0
\ No newline at end of file
diff --git a/src/multiqc/test_data/a.txt b/src/multiqc/test_data/a.txt
new file mode 100644
index 00000000..1be51d70
--- /dev/null
+++ b/src/multiqc/test_data/a.txt
@@ -0,0 +1,1504 @@
+# This file was produced by samtools stats (1.3+htslib-1.3) and can be plotted using plot-bamstats
+# This file contains statistics for all reads.
+# The command line was:  stats mapped/a.bam
+# CHK, Checksum	[2]Read Names	[3]Sequences	[4]Qualities
+# CHK, CRC32 of reads which passed filtering followed by addition (32bit overflow)
+CHK	db35d7d5	ec933459	1f587026
+# Summary Numbers. Use `grep ^SN | cut -f 2-` to extract this part.
+SN	raw total sequences:	21838387
+SN	filtered sequences:	0
+SN	sequences:	21838387
+SN	is sorted:	1
+SN	1st fragments:	21838387
+SN	last fragments:	0
+SN	reads mapped:	21231961
+SN	reads mapped and paired:	0	# paired-end technology bit set + both mates mapped
+SN	reads unmapped:	606426
+SN	reads properly paired:	0	# proper-pair bit set
+SN	reads paired:	0	# paired-end technology bit set
+SN	reads duplicated:	3096782	# PCR or optical duplicate bit set
+SN	reads MQ0:	4882153	# mapped and MQ=0
+SN	reads QC failed:	0
+SN	non-primary alignments:	0
+SN	total length:	1090509989	# ignores clipping
+SN	bases mapped:	1060219802	# ignores clipping
+SN	bases mapped (cigar):	1060219787	# more accurate
+SN	bases trimmed:	0
+SN	bases duplicated:	154717551
+SN	mismatches:	6032903	# from NM fields
+SN	error rate:	5.690238e-03	# mismatches / bases mapped (cigar)
+SN	average length:	49
+SN	maximum length:	50
+SN	average quality:	37.0
+SN	insert size average:	0.0
+SN	insert size standard deviation:	0.0
+SN	inward oriented pairs:	0
+SN	outward oriented pairs:	0
+SN	pairs with other orientation:	0
+SN	pairs on different chromosomes:	0
+# First Fragment Qualitites. Use `grep ^FFQ | cut -f 2-` to extract this part.
+# Columns correspond to qualities and rows to cycles. First column is the cycle number.
+FFQ	1	0	0	51315	0	0	0	0	0	0	0	0	0	0	0	0	382312	0	0	0	0	0	0	178198	0	0	0	0	1338772	0	0	0	0	0	19887790	0	0	0	0	0	0	0	0
+FFQ	2	0	0	5115	0	0	0	0	0	0	0	0	0	0	0	0	275192	0	0	0	0	0	0	147400	0	0	0	0	1284560	0	0	0	0	0	20126120	0	0	0	0	0	0	0	0
+FFQ	3	0	0	5128	0	0	0	0	0	0	0	0	0	0	0	0	191502	0	0	0	0	0	0	150841	0	0	0	0	1285815	0	0	0	0	0	20205101	0	0	0	0	0	0	0	0
+FFQ	4	0	0	5145	0	0	0	0	0	0	0	0	0	0	0	0	146549	0	0	0	0	0	0	39295	0	0	0	0	471059	0	0	0	0	0	1708658	0	0	0	19467681	0	0	0	0
+FFQ	5	0	0	5171	0	0	0	0	0	0	0	0	0	0	0	0	182896	0	0	0	0	0	0	41859	0	0	0	0	541845	0	0	0	0	0	1799240	0	0	0	19267376	0	0	0	0
+FFQ	6	0	0	5207	0	0	0	4751	0	0	0	0	0	0	0	0	177726	0	0	0	0	0	0	50754	0	0	0	0	533328	0	0	0	0	0	1789862	0	0	0	19276759	0	0	0	0
+FFQ	7	0	0	5265	0	0	0	5303	0	0	0	0	0	0	0	0	189482	0	0	0	0	0	0	50374	0	0	0	0	545491	0	0	0	0	0	1801670	0	0	0	19240802	0	0	0	0
+FFQ	8	0	0	5321	0	0	0	5251	0	0	0	0	0	0	0	0	189946	0	0	0	0	0	0	50759	0	0	0	0	544729	0	0	0	0	0	1805074	0	0	0	19237307	0	0	0	0
+FFQ	9	0	0	5412	0	0	0	5572	0	0	0	0	0	0	0	0	194980	0	0	0	0	0	0	50487	0	0	0	0	546813	0	0	0	0	0	1809993	0	0	0	19225130	0	0	0	0
+FFQ	10	0	0	5522	0	0	0	5109	0	0	0	0	0	0	0	0	187331	0	0	0	0	0	0	52119	0	0	0	0	547170	0	0	0	0	0	1806426	0	0	0	19234710	0	0	0	0
+FFQ	11	0	0	5659	0	0	0	5437	0	0	0	0	0	0	0	0	188095	0	0	0	0	0	0	53798	0	0	0	0	550305	0	0	0	0	0	1815355	0	0	0	19219738	0	0	0	0
+FFQ	12	0	0	5842	0	0	0	5812	0	0	0	0	0	0	0	0	191987	0	0	0	0	0	0	54137	0	0	0	0	551697	0	0	0	0	0	1820134	0	0	0	19208778	0	0	0	0
+FFQ	13	0	0	6054	0	0	0	5991	0	0	0	0	0	0	0	0	190425	0	0	0	0	0	0	55749	0	0	0	0	554090	0	0	0	0	0	1824863	0	0	0	19201215	0	0	0	0
+FFQ	14	0	0	6305	0	0	0	6562	0	0	0	0	0	0	0	0	194459	0	0	0	0	0	0	56577	0	0	0	0	553776	0	0	0	0	0	1736245	0	0	0	6044499	0	0	13239964	0
+FFQ	15	0	0	6575	0	0	0	6948	0	0	0	0	0	0	0	0	200015	0	0	0	0	0	0	58113	0	0	0	0	558164	0	0	0	0	0	1741159	0	0	0	6049860	0	0	13217553	0
+FFQ	16	0	0	6884	0	0	0	7121	0	0	0	0	0	0	0	0	201645	0	0	0	0	0	0	59457	0	0	0	0	560449	0	0	0	0	0	1751983	0	0	0	6029168	0	0	13221680	0
+FFQ	17	0	0	7255	0	0	0	7367	0	0	0	0	0	0	0	0	199780	0	0	0	0	0	0	63085	0	0	0	0	565569	0	0	0	0	0	1761217	0	0	0	6046012	0	0	13188102	0
+FFQ	18	0	0	7720	0	0	0	8336	0	0	0	0	0	0	0	0	200938	0	0	0	0	0	0	65311	0	0	0	0	558465	0	0	0	0	0	1759662	0	0	0	6058023	0	0	13179932	0
+FFQ	19	0	0	8413	0	0	0	8308	0	0	0	0	0	0	0	0	201721	0	0	0	0	0	0	69098	0	0	0	0	563047	0	0	0	0	0	1769492	0	0	0	5699288	0	0	13519020	0
+FFQ	20	0	0	8973	0	0	0	9516	0	0	0	0	0	0	0	0	201161	0	0	0	0	0	0	74284	0	0	0	0	562610	0	0	0	0	0	1778241	0	0	0	5767457	0	0	13436145	0
+FFQ	21	0	0	9857	0	0	0	10500	0	0	0	0	0	0	0	0	200349	0	0	0	0	0	0	80072	0	0	0	0	557657	0	0	0	0	0	1780395	0	0	0	5847132	0	0	13352425	0
+FFQ	22	0	0	11063	0	0	0	12270	0	0	0	0	0	0	0	0	204602	0	0	0	0	0	0	89896	0	0	0	0	558198	0	0	0	0	0	1791483	0	0	0	5932912	0	0	13237963	0
+FFQ	23	0	0	12768	0	0	0	14297	0	0	0	0	0	0	0	0	207883	0	0	0	0	0	0	99992	0	0	0	0	556435	0	0	0	0	0	1802873	0	0	0	6033565	0	0	13110574	0
+FFQ	24	0	0	14914	0	0	0	16397	0	0	0	0	0	0	0	0	207240	0	0	0	0	0	0	111512	0	0	0	0	545672	0	0	0	0	0	1806750	0	0	0	6007638	0	0	13128264	0
+FFQ	25	0	0	17715	0	0	0	20138	0	0	0	0	0	0	0	0	214768	0	0	0	0	0	0	129032	0	0	0	0	540112	0	0	0	0	0	1819460	0	0	0	6047119	0	0	13050043	0
+FFQ	26	0	0	21240	0	0	0	34290	0	0	0	0	0	0	0	0	249730	0	0	0	0	0	0	144422	0	0	0	0	520807	0	0	0	0	0	1809886	0	0	0	6058279	0	0	12999733	0
+FFQ	27	0	0	24829	0	0	0	43086	0	0	0	0	0	0	0	0	259480	0	0	0	0	0	0	161601	0	0	0	0	518294	0	0	0	0	0	1824722	0	0	0	6047197	0	0	12959178	0
+FFQ	28	0	0	28496	0	0	0	52585	0	0	0	0	0	0	0	0	260264	0	0	0	0	0	0	176084	0	0	0	0	509295	0	0	0	0	0	1839906	0	0	0	6068273	0	0	12903484	0
+FFQ	29	0	0	32506	0	0	0	62389	0	0	0	0	0	0	0	0	254623	0	0	0	0	0	0	189495	0	0	0	0	499599	0	0	0	0	0	1852205	0	0	0	6080516	0	0	12867054	0
+FFQ	30	0	0	36854	0	0	0	73580	0	0	0	0	0	0	0	0	247860	0	0	0	0	0	0	200625	0	0	0	0	495018	0	0	0	0	0	1863132	0	0	0	6112314	0	0	12809004	0
+FFQ	31	0	0	41323	0	0	0	87468	0	0	0	0	0	0	0	0	242078	0	0	0	0	0	0	209555	0	0	0	0	491444	0	0	0	0	0	1867737	0	0	0	6132089	0	0	12766610	0
+FFQ	32	0	0	46286	0	0	0	98002	0	0	0	0	0	0	0	0	232699	0	0	0	0	0	0	213564	0	0	0	0	491302	0	0	0	0	0	1878843	0	0	0	6142018	0	0	12735496	0
+FFQ	33	0	0	51663	0	0	0	106786	0	0	0	0	0	0	0	0	221792	0	0	0	0	0	0	218240	0	0	0	0	491145	0	0	0	0	0	1877911	0	0	0	6158285	0	0	12712271	0
+FFQ	34	0	0	57443	0	0	0	119491	0	0	0	0	0	0	0	0	216326	0	0	0	0	0	0	222138	0	0	0	0	487486	0	0	0	0	0	1875659	0	0	0	6153206	0	0	12706214	0
+FFQ	35	0	0	63864	0	0	0	122385	0	0	0	0	0	0	0	0	210969	0	0	0	0	0	0	227897	0	0	0	0	488945	0	0	0	0	0	1888985	0	0	0	6136699	0	0	12698075	0
+FFQ	36	0	0	70925	0	0	0	127772	0	0	0	0	0	0	0	0	204278	0	0	0	0	0	0	232925	0	0	0	0	489984	0	0	0	0	0	1893912	0	0	0	6147628	0	0	12670239	0
+FFQ	37	0	0	78443	0	0	0	130513	0	0	0	0	0	0	0	0	201817	0	0	0	0	0	0	237205	0	0	0	0	489393	0	0	0	0	0	1901072	0	0	0	6157060	0	0	12641982	0
+FFQ	38	0	0	86727	0	0	0	134572	0	0	0	0	0	0	0	0	201643	0	0	0	0	0	0	245851	0	0	0	0	493135	0	0	0	0	0	1911564	0	0	0	6168370	0	0	12595418	0
+FFQ	39	0	0	96199	0	0	0	136517	0	0	0	0	0	0	0	0	202556	0	0	0	0	0	0	253424	0	0	0	0	496159	0	0	0	0	0	1926927	0	0	0	6191376	0	0	12533859	0
+FFQ	40	0	0	106625	0	0	0	141535	0	0	0	0	0	0	0	0	207572	0	0	0	0	0	0	263379	0	0	0	0	494281	0	0	0	0	0	1936713	0	0	0	6212472	0	0	12474092	0
+FFQ	41	0	0	118435	0	0	0	134585	0	0	0	0	0	0	0	0	207617	0	0	0	0	0	0	271430	0	0	0	0	497097	0	0	0	0	0	1952887	0	0	0	6236465	0	0	12417628	0
+FFQ	42	0	0	132662	0	0	0	134133	0	0	0	0	0	0	0	0	204434	0	0	0	0	0	0	279354	0	0	0	0	498810	0	0	0	0	0	1968372	0	0	0	6267796	0	0	12349794	0
+FFQ	43	0	0	147587	0	0	0	131817	0	0	0	0	0	0	0	0	204674	0	0	0	0	0	0	288492	0	0	0	0	497849	0	0	0	0	0	1975284	0	0	0	6290454	0	0	12298484	0
+FFQ	44	0	0	166442	0	0	0	128205	0	0	0	0	0	0	0	0	201990	0	0	0	0	0	0	298737	0	0	0	0	496519	0	0	0	0	0	1988815	0	0	0	6294537	0	0	12258940	0
+FFQ	45	0	0	190003	0	0	0	124333	0	0	0	0	0	0	0	0	196796	0	0	0	0	0	0	309371	0	0	0	0	499163	0	0	0	0	0	2001867	0	0	0	6259352	0	0	12252716	0
+FFQ	46	0	0	220981	0	0	0	116347	0	0	0	0	0	0	0	0	191467	0	0	0	0	0	0	316096	0	0	0	0	498894	0	0	0	0	0	2007430	0	0	0	6270683	0	0	12210477	0
+FFQ	47	0	0	258782	0	0	0	106166	0	0	0	0	0	0	0	0	185518	0	0	0	0	0	0	319187	0	0	0	0	496114	0	0	0	0	0	2015168	0	0	0	6276041	0	0	12156632	0
+FFQ	48	0	0	310568	0	0	0	93125	0	0	0	0	0	0	0	0	177253	0	0	0	0	0	0	323208	0	0	0	0	501414	0	0	0	0	0	2033190	0	0	0	6270044	0	0	12009645	0
+FFQ	49	0	0	374982	0	0	0	66673	0	0	0	0	0	0	0	0	165208	0	0	0	0	0	0	314721	0	0	0	0	492972	0	0	0	0	0	2005393	0	0	0	6174269	0	0	11627542	0
+FFQ	50	0	0	468205	0	0	0	30279	0	0	0	0	0	0	0	0	157265	0	0	0	0	0	0	309324	0	0	0	0	497388	0	0	0	0	0	2038361	0	0	0	6218900	0	0	11502038	0
+FFQ	51	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+# Last Fragment Qualitites. Use `grep ^LFQ | cut -f 2-` to extract this part.
+# Columns correspond to qualities and rows to cycles. First column is the cycle number.
+LFQ	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	4	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	5	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	6	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	7	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	8	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	9	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	10	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	11	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	12	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	13	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	14	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	15	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	16	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	17	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	18	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	19	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	20	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	21	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	22	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	23	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	24	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	25	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	26	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	27	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	28	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	29	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	30	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	31	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	32	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	33	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	34	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	35	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	36	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	37	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	38	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	39	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	40	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	41	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	42	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	43	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	44	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	45	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	46	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	47	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	48	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	49	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	50	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	51	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+# GC Content of first fragments. Use `grep ^GCF | cut -f 2-` to extract this part.
+GCF	0.75	865
+GCF	1.76	1418
+GCF	2.76	1432
+GCF	3.77	2552
+GCF	4.27	2584
+GCF	5.03	2582
+GCF	5.78	4188
+GCF	6.78	4242
+GCF	7.79	6900
+GCF	8.79	6990
+GCF	9.80	12077
+GCF	10.30	12202
+GCF	11.06	12248
+GCF	11.81	20918
+GCF	12.31	21159
+GCF	13.07	21223
+GCF	13.82	35416
+GCF	14.32	35417
+GCF	14.82	35899
+GCF	15.33	35912
+GCF	16.08	58403
+GCF	16.83	59262
+GCF	17.34	59292
+GCF	17.84	92651
+GCF	18.34	92652
+GCF	18.84	93563
+GCF	19.35	93799
+GCF	20.10	141217
+GCF	20.85	142627
+GCF	21.36	143006
+GCF	21.86	205422
+GCF	22.36	205429
+GCF	22.86	207354
+GCF	23.37	207906
+GCF	23.87	290147
+GCF	24.37	290170
+GCF	24.87	292864
+GCF	25.38	293730
+GCF	25.88	405518
+GCF	26.38	405534
+GCF	26.88	408551
+GCF	27.39	408580
+GCF	27.89	570253
+GCF	28.39	570499
+GCF	28.89	570545
+GCF	29.40	575537
+GCF	29.90	829159
+GCF	30.40	829379
+GCF	30.90	829405
+GCF	31.41	836277
+GCF	31.91	1143374
+GCF	32.66	1143659
+GCF	33.42	1146746
+GCF	33.92	1501224
+GCF	34.42	1501256
+GCF	34.92	1501488
+GCF	35.43	1507360
+GCF	35.93	1778503
+GCF	36.43	1778542
+GCF	36.93	1778582
+GCF	37.44	1783301
+GCF	37.94	1767410
+GCF	38.44	1767928
+GCF	38.94	1768071
+GCF	39.45	1769688
+GCF	39.95	1656761
+GCF	40.45	1657229
+GCF	40.95	1657212
+GCF	41.46	1658172
+GCF	41.96	1509858
+GCF	42.46	1509735
+GCF	42.96	1509702
+GCF	43.47	1509894
+GCF	43.97	1444340
+GCF	44.47	1444607
+GCF	44.97	1444566
+GCF	45.48	1444635
+GCF	45.98	1405845
+GCF	46.48	1405793
+GCF	46.98	1405225
+GCF	47.49	1405190
+GCF	47.99	1360256
+GCF	48.49	1360229
+GCF	49.25	1359649
+GCF	50.25	1272600
+GCF	51.01	1271785
+GCF	51.51	1271790
+GCF	52.01	1115634
+GCF	52.51	1115609
+GCF	53.02	1114429
+GCF	53.52	1114416
+GCF	54.02	921342
+GCF	54.52	921028
+GCF	55.03	921029
+GCF	55.53	919941
+GCF	56.03	716231
+GCF	56.78	715994
+GCF	57.54	715097
+GCF	58.04	532571
+GCF	58.54	527473
+GCF	59.05	527469
+GCF	59.55	526587
+GCF	60.05	376831
+GCF	60.55	372736
+GCF	61.06	372536
+GCF	61.56	371968
+GCF	62.06	252936
+GCF	62.56	249647
+GCF	63.07	249528
+GCF	63.57	249527
+GCF	64.07	163481
+GCF	64.57	161228
+GCF	65.08	161158
+GCF	65.58	161154
+GCF	66.08	101911
+GCF	66.83	100650
+GCF	67.59	100609
+GCF	68.09	60847
+GCF	68.59	59897
+GCF	69.10	59890
+GCF	69.60	59865
+GCF	70.10	36290
+GCF	70.60	35728
+GCF	71.11	35725
+GCF	71.61	35692
+GCF	72.36	23067
+GCF	73.12	22797
+GCF	73.62	22799
+GCF	74.12	15342
+GCF	74.62	15317
+GCF	75.13	15185
+GCF	75.63	15186
+GCF	76.13	10477
+GCF	76.63	10474
+GCF	77.14	10363
+GCF	77.64	10359
+GCF	78.14	7327
+GCF	78.64	7313
+GCF	79.40	7302
+GCF	80.15	5084
+GCF	80.65	5086
+GCF	81.16	5049
+GCF	81.66	5047
+GCF	82.16	3472
+GCF	82.66	3470
+GCF	83.42	3464
+GCF	84.17	2302
+GCF	84.67	2303
+GCF	85.43	2287
+GCF	86.18	1488
+GCF	86.68	1487
+GCF	87.19	1486
+GCF	87.69	1480
+GCF	88.44	841
+GCF	89.20	842
+GCF	89.70	837
+GCF	90.70	472
+GCF	91.71	471
+GCF	92.71	248
+GCF	93.72	244
+GCF	94.97	126
+GCF	96.98	54
+GCF	98.99	21
+# GC Content of last fragments. Use `grep ^GCL | cut -f 2-` to extract this part.
+# ACGT content per cycle. Use `grep ^GCC | cut -f 2-` to extract this part. The columns are: cycle; A,C,G,T base counts as a percentage of all A/C/G/T bases [%]; and N and O counts as a percentage of all A/C/G/T bases [%]
+GCC	1	27.19	22.69	22.08	28.04	0.21	0.00
+GCC	2	27.70	22.16	21.57	28.57	0.00	0.00
+GCC	3	29.07	20.57	19.82	30.54	0.00	0.00
+GCC	4	28.81	20.73	20.29	30.17	0.00	0.00
+GCC	5	29.23	20.17	19.74	30.86	0.00	0.00
+GCC	6	29.00	20.47	19.91	30.62	0.00	0.00
+GCC	7	28.88	20.46	19.88	30.78	0.00	0.00
+GCC	8	28.85	20.74	20.02	30.39	0.00	0.00
+GCC	9	28.51	21.15	20.49	29.85	0.00	0.00
+GCC	10	28.05	21.54	20.95	29.46	0.00	0.00
+GCC	11	28.15	21.56	20.88	29.41	0.00	0.00
+GCC	12	28.32	21.33	20.59	29.77	0.00	0.00
+GCC	13	28.46	21.18	20.45	29.91	0.00	0.00
+GCC	14	28.36	21.04	20.35	30.25	0.00	0.00
+GCC	15	28.47	20.86	20.15	30.51	0.00	0.00
+GCC	16	28.29	21.14	20.36	30.21	0.00	0.00
+GCC	17	28.23	21.10	20.54	30.12	0.00	0.00
+GCC	18	28.35	20.96	20.66	30.02	0.00	0.00
+GCC	19	28.06	21.42	21.18	29.34	0.00	0.00
+GCC	20	28.15	21.29	21.01	29.55	0.00	0.00
+GCC	21	28.09	21.28	21.33	29.31	0.00	0.00
+GCC	22	28.07	21.26	21.17	29.51	0.00	0.00
+GCC	23	28.22	21.06	20.72	30.01	0.00	0.00
+GCC	24	28.13	21.20	20.87	29.80	0.00	0.00
+GCC	25	28.32	20.89	20.58	30.21	0.00	0.00
+GCC	26	28.13	21.20	20.74	29.92	0.00	0.00
+GCC	27	27.96	21.34	20.88	29.81	0.00	0.00
+GCC	28	28.06	21.17	20.89	29.88	0.00	0.00
+GCC	29	27.79	21.60	21.33	29.29	0.00	0.00
+GCC	30	27.84	21.56	21.24	29.35	0.00	0.00
+GCC	31	27.84	21.59	21.14	29.43	0.00	0.00
+GCC	32	27.82	21.68	21.19	29.31	0.00	0.00
+GCC	33	28.14	21.20	20.82	29.84	0.00	0.00
+GCC	34	28.00	21.30	20.78	29.92	0.00	0.00
+GCC	35	28.14	21.19	20.64	30.03	0.00	0.00
+GCC	36	28.22	21.16	20.67	29.95	0.00	0.00
+GCC	37	28.12	21.36	20.65	29.87	0.00	0.00
+GCC	38	28.15	21.52	20.76	29.58	0.00	0.00
+GCC	39	27.94	21.78	21.08	29.19	0.00	0.00
+GCC	40	27.79	21.80	21.18	29.23	0.00	0.00
+GCC	41	27.65	21.89	21.45	29.01	0.00	0.00
+GCC	42	27.94	21.65	21.15	29.26	0.01	0.00
+GCC	43	27.90	21.51	20.95	29.65	0.00	0.00
+GCC	44	27.87	21.68	21.03	29.42	0.00	0.00
+GCC	45	28.27	21.39	20.69	29.66	0.00	0.00
+GCC	46	28.12	21.20	20.68	30.00	0.01	0.00
+GCC	47	28.06	21.43	21.00	29.51	0.00	0.00
+GCC	48	28.08	21.47	20.96	29.48	0.00	0.00
+GCC	49	27.53	21.94	21.68	28.85	0.02	0.00
+GCC	50	28.35	21.19	20.97	29.49	0.00	0.00
+# Insert sizes. Use `grep ^IS | cut -f 2-` to extract this part. The columns are: insert size, pairs total, inward oriented pairs, outward oriented pairs, other pairs
+# Read lengths. Use `grep ^RL | cut -f 2-` to extract this part. The columns are: read length, count
+RL	30	83
+RL	31	94
+RL	32	117
+RL	33	130
+RL	34	144
+RL	35	156
+RL	36	178
+RL	37	205
+RL	38	263
+RL	39	348
+RL	40	525
+RL	41	789
+RL	42	714
+RL	43	456
+RL	44	584
+RL	45	1226
+RL	46	18767
+RL	47	95161
+RL	48	496687
+RL	50	21221760
+# Indel distribution. Use `grep ^ID | cut -f 2-` to extract this part. The columns are: length, number of insertions, number of deletions
+ID	1	64125	118566
+ID	2	11857	15129
+ID	3	1458	1538
+# Indels per cycle. Use `grep ^IC | cut -f 2-` to extract this part. The columns are: cycle, number of insertions (fwd), .. (rev) , number of deletions (fwd), .. (rev)
+IC	1	0	0	0	1
+IC	2	0	203	0	212
+IC	3	0	552	0	878
+IC	4	0	892	0	1911
+IC	5	0	1594	0	2256
+IC	6	0	1567	0	2393
+IC	7	0	1533	0	2675
+IC	8	0	1585	0	2765
+IC	9	0	1556	0	2857
+IC	10	0	1643	0	3115
+IC	11	0	1682	0	2944
+IC	12	0	1707	0	3030
+IC	13	0	1811	0	3124
+IC	14	0	1723	0	3116
+IC	15	0	1838	0	3290
+IC	16	0	1687	0	3202
+IC	17	0	1841	0	3250
+IC	18	0	1850	0	3390
+IC	19	0	1873	0	3484
+IC	20	0	1785	0	3497
+IC	21	0	1763	0	3457
+IC	22	0	1782	0	3406
+IC	23	0	1841	0	3383
+IC	24	0	1828	0	3277
+IC	25	0	1809	0	3322
+IC	26	0	1830	0	3369
+IC	27	0	1890	0	3294
+IC	28	0	1825	0	3385
+IC	29	0	1864	0	3340
+IC	30	0	1899	0	3649
+IC	31	0	1958	0	3771
+IC	32	0	2052	0	3555
+IC	33	0	2086	0	3636
+IC	34	0	1962	0	3649
+IC	35	0	1945	0	3550
+IC	36	0	1972	0	3423
+IC	37	0	1836	0	3536
+IC	38	0	1845	0	3515
+IC	39	0	1883	0	3451
+IC	40	0	1806	0	3300
+IC	41	0	1850	0	3304
+IC	42	0	1710	0	3148
+IC	43	0	1825	0	2849
+IC	44	0	1639	0	2612
+IC	45	0	1708	0	1439
+IC	46	0	1072	0	765
+IC	47	0	659	0	340
+IC	48	0	288	0	118
+IC	49	0	91	0	0
+# Coverage distribution. Use `grep ^COV | cut -f 2-` to extract this part.
+COV	[1-1]	1	609977704
+COV	[2-2]	2	115063033
+COV	[3-3]	3	16119927
+COV	[4-4]	4	2001769
+COV	[5-5]	5	294243
+COV	[6-6]	6	82570
+COV	[7-7]	7	41437
+COV	[8-8]	8	27141
+COV	[9-9]	9	19572
+COV	[10-10]	10	15755
+COV	[11-11]	11	12467
+COV	[12-12]	12	10784
+COV	[13-13]	13	8648
+COV	[14-14]	14	7758
+COV	[15-15]	15	6163
+COV	[16-16]	16	5267
+COV	[17-17]	17	4349
+COV	[18-18]	18	3615
+COV	[19-19]	19	3296
+COV	[20-20]	20	2835
+COV	[21-21]	21	2708
+COV	[22-22]	22	2026
+COV	[23-23]	23	1585
+COV	[24-24]	24	1605
+COV	[25-25]	25	1606
+COV	[26-26]	26	1387
+COV	[27-27]	27	1529
+COV	[28-28]	28	1270
+COV	[29-29]	29	1185
+COV	[30-30]	30	1228
+COV	[31-31]	31	1101
+COV	[32-32]	32	1125
+COV	[33-33]	33	1032
+COV	[34-34]	34	935
+COV	[35-35]	35	880
+COV	[36-36]	36	985
+COV	[37-37]	37	1009
+COV	[38-38]	38	915
+COV	[39-39]	39	838
+COV	[40-40]	40	828
+COV	[41-41]	41	837
+COV	[42-42]	42	894
+COV	[43-43]	43	903
+COV	[44-44]	44	902
+COV	[45-45]	45	780
+COV	[46-46]	46	796
+COV	[47-47]	47	854
+COV	[48-48]	48	804
+COV	[49-49]	49	755
+COV	[50-50]	50	728
+COV	[51-51]	51	753
+COV	[52-52]	52	834
+COV	[53-53]	53	797
+COV	[54-54]	54	806
+COV	[55-55]	55	748
+COV	[56-56]	56	815
+COV	[57-57]	57	814
+COV	[58-58]	58	775
+COV	[59-59]	59	779
+COV	[60-60]	60	744
+COV	[61-61]	61	787
+COV	[62-62]	62	809
+COV	[63-63]	63	788
+COV	[64-64]	64	748
+COV	[65-65]	65	712
+COV	[66-66]	66	614
+COV	[67-67]	67	631
+COV	[68-68]	68	717
+COV	[69-69]	69	660
+COV	[70-70]	70	591
+COV	[71-71]	71	559
+COV	[72-72]	72	666
+COV	[73-73]	73	535
+COV	[74-74]	74	565
+COV	[75-75]	75	526
+COV	[76-76]	76	514
+COV	[77-77]	77	504
+COV	[78-78]	78	493
+COV	[79-79]	79	452
+COV	[80-80]	80	422
+COV	[81-81]	81	511
+COV	[82-82]	82	494
+COV	[83-83]	83	445
+COV	[84-84]	84	495
+COV	[85-85]	85	412
+COV	[86-86]	86	495
+COV	[87-87]	87	447
+COV	[88-88]	88	469
+COV	[89-89]	89	451
+COV	[90-90]	90	522
+COV	[91-91]	91	471
+COV	[92-92]	92	464
+COV	[93-93]	93	476
+COV	[94-94]	94	520
+COV	[95-95]	95	497
+COV	[96-96]	96	445
+COV	[97-97]	97	494
+COV	[98-98]	98	502
+COV	[99-99]	99	490
+COV	[100-100]	100	461
+COV	[101-101]	101	527
+COV	[102-102]	102	533
+COV	[103-103]	103	515
+COV	[104-104]	104	611
+COV	[105-105]	105	471
+COV	[106-106]	106	492
+COV	[107-107]	107	445
+COV	[108-108]	108	467
+COV	[109-109]	109	455
+COV	[110-110]	110	393
+COV	[111-111]	111	394
+COV	[112-112]	112	370
+COV	[113-113]	113	344
+COV	[114-114]	114	324
+COV	[115-115]	115	308
+COV	[116-116]	116	332
+COV	[117-117]	117	272
+COV	[118-118]	118	248
+COV	[119-119]	119	220
+COV	[120-120]	120	308
+COV	[121-121]	121	281
+COV	[122-122]	122	313
+COV	[123-123]	123	259
+COV	[124-124]	124	222
+COV	[125-125]	125	189
+COV	[126-126]	126	219
+COV	[127-127]	127	194
+COV	[128-128]	128	188
+COV	[129-129]	129	181
+COV	[130-130]	130	223
+COV	[131-131]	131	200
+COV	[132-132]	132	180
+COV	[133-133]	133	167
+COV	[134-134]	134	168
+COV	[135-135]	135	153
+COV	[136-136]	136	179
+COV	[137-137]	137	183
+COV	[138-138]	138	175
+COV	[139-139]	139	177
+COV	[140-140]	140	168
+COV	[141-141]	141	180
+COV	[142-142]	142	197
+COV	[143-143]	143	194
+COV	[144-144]	144	170
+COV	[145-145]	145	172
+COV	[146-146]	146	149
+COV	[147-147]	147	173
+COV	[148-148]	148	184
+COV	[149-149]	149	172
+COV	[150-150]	150	168
+COV	[151-151]	151	187
+COV	[152-152]	152	187
+COV	[153-153]	153	174
+COV	[154-154]	154	134
+COV	[155-155]	155	179
+COV	[156-156]	156	153
+COV	[157-157]	157	160
+COV	[158-158]	158	160
+COV	[159-159]	159	171
+COV	[160-160]	160	163
+COV	[161-161]	161	168
+COV	[162-162]	162	183
+COV	[163-163]	163	175
+COV	[164-164]	164	183
+COV	[165-165]	165	194
+COV	[166-166]	166	180
+COV	[167-167]	167	174
+COV	[168-168]	168	155
+COV	[169-169]	169	173
+COV	[170-170]	170	169
+COV	[171-171]	171	199
+COV	[172-172]	172	190
+COV	[173-173]	173	231
+COV	[174-174]	174	221
+COV	[175-175]	175	235
+COV	[176-176]	176	216
+COV	[177-177]	177	215
+COV	[178-178]	178	210
+COV	[179-179]	179	226
+COV	[180-180]	180	207
+COV	[181-181]	181	232
+COV	[182-182]	182	232
+COV	[183-183]	183	214
+COV	[184-184]	184	210
+COV	[185-185]	185	231
+COV	[186-186]	186	191
+COV	[187-187]	187	216
+COV	[188-188]	188	210
+COV	[189-189]	189	218
+COV	[190-190]	190	260
+COV	[191-191]	191	240
+COV	[192-192]	192	239
+COV	[193-193]	193	252
+COV	[194-194]	194	268
+COV	[195-195]	195	237
+COV	[196-196]	196	256
+COV	[197-197]	197	254
+COV	[198-198]	198	266
+COV	[199-199]	199	297
+COV	[200-200]	200	255
+COV	[201-201]	201	285
+COV	[202-202]	202	259
+COV	[203-203]	203	249
+COV	[204-204]	204	238
+COV	[205-205]	205	247
+COV	[206-206]	206	261
+COV	[207-207]	207	244
+COV	[208-208]	208	241
+COV	[209-209]	209	237
+COV	[210-210]	210	271
+COV	[211-211]	211	245
+COV	[212-212]	212	234
+COV	[213-213]	213	252
+COV	[214-214]	214	241
+COV	[215-215]	215	215
+COV	[216-216]	216	227
+COV	[217-217]	217	212
+COV	[218-218]	218	230
+COV	[219-219]	219	184
+COV	[220-220]	220	213
+COV	[221-221]	221	225
+COV	[222-222]	222	188
+COV	[223-223]	223	214
+COV	[224-224]	224	198
+COV	[225-225]	225	195
+COV	[226-226]	226	192
+COV	[227-227]	227	191
+COV	[228-228]	228	184
+COV	[229-229]	229	182
+COV	[230-230]	230	177
+COV	[231-231]	231	169
+COV	[232-232]	232	174
+COV	[233-233]	233	152
+COV	[234-234]	234	154
+COV	[235-235]	235	132
+COV	[236-236]	236	130
+COV	[237-237]	237	146
+COV	[238-238]	238	130
+COV	[239-239]	239	103
+COV	[240-240]	240	161
+COV	[241-241]	241	120
+COV	[242-242]	242	117
+COV	[243-243]	243	132
+COV	[244-244]	244	134
+COV	[245-245]	245	140
+COV	[246-246]	246	123
+COV	[247-247]	247	126
+COV	[248-248]	248	126
+COV	[249-249]	249	99
+COV	[250-250]	250	87
+COV	[251-251]	251	103
+COV	[252-252]	252	109
+COV	[253-253]	253	101
+COV	[254-254]	254	91
+COV	[255-255]	255	72
+COV	[256-256]	256	64
+COV	[257-257]	257	88
+COV	[258-258]	258	86
+COV	[259-259]	259	87
+COV	[260-260]	260	79
+COV	[261-261]	261	67
+COV	[262-262]	262	76
+COV	[263-263]	263	89
+COV	[264-264]	264	64
+COV	[265-265]	265	52
+COV	[266-266]	266	64
+COV	[267-267]	267	69
+COV	[268-268]	268	64
+COV	[269-269]	269	60
+COV	[270-270]	270	55
+COV	[271-271]	271	44
+COV	[272-272]	272	58
+COV	[273-273]	273	63
+COV	[274-274]	274	63
+COV	[275-275]	275	75
+COV	[276-276]	276	81
+COV	[277-277]	277	81
+COV	[278-278]	278	74
+COV	[279-279]	279	44
+COV	[280-280]	280	78
+COV	[281-281]	281	78
+COV	[282-282]	282	81
+COV	[283-283]	283	75
+COV	[284-284]	284	100
+COV	[285-285]	285	50
+COV	[286-286]	286	57
+COV	[287-287]	287	52
+COV	[288-288]	288	54
+COV	[289-289]	289	65
+COV	[290-290]	290	67
+COV	[291-291]	291	58
+COV	[292-292]	292	56
+COV	[293-293]	293	48
+COV	[294-294]	294	61
+COV	[295-295]	295	51
+COV	[296-296]	296	55
+COV	[297-297]	297	60
+COV	[298-298]	298	50
+COV	[299-299]	299	47
+COV	[300-300]	300	62
+COV	[301-301]	301	56
+COV	[302-302]	302	62
+COV	[303-303]	303	49
+COV	[304-304]	304	66
+COV	[305-305]	305	64
+COV	[306-306]	306	61
+COV	[307-307]	307	53
+COV	[308-308]	308	51
+COV	[309-309]	309	68
+COV	[310-310]	310	53
+COV	[311-311]	311	60
+COV	[312-312]	312	73
+COV	[313-313]	313	61
+COV	[314-314]	314	70
+COV	[315-315]	315	47
+COV	[316-316]	316	44
+COV	[317-317]	317	51
+COV	[318-318]	318	52
+COV	[319-319]	319	56
+COV	[320-320]	320	60
+COV	[321-321]	321	56
+COV	[322-322]	322	55
+COV	[323-323]	323	51
+COV	[324-324]	324	60
+COV	[325-325]	325	60
+COV	[326-326]	326	65
+COV	[327-327]	327	75
+COV	[328-328]	328	52
+COV	[329-329]	329	63
+COV	[330-330]	330	59
+COV	[331-331]	331	50
+COV	[332-332]	332	51
+COV	[333-333]	333	57
+COV	[334-334]	334	44
+COV	[335-335]	335	32
+COV	[336-336]	336	62
+COV	[337-337]	337	47
+COV	[338-338]	338	69
+COV	[339-339]	339	64
+COV	[340-340]	340	51
+COV	[341-341]	341	56
+COV	[342-342]	342	51
+COV	[343-343]	343	49
+COV	[344-344]	344	72
+COV	[345-345]	345	61
+COV	[346-346]	346	51
+COV	[347-347]	347	76
+COV	[348-348]	348	75
+COV	[349-349]	349	55
+COV	[350-350]	350	48
+COV	[351-351]	351	52
+COV	[352-352]	352	68
+COV	[353-353]	353	47
+COV	[354-354]	354	59
+COV	[355-355]	355	52
+COV	[356-356]	356	51
+COV	[357-357]	357	59
+COV	[358-358]	358	57
+COV	[359-359]	359	69
+COV	[360-360]	360	59
+COV	[361-361]	361	80
+COV	[362-362]	362	42
+COV	[363-363]	363	46
+COV	[364-364]	364	65
+COV	[365-365]	365	60
+COV	[366-366]	366	45
+COV	[367-367]	367	48
+COV	[368-368]	368	39
+COV	[369-369]	369	48
+COV	[370-370]	370	44
+COV	[371-371]	371	49
+COV	[372-372]	372	61
+COV	[373-373]	373	48
+COV	[374-374]	374	45
+COV	[375-375]	375	55
+COV	[376-376]	376	54
+COV	[377-377]	377	67
+COV	[378-378]	378	53
+COV	[379-379]	379	65
+COV	[380-380]	380	49
+COV	[381-381]	381	61
+COV	[382-382]	382	48
+COV	[383-383]	383	49
+COV	[384-384]	384	49
+COV	[385-385]	385	45
+COV	[386-386]	386	40
+COV	[387-387]	387	38
+COV	[388-388]	388	41
+COV	[389-389]	389	46
+COV	[390-390]	390	42
+COV	[391-391]	391	53
+COV	[392-392]	392	38
+COV	[393-393]	393	36
+COV	[394-394]	394	37
+COV	[395-395]	395	40
+COV	[396-396]	396	43
+COV	[397-397]	397	24
+COV	[398-398]	398	54
+COV	[399-399]	399	36
+COV	[400-400]	400	40
+COV	[401-401]	401	28
+COV	[402-402]	402	52
+COV	[403-403]	403	70
+COV	[404-404]	404	52
+COV	[405-405]	405	49
+COV	[406-406]	406	42
+COV	[407-407]	407	37
+COV	[408-408]	408	41
+COV	[409-409]	409	61
+COV	[410-410]	410	44
+COV	[411-411]	411	36
+COV	[412-412]	412	58
+COV	[413-413]	413	37
+COV	[414-414]	414	53
+COV	[415-415]	415	33
+COV	[416-416]	416	44
+COV	[417-417]	417	35
+COV	[418-418]	418	40
+COV	[419-419]	419	43
+COV	[420-420]	420	48
+COV	[421-421]	421	58
+COV	[422-422]	422	53
+COV	[423-423]	423	44
+COV	[424-424]	424	55
+COV	[425-425]	425	62
+COV	[426-426]	426	49
+COV	[427-427]	427	43
+COV	[428-428]	428	31
+COV	[429-429]	429	47
+COV	[430-430]	430	54
+COV	[431-431]	431	43
+COV	[432-432]	432	57
+COV	[433-433]	433	33
+COV	[434-434]	434	50
+COV	[435-435]	435	49
+COV	[436-436]	436	32
+COV	[437-437]	437	49
+COV	[438-438]	438	40
+COV	[439-439]	439	44
+COV	[440-440]	440	42
+COV	[441-441]	441	43
+COV	[442-442]	442	42
+COV	[443-443]	443	50
+COV	[444-444]	444	36
+COV	[445-445]	445	29
+COV	[446-446]	446	46
+COV	[447-447]	447	34
+COV	[448-448]	448	40
+COV	[449-449]	449	40
+COV	[450-450]	450	46
+COV	[451-451]	451	28
+COV	[452-452]	452	37
+COV	[453-453]	453	42
+COV	[454-454]	454	42
+COV	[455-455]	455	44
+COV	[456-456]	456	38
+COV	[457-457]	457	42
+COV	[458-458]	458	42
+COV	[459-459]	459	38
+COV	[460-460]	460	45
+COV	[461-461]	461	34
+COV	[462-462]	462	38
+COV	[463-463]	463	36
+COV	[464-464]	464	44
+COV	[465-465]	465	43
+COV	[466-466]	466	44
+COV	[467-467]	467	31
+COV	[468-468]	468	58
+COV	[469-469]	469	44
+COV	[470-470]	470	57
+COV	[471-471]	471	39
+COV	[472-472]	472	37
+COV	[473-473]	473	42
+COV	[474-474]	474	38
+COV	[475-475]	475	41
+COV	[476-476]	476	40
+COV	[477-477]	477	41
+COV	[478-478]	478	44
+COV	[479-479]	479	40
+COV	[480-480]	480	48
+COV	[481-481]	481	34
+COV	[482-482]	482	40
+COV	[483-483]	483	41
+COV	[484-484]	484	45
+COV	[485-485]	485	44
+COV	[486-486]	486	48
+COV	[487-487]	487	32
+COV	[488-488]	488	44
+COV	[489-489]	489	38
+COV	[490-490]	490	22
+COV	[491-491]	491	32
+COV	[492-492]	492	45
+COV	[493-493]	493	28
+COV	[494-494]	494	33
+COV	[495-495]	495	39
+COV	[496-496]	496	46
+COV	[497-497]	497	32
+COV	[498-498]	498	34
+COV	[499-499]	499	30
+COV	[500-500]	500	30
+COV	[501-501]	501	31
+COV	[502-502]	502	39
+COV	[503-503]	503	44
+COV	[504-504]	504	30
+COV	[505-505]	505	34
+COV	[506-506]	506	25
+COV	[507-507]	507	48
+COV	[508-508]	508	35
+COV	[509-509]	509	41
+COV	[510-510]	510	38
+COV	[511-511]	511	36
+COV	[512-512]	512	45
+COV	[513-513]	513	26
+COV	[514-514]	514	34
+COV	[515-515]	515	35
+COV	[516-516]	516	36
+COV	[517-517]	517	29
+COV	[518-518]	518	28
+COV	[519-519]	519	31
+COV	[520-520]	520	34
+COV	[521-521]	521	47
+COV	[522-522]	522	35
+COV	[523-523]	523	44
+COV	[524-524]	524	58
+COV	[525-525]	525	26
+COV	[526-526]	526	40
+COV	[527-527]	527	36
+COV	[528-528]	528	37
+COV	[529-529]	529	55
+COV	[530-530]	530	37
+COV	[531-531]	531	32
+COV	[532-532]	532	33
+COV	[533-533]	533	39
+COV	[534-534]	534	34
+COV	[535-535]	535	26
+COV	[536-536]	536	42
+COV	[537-537]	537	25
+COV	[538-538]	538	40
+COV	[539-539]	539	38
+COV	[540-540]	540	35
+COV	[541-541]	541	31
+COV	[542-542]	542	33
+COV	[543-543]	543	38
+COV	[544-544]	544	36
+COV	[545-545]	545	39
+COV	[546-546]	546	35
+COV	[547-547]	547	36
+COV	[548-548]	548	41
+COV	[549-549]	549	38
+COV	[550-550]	550	30
+COV	[551-551]	551	33
+COV	[552-552]	552	40
+COV	[553-553]	553	33
+COV	[554-554]	554	30
+COV	[555-555]	555	41
+COV	[556-556]	556	31
+COV	[557-557]	557	37
+COV	[558-558]	558	41
+COV	[559-559]	559	26
+COV	[560-560]	560	30
+COV	[561-561]	561	35
+COV	[562-562]	562	35
+COV	[563-563]	563	34
+COV	[564-564]	564	35
+COV	[565-565]	565	39
+COV	[566-566]	566	29
+COV	[567-567]	567	41
+COV	[568-568]	568	29
+COV	[569-569]	569	27
+COV	[570-570]	570	40
+COV	[571-571]	571	32
+COV	[572-572]	572	30
+COV	[573-573]	573	25
+COV	[574-574]	574	35
+COV	[575-575]	575	30
+COV	[576-576]	576	28
+COV	[577-577]	577	34
+COV	[578-578]	578	21
+COV	[579-579]	579	31
+COV	[580-580]	580	34
+COV	[581-581]	581	18
+COV	[582-582]	582	31
+COV	[583-583]	583	24
+COV	[584-584]	584	30
+COV	[585-585]	585	31
+COV	[586-586]	586	32
+COV	[587-587]	587	23
+COV	[588-588]	588	33
+COV	[589-589]	589	31
+COV	[590-590]	590	28
+COV	[591-591]	591	27
+COV	[592-592]	592	28
+COV	[593-593]	593	40
+COV	[594-594]	594	28
+COV	[595-595]	595	26
+COV	[596-596]	596	22
+COV	[597-597]	597	34
+COV	[598-598]	598	35
+COV	[599-599]	599	29
+COV	[600-600]	600	23
+COV	[601-601]	601	34
+COV	[602-602]	602	19
+COV	[603-603]	603	25
+COV	[604-604]	604	23
+COV	[605-605]	605	33
+COV	[606-606]	606	27
+COV	[607-607]	607	31
+COV	[608-608]	608	23
+COV	[609-609]	609	29
+COV	[610-610]	610	34
+COV	[611-611]	611	36
+COV	[612-612]	612	32
+COV	[613-613]	613	27
+COV	[614-614]	614	26
+COV	[615-615]	615	31
+COV	[616-616]	616	27
+COV	[617-617]	617	36
+COV	[618-618]	618	15
+COV	[619-619]	619	36
+COV	[620-620]	620	20
+COV	[621-621]	621	30
+COV	[622-622]	622	30
+COV	[623-623]	623	40
+COV	[624-624]	624	29
+COV	[625-625]	625	24
+COV	[626-626]	626	40
+COV	[627-627]	627	36
+COV	[628-628]	628	24
+COV	[629-629]	629	20
+COV	[630-630]	630	18
+COV	[631-631]	631	28
+COV	[632-632]	632	28
+COV	[633-633]	633	23
+COV	[634-634]	634	24
+COV	[635-635]	635	21
+COV	[636-636]	636	18
+COV	[637-637]	637	22
+COV	[638-638]	638	24
+COV	[639-639]	639	24
+COV	[640-640]	640	19
+COV	[641-641]	641	26
+COV	[642-642]	642	16
+COV	[643-643]	643	24
+COV	[644-644]	644	22
+COV	[645-645]	645	19
+COV	[646-646]	646	24
+COV	[647-647]	647	27
+COV	[648-648]	648	22
+COV	[649-649]	649	15
+COV	[650-650]	650	30
+COV	[651-651]	651	32
+COV	[652-652]	652	21
+COV	[653-653]	653	25
+COV	[654-654]	654	24
+COV	[655-655]	655	26
+COV	[656-656]	656	33
+COV	[657-657]	657	20
+COV	[658-658]	658	28
+COV	[659-659]	659	32
+COV	[660-660]	660	28
+COV	[661-661]	661	29
+COV	[662-662]	662	22
+COV	[663-663]	663	26
+COV	[664-664]	664	18
+COV	[665-665]	665	28
+COV	[666-666]	666	24
+COV	[667-667]	667	30
+COV	[668-668]	668	24
+COV	[669-669]	669	24
+COV	[670-670]	670	21
+COV	[671-671]	671	31
+COV	[672-672]	672	22
+COV	[673-673]	673	24
+COV	[674-674]	674	27
+COV	[675-675]	675	28
+COV	[676-676]	676	30
+COV	[677-677]	677	34
+COV	[678-678]	678	43
+COV	[679-679]	679	31
+COV	[680-680]	680	26
+COV	[681-681]	681	26
+COV	[682-682]	682	24
+COV	[683-683]	683	25
+COV	[684-684]	684	21
+COV	[685-685]	685	16
+COV	[686-686]	686	30
+COV	[687-687]	687	23
+COV	[688-688]	688	30
+COV	[689-689]	689	19
+COV	[690-690]	690	22
+COV	[691-691]	691	30
+COV	[692-692]	692	30
+COV	[693-693]	693	23
+COV	[694-694]	694	39
+COV	[695-695]	695	15
+COV	[696-696]	696	20
+COV	[697-697]	697	29
+COV	[698-698]	698	34
+COV	[699-699]	699	18
+COV	[700-700]	700	31
+COV	[701-701]	701	23
+COV	[702-702]	702	25
+COV	[703-703]	703	36
+COV	[704-704]	704	34
+COV	[705-705]	705	35
+COV	[706-706]	706	29
+COV	[707-707]	707	31
+COV	[708-708]	708	22
+COV	[709-709]	709	22
+COV	[710-710]	710	26
+COV	[711-711]	711	29
+COV	[712-712]	712	34
+COV	[713-713]	713	33
+COV	[714-714]	714	20
+COV	[715-715]	715	23
+COV	[716-716]	716	24
+COV	[717-717]	717	25
+COV	[718-718]	718	24
+COV	[719-719]	719	28
+COV	[720-720]	720	26
+COV	[721-721]	721	24
+COV	[722-722]	722	19
+COV	[723-723]	723	21
+COV	[724-724]	724	28
+COV	[725-725]	725	23
+COV	[726-726]	726	29
+COV	[727-727]	727	28
+COV	[728-728]	728	31
+COV	[729-729]	729	15
+COV	[730-730]	730	25
+COV	[731-731]	731	26
+COV	[732-732]	732	17
+COV	[733-733]	733	20
+COV	[734-734]	734	15
+COV	[735-735]	735	23
+COV	[736-736]	736	14
+COV	[737-737]	737	20
+COV	[738-738]	738	21
+COV	[739-739]	739	24
+COV	[740-740]	740	20
+COV	[741-741]	741	24
+COV	[742-742]	742	24
+COV	[743-743]	743	23
+COV	[744-744]	744	18
+COV	[745-745]	745	18
+COV	[746-746]	746	14
+COV	[747-747]	747	13
+COV	[748-748]	748	20
+COV	[749-749]	749	37
+COV	[750-750]	750	22
+COV	[751-751]	751	25
+COV	[752-752]	752	21
+COV	[753-753]	753	16
+COV	[754-754]	754	24
+COV	[755-755]	755	20
+COV	[756-756]	756	20
+COV	[757-757]	757	29
+COV	[758-758]	758	16
+COV	[759-759]	759	15
+COV	[760-760]	760	16
+COV	[761-761]	761	21
+COV	[762-762]	762	22
+COV	[763-763]	763	24
+COV	[764-764]	764	17
+COV	[765-765]	765	15
+COV	[766-766]	766	21
+COV	[767-767]	767	27
+COV	[768-768]	768	16
+COV	[769-769]	769	29
+COV	[770-770]	770	27
+COV	[771-771]	771	17
+COV	[772-772]	772	16
+COV	[773-773]	773	23
+COV	[774-774]	774	28
+COV	[775-775]	775	16
+COV	[776-776]	776	24
+COV	[777-777]	777	16
+COV	[778-778]	778	20
+COV	[779-779]	779	27
+COV	[780-780]	780	18
+COV	[781-781]	781	27
+COV	[782-782]	782	18
+COV	[783-783]	783	23
+COV	[784-784]	784	12
+COV	[785-785]	785	33
+COV	[786-786]	786	20
+COV	[787-787]	787	22
+COV	[788-788]	788	15
+COV	[789-789]	789	18
+COV	[790-790]	790	19
+COV	[791-791]	791	19
+COV	[792-792]	792	31
+COV	[793-793]	793	17
+COV	[794-794]	794	16
+COV	[795-795]	795	17
+COV	[796-796]	796	16
+COV	[797-797]	797	18
+COV	[798-798]	798	19
+COV	[799-799]	799	22
+COV	[800-800]	800	12
+COV	[801-801]	801	19
+COV	[802-802]	802	22
+COV	[803-803]	803	15
+COV	[804-804]	804	18
+COV	[805-805]	805	20
+COV	[806-806]	806	14
+COV	[807-807]	807	20
+COV	[808-808]	808	22
+COV	[809-809]	809	16
+COV	[810-810]	810	23
+COV	[811-811]	811	24
+COV	[812-812]	812	27
+COV	[813-813]	813	15
+COV	[814-814]	814	18
+COV	[815-815]	815	28
+COV	[816-816]	816	22
+COV	[817-817]	817	32
+COV	[818-818]	818	14
+COV	[819-819]	819	21
+COV	[820-820]	820	18
+COV	[821-821]	821	21
+COV	[822-822]	822	17
+COV	[823-823]	823	18
+COV	[824-824]	824	17
+COV	[825-825]	825	21
+COV	[826-826]	826	11
+COV	[827-827]	827	14
+COV	[828-828]	828	15
+COV	[829-829]	829	18
+COV	[830-830]	830	18
+COV	[831-831]	831	27
+COV	[832-832]	832	21
+COV	[833-833]	833	24
+COV	[834-834]	834	25
+COV	[835-835]	835	19
+COV	[836-836]	836	27
+COV	[837-837]	837	19
+COV	[838-838]	838	24
+COV	[839-839]	839	16
+COV	[840-840]	840	17
+COV	[841-841]	841	12
+COV	[842-842]	842	22
+COV	[843-843]	843	18
+COV	[844-844]	844	11
+COV	[845-845]	845	29
+COV	[846-846]	846	22
+COV	[847-847]	847	18
+COV	[848-848]	848	25
+COV	[849-849]	849	19
+COV	[850-850]	850	13
+COV	[851-851]	851	18
+COV	[852-852]	852	21
+COV	[853-853]	853	19
+COV	[854-854]	854	19
+COV	[855-855]	855	19
+COV	[856-856]	856	17
+COV	[857-857]	857	21
+COV	[858-858]	858	21
+COV	[859-859]	859	15
+COV	[860-860]	860	28
+COV	[861-861]	861	14
+COV	[862-862]	862	20
+COV	[863-863]	863	10
+COV	[864-864]	864	15
+COV	[865-865]	865	20
+COV	[866-866]	866	18
+COV	[867-867]	867	18
+COV	[868-868]	868	17
+COV	[869-869]	869	13
+COV	[870-870]	870	19
+COV	[871-871]	871	14
+COV	[872-872]	872	19
+COV	[873-873]	873	14
+COV	[874-874]	874	13
+COV	[875-875]	875	20
+COV	[876-876]	876	28
+COV	[877-877]	877	21
+COV	[878-878]	878	14
+COV	[879-879]	879	21
+COV	[880-880]	880	22
+COV	[881-881]	881	16
+COV	[882-882]	882	18
+COV	[883-883]	883	24
+COV	[884-884]	884	22
+COV	[885-885]	885	22
+COV	[886-886]	886	23
+COV	[887-887]	887	19
+COV	[888-888]	888	16
+COV	[889-889]	889	11
+COV	[890-890]	890	18
+COV	[891-891]	891	18
+COV	[892-892]	892	16
+COV	[893-893]	893	20
+COV	[894-894]	894	18
+COV	[895-895]	895	13
+COV	[896-896]	896	25
+COV	[897-897]	897	15
+COV	[898-898]	898	22
+COV	[899-899]	899	21
+COV	[900-900]	900	13
+COV	[901-901]	901	16
+COV	[902-902]	902	16
+COV	[903-903]	903	22
+COV	[904-904]	904	19
+COV	[905-905]	905	24
+COV	[906-906]	906	26
+COV	[907-907]	907	20
+COV	[908-908]	908	14
+COV	[909-909]	909	15
+COV	[910-910]	910	19
+COV	[911-911]	911	19
+COV	[912-912]	912	19
+COV	[913-913]	913	17
+COV	[914-914]	914	21
+COV	[915-915]	915	24
+COV	[916-916]	916	6
+COV	[917-917]	917	21
+COV	[918-918]	918	10
+COV	[919-919]	919	13
+COV	[920-920]	920	25
+COV	[921-921]	921	12
+COV	[922-922]	922	12
+COV	[923-923]	923	13
+COV	[924-924]	924	21
+COV	[925-925]	925	13
+COV	[926-926]	926	24
+COV	[927-927]	927	13
+COV	[928-928]	928	9
+COV	[929-929]	929	17
+COV	[930-930]	930	7
+COV	[931-931]	931	9
+COV	[932-932]	932	19
+COV	[933-933]	933	16
+COV	[934-934]	934	21
+COV	[935-935]	935	17
+COV	[936-936]	936	14
+COV	[937-937]	937	13
+COV	[938-938]	938	17
+COV	[939-939]	939	14
+COV	[940-940]	940	10
+COV	[941-941]	941	20
+COV	[942-942]	942	19
+COV	[943-943]	943	17
+COV	[944-944]	944	16
+COV	[945-945]	945	13
+COV	[946-946]	946	14
+COV	[947-947]	947	17
+COV	[948-948]	948	11
+COV	[949-949]	949	12
+COV	[950-950]	950	14
+COV	[951-951]	951	11
+COV	[952-952]	952	14
+COV	[953-953]	953	11
+COV	[954-954]	954	14
+COV	[955-955]	955	18
+COV	[956-956]	956	18
+COV	[957-957]	957	17
+COV	[958-958]	958	13
+COV	[959-959]	959	17
+COV	[960-960]	960	19
+COV	[961-961]	961	14
+COV	[962-962]	962	19
+COV	[963-963]	963	7
+COV	[964-964]	964	12
+COV	[965-965]	965	13
+COV	[966-966]	966	13
+COV	[967-967]	967	15
+COV	[968-968]	968	21
+COV	[969-969]	969	16
+COV	[970-970]	970	18
+COV	[971-971]	971	4
+COV	[972-972]	972	18
+COV	[973-973]	973	14
+COV	[974-974]	974	17
+COV	[975-975]	975	17
+COV	[976-976]	976	10
+COV	[977-977]	977	11
+COV	[978-978]	978	16
+COV	[979-979]	979	13
+COV	[980-980]	980	14
+COV	[981-981]	981	27
+COV	[982-982]	982	18
+COV	[983-983]	983	20
+COV	[984-984]	984	15
+COV	[985-985]	985	18
+COV	[986-986]	986	14
+COV	[987-987]	987	15
+COV	[988-988]	988	19
+COV	[989-989]	989	22
+COV	[990-990]	990	12
+COV	[991-991]	991	11
+COV	[992-992]	992	14
+COV	[993-993]	993	20
+COV	[994-994]	994	11
+COV	[995-995]	995	11
+COV	[996-996]	996	15
+COV	[997-997]	997	17
+COV	[998-998]	998	6
+COV	[999-999]	999	11
+COV	[1000-1000]	1000	16
+COV	[1000<]	1000	29066
+# GC-depth. Use `grep ^GCD | cut -f 2-` to extract this part. The columns are: GC%, unique sequence percentiles, 10th, 25th, 50th, 75th and 90th depth percentile
+GCD	0.0	0.006	0.000	0.002	0.002	0.005	0.005
+GCD	1.0	0.007	0.007	0.007	0.007	0.007	0.007
+GCD	2.0	0.012	0.002	0.002	0.002	0.005	0.007
+GCD	3.0	0.014	0.005	0.005	0.007	0.020	0.020
+GCD	4.0	0.016	0.002	0.002	0.002	0.002	0.002
+GCD	6.0	0.020	0.002	0.002	0.002	0.002	0.002
+GCD	8.0	0.022	0.002	0.002	0.002	0.002	0.002
+GCD	10.0	0.024	0.002	0.002	0.002	0.007	0.007
+GCD	11.0	0.025	0.005	0.005	0.005	0.005	0.005
+GCD	11.6	0.025	0.047	0.047	0.047	0.047	0.047
+GCD	12.0	0.031	0.002	0.002	0.002	0.005	0.007
+GCD	13.0	0.032	0.005	0.005	0.005	0.005	0.005
+GCD	14.0	0.033	0.002	0.002	0.002	0.005	0.005
+GCD	15.0	0.035	0.010	0.010	0.010	0.017	0.017
+GCD	16.0	0.039	0.002	0.002	0.005	0.005	0.005
+GCD	17.0	0.041	0.007	0.007	0.007	0.007	0.007
+GCD	18.0	0.045	0.002	0.002	0.005	0.010	0.010
+GCD	19.0	0.048	0.002	0.002	0.002	0.005	0.012
+GCD	20.0	0.052	0.002	0.002	0.002	0.002	0.007
+GCD	21.0	0.054	0.002	0.002	0.005	0.007	0.007
+GCD	22.0	0.062	0.002	0.002	0.005	0.007	0.010
+GCD	23.0	0.068	0.002	0.005	0.005	0.007	0.017
+GCD	24.0	0.080	0.002	0.002	0.002	0.002	0.005
+GCD	25.0	0.089	0.002	0.005	0.007	0.010	0.012
+GCD	26.0	0.105	0.002	0.002	0.002	0.005	0.007
+GCD	27.0	0.112	0.007	0.007	0.007	0.419	0.691
+GCD	28.0	0.124	0.002	0.002	0.007	0.020	0.093
+GCD	29.0	0.134	0.005	0.005	0.007	0.010	0.012
+GCD	30.0	0.149	0.002	0.002	0.005	0.012	0.022
+GCD	31.0	0.171	0.005	0.005	0.010	0.120	0.255
+GCD	32.0	0.225	0.002	0.005	0.120	0.228	0.262
+GCD	33.0	0.344	0.012	0.142	0.225	0.262	0.292
+GCD	34.0	0.721	0.022	0.194	0.240	0.272	0.296
+GCD	35.0	1.791	0.167	0.223	0.255	0.282	0.304
+GCD	36.0	4.174	0.194	0.235	0.265	0.292	0.316
+GCD	37.0	8.546	0.208	0.245	0.277	0.304	0.331
+GCD	38.0	15.513	0.218	0.255	0.287	0.316	0.345
+GCD	39.0	24.259	0.228	0.267	0.299	0.328	0.358
+GCD	40.0	34.137	0.238	0.277	0.311	0.343	0.372
+GCD	41.0	44.039	0.247	0.289	0.323	0.355	0.387
+GCD	42.0	53.383	0.260	0.299	0.336	0.368	0.402
+GCD	43.0	61.865	0.274	0.314	0.348	0.382	0.417
+GCD	44.0	69.571	0.289	0.326	0.363	0.394	0.431
+GCD	45.0	76.519	0.304	0.341	0.375	0.409	0.446
+GCD	46.0	82.424	0.316	0.353	0.387	0.424	0.468
+GCD	47.0	87.213	0.326	0.365	0.402	0.441	0.488
+GCD	48.0	90.973	0.338	0.375	0.409	0.451	0.505
+GCD	49.0	93.667	0.353	0.390	0.424	0.463	0.517
+GCD	50.0	95.910	0.345	0.392	0.429	0.470	0.524
+GCD	51.0	97.447	0.365	0.404	0.439	0.480	0.537
+GCD	52.0	98.546	0.365	0.402	0.441	0.483	0.537
+GCD	53.0	99.252	0.370	0.412	0.446	0.485	0.539
+GCD	54.0	99.662	0.365	0.412	0.448	0.492	0.561
+GCD	55.0	99.840	0.387	0.426	0.461	0.502	0.573
+GCD	56.0	99.930	0.020	0.402	0.446	0.485	0.554
+GCD	57.0	99.966	0.279	0.387	0.426	0.492	0.581
+GCD	58.0	99.982	0.002	0.005	0.470	0.980	1.063
+GCD	59.0	99.988	0.397	0.461	0.475	0.987	1.333
+GCD	60.0	99.989	0.002	0.002	0.002	0.211	0.211
+GCD	61.0	99.992	0.005	0.005	0.485	0.502	0.527
+GCD	62.0	99.995	0.002	0.002	0.002	0.434	0.434
+GCD	63.0	99.997	0.892	0.892	1.105	2.472	2.472
+GCD	64.0	99.998	1.034	1.034	1.034	1.098	1.098
+GCD	65.0	99.999	12.870	12.870	12.870	12.870	12.870
+GCD	66.0	100.000	0.002	0.002	0.002	0.002	0.002
diff --git a/src/multiqc/test_data/b.txt b/src/multiqc/test_data/b.txt
new file mode 100644
index 00000000..5df6122a
--- /dev/null
+++ b/src/multiqc/test_data/b.txt
@@ -0,0 +1,1505 @@
+# This file was produced by samtools stats (1.3+htslib-1.3) and can be plotted using plot-bamstats
+# This file contains statistics for all reads.
+# The command line was:  stats mapped/b.bam
+# CHK, Checksum	[2]Read Names	[3]Sequences	[4]Qualities
+# CHK, CRC32 of reads which passed filtering followed by addition (32bit overflow)
+CHK	ee6a9cbf	ecd7f501	51869fe3
+# Summary Numbers. Use `grep ^SN | cut -f 2-` to extract this part.
+SN	raw total sequences:	18576178
+SN	filtered sequences:	0
+SN	sequences:	18576178
+SN	is sorted:	1
+SN	1st fragments:	18576178
+SN	last fragments:	0
+SN	reads mapped:	18166869
+SN	reads mapped and paired:	0	# paired-end technology bit set + both mates mapped
+SN	reads unmapped:	409309
+SN	reads properly paired:	0	# proper-pair bit set
+SN	reads paired:	0	# paired-end technology bit set
+SN	reads duplicated:	1674761	# PCR or optical duplicate bit set
+SN	reads MQ0:	3360997	# mapped and MQ=0
+SN	reads QC failed:	0
+SN	non-primary alignments:	0
+SN	total length:	927580112	# ignores clipping
+SN	bases mapped:	907135249	# ignores clipping
+SN	bases mapped (cigar):	907135242	# more accurate
+SN	bases trimmed:	0
+SN	bases duplicated:	83676902
+SN	mismatches:	4228623	# from NM fields
+SN	error rate:	4.661513e-03	# mismatches / bases mapped (cigar)
+SN	average length:	49
+SN	maximum length:	50
+SN	average quality:	37.1
+SN	insert size average:	0.0
+SN	insert size standard deviation:	0.0
+SN	inward oriented pairs:	0
+SN	outward oriented pairs:	0
+SN	pairs with other orientation:	0
+SN	pairs on different chromosomes:	0
+# First Fragment Qualitites. Use `grep ^FFQ | cut -f 2-` to extract this part.
+# Columns correspond to qualities and rows to cycles. First column is the cycle number.
+FFQ	1	0	0	43365	0	0	0	0	0	0	0	0	0	0	0	0	316667	0	0	0	0	0	0	145075	0	0	0	0	1091864	0	0	0	0	0	16979207	0	0	0	0	0	0	0	0
+FFQ	2	0	0	2631	0	0	0	0	0	0	0	0	0	0	0	0	226851	0	0	0	0	0	0	117493	0	0	0	0	1044416	0	0	0	0	0	17184787	0	0	0	0	0	0	0	0
+FFQ	3	0	0	2642	0	0	0	0	0	0	0	0	0	0	0	0	150819	0	0	0	0	0	0	121280	0	0	0	0	1043537	0	0	0	0	0	17257900	0	0	0	0	0	0	0	0
+FFQ	4	0	0	2652	0	0	0	0	0	0	0	0	0	0	0	0	118535	0	0	0	0	0	0	32499	0	0	0	0	385005	0	0	0	0	0	1401276	0	0	0	16636211	0	0	0	0
+FFQ	5	0	0	2664	0	0	0	0	0	0	0	0	0	0	0	0	149178	0	0	0	0	0	0	33908	0	0	0	0	445421	0	0	0	0	0	1485286	0	0	0	16459721	0	0	0	0
+FFQ	6	0	0	2681	0	0	0	3389	0	0	0	0	0	0	0	0	146379	0	0	0	0	0	0	40576	0	0	0	0	438297	0	0	0	0	0	1478793	0	0	0	16466063	0	0	0	0
+FFQ	7	0	0	2719	0	0	0	4001	0	0	0	0	0	0	0	0	156176	0	0	0	0	0	0	40734	0	0	0	0	447501	0	0	0	0	0	1488746	0	0	0	16436301	0	0	0	0
+FFQ	8	0	0	2759	0	0	0	3952	0	0	0	0	0	0	0	0	156255	0	0	0	0	0	0	40576	0	0	0	0	446114	0	0	0	0	0	1486214	0	0	0	16440308	0	0	0	0
+FFQ	9	0	0	2822	0	0	0	4334	0	0	0	0	0	0	0	0	159441	0	0	0	0	0	0	40893	0	0	0	0	448307	0	0	0	0	0	1489379	0	0	0	16431002	0	0	0	0
+FFQ	10	0	0	2897	0	0	0	3878	0	0	0	0	0	0	0	0	153155	0	0	0	0	0	0	41101	0	0	0	0	447304	0	0	0	0	0	1484804	0	0	0	16443039	0	0	0	0
+FFQ	11	0	0	2982	0	0	0	4003	0	0	0	0	0	0	0	0	151436	0	0	0	0	0	0	42075	0	0	0	0	447020	0	0	0	0	0	1486604	0	0	0	16442058	0	0	0	0
+FFQ	12	0	0	3101	0	0	0	4242	0	0	0	0	0	0	0	0	155412	0	0	0	0	0	0	42911	0	0	0	0	449860	0	0	0	0	0	1491835	0	0	0	16428817	0	0	0	0
+FFQ	13	0	0	3240	0	0	0	4244	0	0	0	0	0	0	0	0	154472	0	0	0	0	0	0	44402	0	0	0	0	451953	0	0	0	0	0	1495686	0	0	0	16422181	0	0	0	0
+FFQ	14	0	0	3399	0	0	0	4705	0	0	0	0	0	0	0	0	158387	0	0	0	0	0	0	44832	0	0	0	0	452013	0	0	0	0	0	1422645	0	0	0	5009192	0	0	11481005	0
+FFQ	15	0	0	3574	0	0	0	4943	0	0	0	0	0	0	0	0	162629	0	0	0	0	0	0	45939	0	0	0	0	455281	0	0	0	0	0	1429083	0	0	0	5018020	0	0	11456709	0
+FFQ	16	0	0	3789	0	0	0	5204	0	0	0	0	0	0	0	0	164703	0	0	0	0	0	0	47268	0	0	0	0	459688	0	0	0	0	0	1438944	0	0	0	5025956	0	0	11430626	0
+FFQ	17	0	0	4054	0	0	0	5500	0	0	0	0	0	0	0	0	161723	0	0	0	0	0	0	49772	0	0	0	0	462909	0	0	0	0	0	1448410	0	0	0	5050556	0	0	11393254	0
+FFQ	18	0	0	4376	0	0	0	6040	0	0	0	0	0	0	0	0	163399	0	0	0	0	0	0	51435	0	0	0	0	456360	0	0	0	0	0	1447415	0	0	0	5057035	0	0	11390118	0
+FFQ	19	0	0	4895	0	0	0	6152	0	0	0	0	0	0	0	0	164137	0	0	0	0	0	0	54177	0	0	0	0	459431	0	0	0	0	0	1452212	0	0	0	4724623	0	0	11710551	0
+FFQ	20	0	0	5278	0	0	0	6748	0	0	0	0	0	0	0	0	161669	0	0	0	0	0	0	57142	0	0	0	0	456404	0	0	0	0	0	1454134	0	0	0	4771944	0	0	11662859	0
+FFQ	21	0	0	6041	0	0	0	7654	0	0	0	0	0	0	0	0	160998	0	0	0	0	0	0	61704	0	0	0	0	453274	0	0	0	0	0	1456206	0	0	0	4832585	0	0	11597716	0
+FFQ	22	0	0	7025	0	0	0	8936	0	0	0	0	0	0	0	0	164004	0	0	0	0	0	0	69132	0	0	0	0	455154	0	0	0	0	0	1463092	0	0	0	4900894	0	0	11507941	0
+FFQ	23	0	0	8438	0	0	0	10369	0	0	0	0	0	0	0	0	166619	0	0	0	0	0	0	76781	0	0	0	0	451917	0	0	0	0	0	1473087	0	0	0	4980302	0	0	11408665	0
+FFQ	24	0	0	10137	0	0	0	12451	0	0	0	0	0	0	0	0	167661	0	0	0	0	0	0	86418	0	0	0	0	446268	0	0	0	0	0	1481414	0	0	0	4969528	0	0	11402301	0
+FFQ	25	0	0	12428	0	0	0	14892	0	0	0	0	0	0	0	0	173631	0	0	0	0	0	0	99776	0	0	0	0	442524	0	0	0	0	0	1493761	0	0	0	5016661	0	0	11322505	0
+FFQ	26	0	0	15335	0	0	0	25515	0	0	0	0	0	0	0	0	204814	0	0	0	0	0	0	111835	0	0	0	0	427338	0	0	0	0	0	1483190	0	0	0	5032460	0	0	11275691	0
+FFQ	27	0	0	18183	0	0	0	31691	0	0	0	0	0	0	0	0	211885	0	0	0	0	0	0	125826	0	0	0	0	425529	0	0	0	0	0	1495988	0	0	0	5036475	0	0	11230601	0
+FFQ	28	0	0	21234	0	0	0	38567	0	0	0	0	0	0	0	0	212153	0	0	0	0	0	0	138492	0	0	0	0	416049	0	0	0	0	0	1506817	0	0	0	5050848	0	0	11192018	0
+FFQ	29	0	0	24469	0	0	0	45921	0	0	0	0	0	0	0	0	208586	0	0	0	0	0	0	150099	0	0	0	0	406972	0	0	0	0	0	1510396	0	0	0	5061017	0	0	11168718	0
+FFQ	30	0	0	27790	0	0	0	54131	0	0	0	0	0	0	0	0	202787	0	0	0	0	0	0	159734	0	0	0	0	401982	0	0	0	0	0	1517830	0	0	0	5076275	0	0	11135649	0
+FFQ	31	0	0	31389	0	0	0	64745	0	0	0	0	0	0	0	0	197260	0	0	0	0	0	0	167040	0	0	0	0	398914	0	0	0	0	0	1522211	0	0	0	5081933	0	0	11112662	0
+FFQ	32	0	0	35265	0	0	0	73249	0	0	0	0	0	0	0	0	190526	0	0	0	0	0	0	171610	0	0	0	0	397631	0	0	0	0	0	1530272	0	0	0	5089484	0	0	11088092	0
+FFQ	33	0	0	39568	0	0	0	82173	0	0	0	0	0	0	0	0	181514	0	0	0	0	0	0	175016	0	0	0	0	397113	0	0	0	0	0	1534492	0	0	0	5098856	0	0	11067375	0
+FFQ	34	0	0	44025	0	0	0	92751	0	0	0	0	0	0	0	0	177863	0	0	0	0	0	0	177915	0	0	0	0	398138	0	0	0	0	0	1535653	0	0	0	5098622	0	0	11051118	0
+FFQ	35	0	0	49081	0	0	0	96325	0	0	0	0	0	0	0	0	171633	0	0	0	0	0	0	181304	0	0	0	0	399581	0	0	0	0	0	1542546	0	0	0	5100609	0	0	11034967	0
+FFQ	36	0	0	54552	0	0	0	101878	0	0	0	0	0	0	0	0	166948	0	0	0	0	0	0	185932	0	0	0	0	399740	0	0	0	0	0	1551353	0	0	0	5114688	0	0	11000912	0
+FFQ	37	0	0	60308	0	0	0	104644	0	0	0	0	0	0	0	0	164138	0	0	0	0	0	0	189071	0	0	0	0	399564	0	0	0	0	0	1556486	0	0	0	5126556	0	0	10975200	0
+FFQ	38	0	0	66655	0	0	0	108344	0	0	0	0	0	0	0	0	163526	0	0	0	0	0	0	194698	0	0	0	0	402462	0	0	0	0	0	1564062	0	0	0	5137844	0	0	10938345	0
+FFQ	39	0	0	74040	0	0	0	109236	0	0	0	0	0	0	0	0	163901	0	0	0	0	0	0	199818	0	0	0	0	402198	0	0	0	0	0	1573785	0	0	0	5152707	0	0	10900208	0
+FFQ	40	0	0	82117	0	0	0	113084	0	0	0	0	0	0	0	0	165347	0	0	0	0	0	0	205720	0	0	0	0	402517	0	0	0	0	0	1577961	0	0	0	5155840	0	0	10873211	0
+FFQ	41	0	0	91108	0	0	0	107424	0	0	0	0	0	0	0	0	165874	0	0	0	0	0	0	212167	0	0	0	0	403439	0	0	0	0	0	1590477	0	0	0	5168941	0	0	10836084	0
+FFQ	42	0	0	102306	0	0	0	106524	0	0	0	0	0	0	0	0	163227	0	0	0	0	0	0	217731	0	0	0	0	403568	0	0	0	0	0	1594692	0	0	0	5188518	0	0	10798521	0
+FFQ	43	0	0	113461	0	0	0	105566	0	0	0	0	0	0	0	0	163762	0	0	0	0	0	0	226845	0	0	0	0	402623	0	0	0	0	0	1602299	0	0	0	5194713	0	0	10765448	0
+FFQ	44	0	0	127992	0	0	0	103292	0	0	0	0	0	0	0	0	161844	0	0	0	0	0	0	234717	0	0	0	0	401632	0	0	0	0	0	1618498	0	0	0	5206467	0	0	10720171	0
+FFQ	45	0	0	146743	0	0	0	99382	0	0	0	0	0	0	0	0	157848	0	0	0	0	0	0	242460	0	0	0	0	401753	0	0	0	0	0	1630019	0	0	0	5184900	0	0	10711332	0
+FFQ	46	0	0	171139	0	0	0	94094	0	0	0	0	0	0	0	0	154818	0	0	0	0	0	0	248889	0	0	0	0	401705	0	0	0	0	0	1637377	0	0	0	5203803	0	0	10661983	0
+FFQ	47	0	0	200079	0	0	0	86401	0	0	0	0	0	0	0	0	149983	0	0	0	0	0	0	252443	0	0	0	0	400899	0	0	0	0	0	1643053	0	0	0	5213972	0	0	10610153	0
+FFQ	48	0	0	240223	0	0	0	76248	0	0	0	0	0	0	0	0	143739	0	0	0	0	0	0	255275	0	0	0	0	401446	0	0	0	0	0	1652184	0	0	0	5217727	0	0	10481218	0
+FFQ	49	0	0	290803	0	0	0	54802	0	0	0	0	0	0	0	0	131779	0	0	0	0	0	0	247788	0	0	0	0	392435	0	0	0	0	0	1629666	0	0	0	5126595	0	0	10156850	0
+FFQ	50	0	0	363909	0	0	0	25352	0	0	0	0	0	0	0	0	126109	0	0	0	0	0	0	245269	0	0	0	0	391546	0	0	0	0	0	1648220	0	0	0	5162006	0	0	10068307	0
+FFQ	51	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+# Last Fragment Qualitites. Use `grep ^LFQ | cut -f 2-` to extract this part.
+# Columns correspond to qualities and rows to cycles. First column is the cycle number.
+LFQ	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	4	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	5	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	6	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	7	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	8	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	9	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	10	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	11	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	12	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	13	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	14	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	15	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	16	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	17	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	18	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	19	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	20	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	21	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	22	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	23	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	24	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	25	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	26	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	27	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	28	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	29	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	30	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	31	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	32	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	33	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	34	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	35	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	36	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	37	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	38	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	39	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	40	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	41	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	42	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	43	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	44	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	45	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	46	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	47	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	48	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	49	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	50	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+LFQ	51	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
+# GC Content of first fragments. Use `grep ^GCF | cut -f 2-` to extract this part.
+GCF	0.75	1080
+GCF	1.76	1554
+GCF	2.26	1567
+GCF	3.02	1566
+GCF	3.77	2850
+GCF	4.77	2881
+GCF	5.78	4731
+GCF	6.28	4791
+GCF	7.04	4792
+GCF	7.79	8136
+GCF	8.29	8231
+GCF	9.05	8233
+GCF	9.80	14137
+GCF	10.30	14252
+GCF	10.80	14293
+GCF	11.31	14294
+GCF	11.81	24969
+GCF	12.31	25354
+GCF	13.07	25452
+GCF	13.82	43286
+GCF	14.32	43288
+GCF	14.82	43868
+GCF	15.33	43887
+GCF	15.83	72345
+GCF	16.33	72346
+GCF	16.83	73323
+GCF	17.34	73346
+GCF	17.84	115892
+GCF	18.34	115893
+GCF	18.84	117007
+GCF	19.35	117404
+GCF	19.85	176022
+GCF	20.35	176024
+GCF	20.85	177820
+GCF	21.36	178297
+GCF	21.86	256493
+GCF	22.36	256500
+GCF	22.86	258736
+GCF	23.37	259378
+GCF	23.87	358005
+GCF	24.37	358006
+GCF	24.87	361025
+GCF	25.38	362008
+GCF	25.88	484259
+GCF	26.38	484258
+GCF	26.88	487623
+GCF	27.39	487628
+GCF	27.89	641238
+GCF	28.39	641467
+GCF	28.89	641483
+GCF	29.40	645895
+GCF	29.90	848565
+GCF	30.40	848762
+GCF	30.90	848764
+GCF	31.41	854323
+GCF	31.91	1093044
+GCF	32.66	1093138
+GCF	33.42	1096936
+GCF	33.92	1331028
+GCF	34.42	1331031
+GCF	34.92	1331203
+GCF	35.43	1335750
+GCF	35.93	1505123
+GCF	36.43	1505127
+GCF	36.93	1505175
+GCF	37.44	1508624
+GCF	37.94	1493366
+GCF	38.44	1493657
+GCF	38.94	1493818
+GCF	39.45	1494636
+GCF	39.95	1420236
+GCF	40.45	1420377
+GCF	40.95	1420370
+GCF	41.46	1419738
+GCF	41.96	1313182
+GCF	42.46	1313001
+GCF	42.96	1312999
+GCF	43.47	1313043
+GCF	43.97	1231538
+GCF	44.47	1231204
+GCF	44.97	1231192
+GCF	45.48	1231260
+GCF	45.98	1148968
+GCF	46.48	1148953
+GCF	46.98	1148367
+GCF	47.49	1148340
+GCF	47.99	1059806
+GCF	48.49	1059813
+GCF	49.25	1058887
+GCF	50.25	954205
+GCF	51.01	953262
+GCF	51.51	953251
+GCF	52.01	808649
+GCF	52.51	808641
+GCF	53.02	807799
+GCF	53.52	807784
+GCF	54.02	649395
+GCF	54.52	649184
+GCF	55.03	649178
+GCF	55.53	648304
+GCF	56.03	490867
+GCF	56.53	490638
+GCF	57.04	490632
+GCF	57.54	489794
+GCF	58.04	359200
+GCF	58.54	355526
+GCF	59.05	355524
+GCF	59.55	355031
+GCF	60.05	247759
+GCF	60.55	244574
+GCF	61.06	244459
+GCF	61.56	243954
+GCF	62.06	164265
+GCF	62.56	162114
+GCF	63.07	162022
+GCF	63.57	162018
+GCF	64.07	103863
+GCF	64.57	102491
+GCF	65.08	102446
+GCF	65.58	102445
+GCF	66.08	64175
+GCF	66.83	63383
+GCF	67.59	63356
+GCF	68.09	37977
+GCF	68.59	37240
+GCF	69.10	37235
+GCF	69.60	37220
+GCF	70.10	22861
+GCF	70.60	22555
+GCF	71.11	22552
+GCF	71.61	22533
+GCF	72.11	14370
+GCF	72.61	14369
+GCF	73.37	14229
+GCF	74.12	9740
+GCF	74.62	9736
+GCF	75.13	9636
+GCF	75.63	9635
+GCF	76.13	6719
+GCF	76.63	6701
+GCF	77.14	6630
+GCF	77.64	6632
+GCF	78.14	4609
+GCF	78.64	4605
+GCF	79.40	4595
+GCF	80.15	3154
+GCF	80.65	3156
+GCF	81.41	3128
+GCF	82.16	2097
+GCF	82.66	2096
+GCF	83.42	2082
+GCF	84.17	1523
+GCF	84.67	1522
+GCF	85.43	1519
+GCF	86.68	822
+GCF	87.69	821
+GCF	88.44	544
+GCF	89.20	543
+GCF	89.70	535
+GCF	90.70	303
+GCF	91.71	304
+GCF	92.71	169
+GCF	93.72	167
+GCF	94.97	74
+GCF	96.98	47
+GCF	98.99	19
+# GC Content of last fragments. Use `grep ^GCL | cut -f 2-` to extract this part.
+# ACGT content per cycle. Use `grep ^GCC | cut -f 2-` to extract this part. The columns are: cycle; A,C,G,T base counts as a percentage of all A/C/G/T bases [%]; and N and O counts as a percentage of all A/C/G/T bases [%]
+GCC	1	29.99	19.73	19.50	30.79	0.22	0.00
+GCC	2	29.97	19.73	19.48	30.83	0.00	0.00
+GCC	3	29.53	20.19	19.82	30.46	0.00	0.00
+GCC	4	29.46	20.23	19.95	30.36	0.00	0.00
+GCC	5	29.50	20.16	19.89	30.46	0.00	0.00
+GCC	6	29.32	20.45	20.06	30.17	0.00	0.00
+GCC	7	29.42	20.32	19.92	30.34	0.00	0.00
+GCC	8	29.44	20.26	19.90	30.41	0.00	0.00
+GCC	9	29.45	20.23	19.91	30.41	0.00	0.00
+GCC	10	29.35	20.34	19.98	30.33	0.00	0.00
+GCC	11	29.39	20.25	19.92	30.43	0.00	0.00
+GCC	12	29.40	20.32	19.93	30.35	0.00	0.00
+GCC	13	29.45	20.28	19.86	30.42	0.00	0.00
+GCC	14	29.41	20.26	19.85	30.48	0.00	0.00
+GCC	15	29.40	20.31	19.91	30.38	0.00	0.00
+GCC	16	29.24	20.40	20.03	30.33	0.00	0.00
+GCC	17	29.29	20.29	20.02	30.39	0.00	0.00
+GCC	18	29.20	20.38	20.15	30.27	0.00	0.00
+GCC	19	29.21	20.39	20.14	30.25	0.00	0.00
+GCC	20	29.21	20.36	20.21	30.23	0.00	0.00
+GCC	21	29.18	20.39	20.26	30.17	0.00	0.00
+GCC	22	29.16	20.41	20.19	30.24	0.00	0.00
+GCC	23	29.12	20.41	20.23	30.24	0.00	0.00
+GCC	24	29.12	20.47	20.20	30.21	0.00	0.00
+GCC	25	29.13	20.47	20.20	30.20	0.00	0.00
+GCC	26	29.11	20.47	20.26	30.16	0.00	0.00
+GCC	27	29.07	20.49	20.26	30.19	0.00	0.00
+GCC	28	28.99	20.56	20.38	30.07	0.00	0.00
+GCC	29	29.09	20.48	20.30	30.13	0.00	0.00
+GCC	30	29.06	20.49	20.37	30.08	0.00	0.00
+GCC	31	29.00	20.58	20.36	30.06	0.00	0.00
+GCC	32	29.01	20.56	20.34	30.09	0.00	0.00
+GCC	33	29.00	20.59	20.31	30.10	0.00	0.00
+GCC	34	28.97	20.65	20.30	30.09	0.00	0.00
+GCC	35	29.00	20.59	20.26	30.14	0.00	0.00
+GCC	36	28.96	20.66	20.30	30.08	0.00	0.00
+GCC	37	28.98	20.73	20.26	30.03	0.00	0.00
+GCC	38	28.96	20.75	20.30	29.99	0.00	0.00
+GCC	39	28.98	20.73	20.34	29.94	0.00	0.00
+GCC	40	28.93	20.76	20.39	29.92	0.00	0.00
+GCC	41	28.97	20.69	20.35	29.99	0.00	0.00
+GCC	42	28.96	20.68	20.36	29.99	0.01	0.00
+GCC	43	28.93	20.73	20.36	29.98	0.00	0.00
+GCC	44	29.02	20.71	20.33	29.94	0.00	0.00
+GCC	45	29.04	20.69	20.30	29.98	0.00	0.00
+GCC	46	29.00	20.71	20.38	29.91	0.01	0.00
+GCC	47	29.01	20.70	20.39	29.89	0.00	0.00
+GCC	48	28.93	20.78	20.47	29.82	0.00	0.00
+GCC	49	28.54	21.12	20.84	29.50	0.02	0.00
+GCC	50	29.58	20.06	19.83	30.53	0.00	0.00
+# Insert sizes. Use `grep ^IS | cut -f 2-` to extract this part. The columns are: insert size, pairs total, inward oriented pairs, outward oriented pairs, other pairs
+# Read lengths. Use `grep ^RL | cut -f 2-` to extract this part. The columns are: read length, count
+RL	30	24
+RL	31	25
+RL	32	22
+RL	33	22
+RL	34	39
+RL	35	43
+RL	36	36
+RL	37	31
+RL	38	43
+RL	39	96
+RL	40	283
+RL	41	427
+RL	42	370
+RL	43	104
+RL	44	176
+RL	45	629
+RL	46	16825
+RL	47	88923
+RL	48	437342
+RL	50	18030718
+# Indel distribution. Use `grep ^ID | cut -f 2-` to extract this part. The columns are: length, number of insertions, number of deletions
+ID	1	55991	87210
+ID	2	11097	13144
+ID	3	1413	1466
+# Indels per cycle. Use `grep ^IC | cut -f 2-` to extract this part. The columns are: cycle, number of insertions (fwd), .. (rev) , number of deletions (fwd), .. (rev)
+IC	2	0	135	0	131
+IC	3	0	500	0	654
+IC	4	0	799	0	1454
+IC	5	0	1390	0	1639
+IC	6	0	1371	0	1820
+IC	7	0	1345	0	1970
+IC	8	0	1321	0	2059
+IC	9	0	1429	0	2103
+IC	10	0	1477	0	2217
+IC	11	0	1488	0	2270
+IC	12	0	1593	0	2376
+IC	13	0	1586	0	2410
+IC	14	0	1602	0	2512
+IC	15	0	1664	0	2466
+IC	16	0	1631	0	2573
+IC	17	0	1711	0	2657
+IC	18	0	1651	0	2522
+IC	19	0	1667	0	2561
+IC	20	0	1661	0	2595
+IC	21	0	1644	0	2607
+IC	22	0	1725	0	2630
+IC	23	0	1690	0	2566
+IC	24	0	1725	0	2682
+IC	25	0	1625	0	2561
+IC	26	0	1624	0	2554
+IC	27	0	1636	0	2528
+IC	28	0	1694	0	2587
+IC	29	0	1729	0	2622
+IC	30	0	1712	0	2609
+IC	31	0	1846	0	2834
+IC	32	0	1834	0	2772
+IC	33	0	1820	0	2755
+IC	34	0	1850	0	2757
+IC	35	0	1754	0	2768
+IC	36	0	1744	0	2569
+IC	37	0	1665	0	2504
+IC	38	0	1622	0	2483
+IC	39	0	1559	0	2523
+IC	40	0	1544	0	2495
+IC	41	0	1518	0	2378
+IC	42	0	1406	0	2210
+IC	43	0	1353	0	2026
+IC	44	0	1295	0	1795
+IC	45	0	1290	0	1168
+IC	46	0	779	0	587
+IC	47	0	529	0	202
+IC	48	0	192	0	59
+IC	49	0	76	0	0
+# Coverage distribution. Use `grep ^COV | cut -f 2-` to extract this part.
+COV	[1-1]	1	582941672
+COV	[2-2]	2	97104308
+COV	[3-3]	3	11593609
+COV	[4-4]	4	1244538
+COV	[5-5]	5	189629
+COV	[6-6]	6	63129
+COV	[7-7]	7	34669
+COV	[8-8]	8	22305
+COV	[9-9]	9	16271
+COV	[10-10]	10	12620
+COV	[11-11]	11	9896
+COV	[12-12]	12	8348
+COV	[13-13]	13	6759
+COV	[14-14]	14	5217
+COV	[15-15]	15	4028
+COV	[16-16]	16	3370
+COV	[17-17]	17	2988
+COV	[18-18]	18	2649
+COV	[19-19]	19	2532
+COV	[20-20]	20	2332
+COV	[21-21]	21	2037
+COV	[22-22]	22	2291
+COV	[23-23]	23	2356
+COV	[24-24]	24	2209
+COV	[25-25]	25	2242
+COV	[26-26]	26	2173
+COV	[27-27]	27	1819
+COV	[28-28]	28	1955
+COV	[29-29]	29	1860
+COV	[30-30]	30	1861
+COV	[31-31]	31	1704
+COV	[32-32]	32	1602
+COV	[33-33]	33	1596
+COV	[34-34]	34	1526
+COV	[35-35]	35	1392
+COV	[36-36]	36	1437
+COV	[37-37]	37	1401
+COV	[38-38]	38	1429
+COV	[39-39]	39	1317
+COV	[40-40]	40	1334
+COV	[41-41]	41	1242
+COV	[42-42]	42	1199
+COV	[43-43]	43	1198
+COV	[44-44]	44	1031
+COV	[45-45]	45	1130
+COV	[46-46]	46	1146
+COV	[47-47]	47	1000
+COV	[48-48]	48	1025
+COV	[49-49]	49	1051
+COV	[50-50]	50	1080
+COV	[51-51]	51	1077
+COV	[52-52]	52	1071
+COV	[53-53]	53	1005
+COV	[54-54]	54	965
+COV	[55-55]	55	931
+COV	[56-56]	56	1060
+COV	[57-57]	57	1035
+COV	[58-58]	58	965
+COV	[59-59]	59	938
+COV	[60-60]	60	1023
+COV	[61-61]	61	1011
+COV	[62-62]	62	995
+COV	[63-63]	63	966
+COV	[64-64]	64	881
+COV	[65-65]	65	818
+COV	[66-66]	66	810
+COV	[67-67]	67	772
+COV	[68-68]	68	780
+COV	[69-69]	69	717
+COV	[70-70]	70	566
+COV	[71-71]	71	587
+COV	[72-72]	72	557
+COV	[73-73]	73	515
+COV	[74-74]	74	530
+COV	[75-75]	75	531
+COV	[76-76]	76	435
+COV	[77-77]	77	418
+COV	[78-78]	78	443
+COV	[79-79]	79	433
+COV	[80-80]	80	361
+COV	[81-81]	81	358
+COV	[82-82]	82	351
+COV	[83-83]	83	339
+COV	[84-84]	84	274
+COV	[85-85]	85	303
+COV	[86-86]	86	243
+COV	[87-87]	87	299
+COV	[88-88]	88	258
+COV	[89-89]	89	275
+COV	[90-90]	90	235
+COV	[91-91]	91	229
+COV	[92-92]	92	208
+COV	[93-93]	93	234
+COV	[94-94]	94	205
+COV	[95-95]	95	240
+COV	[96-96]	96	253
+COV	[97-97]	97	199
+COV	[98-98]	98	200
+COV	[99-99]	99	216
+COV	[100-100]	100	223
+COV	[101-101]	101	202
+COV	[102-102]	102	187
+COV	[103-103]	103	189
+COV	[104-104]	104	186
+COV	[105-105]	105	229
+COV	[106-106]	106	182
+COV	[107-107]	107	180
+COV	[108-108]	108	181
+COV	[109-109]	109	190
+COV	[110-110]	110	149
+COV	[111-111]	111	197
+COV	[112-112]	112	189
+COV	[113-113]	113	199
+COV	[114-114]	114	208
+COV	[115-115]	115	167
+COV	[116-116]	116	166
+COV	[117-117]	117	134
+COV	[118-118]	118	165
+COV	[119-119]	119	146
+COV	[120-120]	120	149
+COV	[121-121]	121	144
+COV	[122-122]	122	169
+COV	[123-123]	123	148
+COV	[124-124]	124	140
+COV	[125-125]	125	151
+COV	[126-126]	126	141
+COV	[127-127]	127	162
+COV	[128-128]	128	149
+COV	[129-129]	129	133
+COV	[130-130]	130	143
+COV	[131-131]	131	164
+COV	[132-132]	132	141
+COV	[133-133]	133	121
+COV	[134-134]	134	136
+COV	[135-135]	135	150
+COV	[136-136]	136	134
+COV	[137-137]	137	131
+COV	[138-138]	138	139
+COV	[139-139]	139	117
+COV	[140-140]	140	141
+COV	[141-141]	141	138
+COV	[142-142]	142	116
+COV	[143-143]	143	120
+COV	[144-144]	144	127
+COV	[145-145]	145	107
+COV	[146-146]	146	130
+COV	[147-147]	147	137
+COV	[148-148]	148	149
+COV	[149-149]	149	132
+COV	[150-150]	150	125
+COV	[151-151]	151	102
+COV	[152-152]	152	105
+COV	[153-153]	153	111
+COV	[154-154]	154	115
+COV	[155-155]	155	104
+COV	[156-156]	156	104
+COV	[157-157]	157	120
+COV	[158-158]	158	104
+COV	[159-159]	159	123
+COV	[160-160]	160	126
+COV	[161-161]	161	99
+COV	[162-162]	162	125
+COV	[163-163]	163	103
+COV	[164-164]	164	124
+COV	[165-165]	165	113
+COV	[166-166]	166	103
+COV	[167-167]	167	141
+COV	[168-168]	168	121
+COV	[169-169]	169	118
+COV	[170-170]	170	130
+COV	[171-171]	171	158
+COV	[172-172]	172	121
+COV	[173-173]	173	101
+COV	[174-174]	174	110
+COV	[175-175]	175	123
+COV	[176-176]	176	121
+COV	[177-177]	177	101
+COV	[178-178]	178	106
+COV	[179-179]	179	108
+COV	[180-180]	180	103
+COV	[181-181]	181	115
+COV	[182-182]	182	99
+COV	[183-183]	183	122
+COV	[184-184]	184	102
+COV	[185-185]	185	104
+COV	[186-186]	186	123
+COV	[187-187]	187	104
+COV	[188-188]	188	115
+COV	[189-189]	189	97
+COV	[190-190]	190	121
+COV	[191-191]	191	89
+COV	[192-192]	192	118
+COV	[193-193]	193	122
+COV	[194-194]	194	104
+COV	[195-195]	195	85
+COV	[196-196]	196	96
+COV	[197-197]	197	87
+COV	[198-198]	198	92
+COV	[199-199]	199	78
+COV	[200-200]	200	92
+COV	[201-201]	201	96
+COV	[202-202]	202	75
+COV	[203-203]	203	88
+COV	[204-204]	204	87
+COV	[205-205]	205	100
+COV	[206-206]	206	91
+COV	[207-207]	207	79
+COV	[208-208]	208	89
+COV	[209-209]	209	92
+COV	[210-210]	210	91
+COV	[211-211]	211	73
+COV	[212-212]	212	112
+COV	[213-213]	213	119
+COV	[214-214]	214	98
+COV	[215-215]	215	95
+COV	[216-216]	216	93
+COV	[217-217]	217	95
+COV	[218-218]	218	95
+COV	[219-219]	219	79
+COV	[220-220]	220	76
+COV	[221-221]	221	61
+COV	[222-222]	222	90
+COV	[223-223]	223	74
+COV	[224-224]	224	64
+COV	[225-225]	225	75
+COV	[226-226]	226	77
+COV	[227-227]	227	74
+COV	[228-228]	228	79
+COV	[229-229]	229	63
+COV	[230-230]	230	57
+COV	[231-231]	231	68
+COV	[232-232]	232	66
+COV	[233-233]	233	65
+COV	[234-234]	234	75
+COV	[235-235]	235	71
+COV	[236-236]	236	63
+COV	[237-237]	237	72
+COV	[238-238]	238	95
+COV	[239-239]	239	67
+COV	[240-240]	240	86
+COV	[241-241]	241	81
+COV	[242-242]	242	77
+COV	[243-243]	243	99
+COV	[244-244]	244	80
+COV	[245-245]	245	68
+COV	[246-246]	246	66
+COV	[247-247]	247	61
+COV	[248-248]	248	82
+COV	[249-249]	249	75
+COV	[250-250]	250	59
+COV	[251-251]	251	74
+COV	[252-252]	252	79
+COV	[253-253]	253	78
+COV	[254-254]	254	61
+COV	[255-255]	255	79
+COV	[256-256]	256	74
+COV	[257-257]	257	71
+COV	[258-258]	258	82
+COV	[259-259]	259	77
+COV	[260-260]	260	76
+COV	[261-261]	261	65
+COV	[262-262]	262	65
+COV	[263-263]	263	90
+COV	[264-264]	264	70
+COV	[265-265]	265	69
+COV	[266-266]	266	82
+COV	[267-267]	267	65
+COV	[268-268]	268	91
+COV	[269-269]	269	74
+COV	[270-270]	270	83
+COV	[271-271]	271	79
+COV	[272-272]	272	69
+COV	[273-273]	273	63
+COV	[274-274]	274	73
+COV	[275-275]	275	80
+COV	[276-276]	276	68
+COV	[277-277]	277	69
+COV	[278-278]	278	64
+COV	[279-279]	279	60
+COV	[280-280]	280	67
+COV	[281-281]	281	55
+COV	[282-282]	282	54
+COV	[283-283]	283	59
+COV	[284-284]	284	74
+COV	[285-285]	285	63
+COV	[286-286]	286	69
+COV	[287-287]	287	72
+COV	[288-288]	288	72
+COV	[289-289]	289	73
+COV	[290-290]	290	61
+COV	[291-291]	291	72
+COV	[292-292]	292	72
+COV	[293-293]	293	64
+COV	[294-294]	294	68
+COV	[295-295]	295	73
+COV	[296-296]	296	60
+COV	[297-297]	297	65
+COV	[298-298]	298	59
+COV	[299-299]	299	71
+COV	[300-300]	300	51
+COV	[301-301]	301	55
+COV	[302-302]	302	69
+COV	[303-303]	303	65
+COV	[304-304]	304	49
+COV	[305-305]	305	59
+COV	[306-306]	306	56
+COV	[307-307]	307	66
+COV	[308-308]	308	68
+COV	[309-309]	309	58
+COV	[310-310]	310	67
+COV	[311-311]	311	59
+COV	[312-312]	312	50
+COV	[313-313]	313	64
+COV	[314-314]	314	57
+COV	[315-315]	315	62
+COV	[316-316]	316	56
+COV	[317-317]	317	46
+COV	[318-318]	318	50
+COV	[319-319]	319	51
+COV	[320-320]	320	51
+COV	[321-321]	321	49
+COV	[322-322]	322	52
+COV	[323-323]	323	51
+COV	[324-324]	324	46
+COV	[325-325]	325	50
+COV	[326-326]	326	50
+COV	[327-327]	327	53
+COV	[328-328]	328	59
+COV	[329-329]	329	54
+COV	[330-330]	330	55
+COV	[331-331]	331	58
+COV	[332-332]	332	58
+COV	[333-333]	333	52
+COV	[334-334]	334	52
+COV	[335-335]	335	50
+COV	[336-336]	336	60
+COV	[337-337]	337	63
+COV	[338-338]	338	53
+COV	[339-339]	339	50
+COV	[340-340]	340	57
+COV	[341-341]	341	69
+COV	[342-342]	342	53
+COV	[343-343]	343	46
+COV	[344-344]	344	63
+COV	[345-345]	345	53
+COV	[346-346]	346	50
+COV	[347-347]	347	52
+COV	[348-348]	348	48
+COV	[349-349]	349	52
+COV	[350-350]	350	44
+COV	[351-351]	351	59
+COV	[352-352]	352	51
+COV	[353-353]	353	51
+COV	[354-354]	354	48
+COV	[355-355]	355	52
+COV	[356-356]	356	81
+COV	[357-357]	357	49
+COV	[358-358]	358	58
+COV	[359-359]	359	51
+COV	[360-360]	360	39
+COV	[361-361]	361	37
+COV	[362-362]	362	39
+COV	[363-363]	363	50
+COV	[364-364]	364	41
+COV	[365-365]	365	39
+COV	[366-366]	366	46
+COV	[367-367]	367	58
+COV	[368-368]	368	40
+COV	[369-369]	369	52
+COV	[370-370]	370	41
+COV	[371-371]	371	42
+COV	[372-372]	372	45
+COV	[373-373]	373	40
+COV	[374-374]	374	43
+COV	[375-375]	375	53
+COV	[376-376]	376	42
+COV	[377-377]	377	55
+COV	[378-378]	378	47
+COV	[379-379]	379	45
+COV	[380-380]	380	40
+COV	[381-381]	381	43
+COV	[382-382]	382	39
+COV	[383-383]	383	51
+COV	[384-384]	384	43
+COV	[385-385]	385	58
+COV	[386-386]	386	43
+COV	[387-387]	387	55
+COV	[388-388]	388	50
+COV	[389-389]	389	42
+COV	[390-390]	390	40
+COV	[391-391]	391	54
+COV	[392-392]	392	40
+COV	[393-393]	393	41
+COV	[394-394]	394	41
+COV	[395-395]	395	33
+COV	[396-396]	396	36
+COV	[397-397]	397	29
+COV	[398-398]	398	47
+COV	[399-399]	399	49
+COV	[400-400]	400	31
+COV	[401-401]	401	37
+COV	[402-402]	402	34
+COV	[403-403]	403	38
+COV	[404-404]	404	40
+COV	[405-405]	405	44
+COV	[406-406]	406	47
+COV	[407-407]	407	52
+COV	[408-408]	408	40
+COV	[409-409]	409	50
+COV	[410-410]	410	38
+COV	[411-411]	411	40
+COV	[412-412]	412	35
+COV	[413-413]	413	39
+COV	[414-414]	414	36
+COV	[415-415]	415	44
+COV	[416-416]	416	42
+COV	[417-417]	417	44
+COV	[418-418]	418	53
+COV	[419-419]	419	51
+COV	[420-420]	420	41
+COV	[421-421]	421	36
+COV	[422-422]	422	46
+COV	[423-423]	423	35
+COV	[424-424]	424	38
+COV	[425-425]	425	33
+COV	[426-426]	426	55
+COV	[427-427]	427	47
+COV	[428-428]	428	34
+COV	[429-429]	429	35
+COV	[430-430]	430	43
+COV	[431-431]	431	42
+COV	[432-432]	432	35
+COV	[433-433]	433	40
+COV	[434-434]	434	34
+COV	[435-435]	435	33
+COV	[436-436]	436	42
+COV	[437-437]	437	42
+COV	[438-438]	438	34
+COV	[439-439]	439	47
+COV	[440-440]	440	44
+COV	[441-441]	441	39
+COV	[442-442]	442	28
+COV	[443-443]	443	37
+COV	[444-444]	444	45
+COV	[445-445]	445	32
+COV	[446-446]	446	34
+COV	[447-447]	447	40
+COV	[448-448]	448	31
+COV	[449-449]	449	38
+COV	[450-450]	450	34
+COV	[451-451]	451	40
+COV	[452-452]	452	27
+COV	[453-453]	453	59
+COV	[454-454]	454	45
+COV	[455-455]	455	41
+COV	[456-456]	456	44
+COV	[457-457]	457	42
+COV	[458-458]	458	52
+COV	[459-459]	459	37
+COV	[460-460]	460	48
+COV	[461-461]	461	43
+COV	[462-462]	462	40
+COV	[463-463]	463	40
+COV	[464-464]	464	39
+COV	[465-465]	465	38
+COV	[466-466]	466	38
+COV	[467-467]	467	30
+COV	[468-468]	468	24
+COV	[469-469]	469	37
+COV	[470-470]	470	33
+COV	[471-471]	471	26
+COV	[472-472]	472	28
+COV	[473-473]	473	30
+COV	[474-474]	474	35
+COV	[475-475]	475	22
+COV	[476-476]	476	31
+COV	[477-477]	477	26
+COV	[478-478]	478	31
+COV	[479-479]	479	36
+COV	[480-480]	480	37
+COV	[481-481]	481	22
+COV	[482-482]	482	31
+COV	[483-483]	483	39
+COV	[484-484]	484	38
+COV	[485-485]	485	40
+COV	[486-486]	486	31
+COV	[487-487]	487	41
+COV	[488-488]	488	40
+COV	[489-489]	489	38
+COV	[490-490]	490	28
+COV	[491-491]	491	24
+COV	[492-492]	492	35
+COV	[493-493]	493	23
+COV	[494-494]	494	39
+COV	[495-495]	495	23
+COV	[496-496]	496	24
+COV	[497-497]	497	20
+COV	[498-498]	498	31
+COV	[499-499]	499	23
+COV	[500-500]	500	38
+COV	[501-501]	501	23
+COV	[502-502]	502	27
+COV	[503-503]	503	29
+COV	[504-504]	504	17
+COV	[505-505]	505	34
+COV	[506-506]	506	36
+COV	[507-507]	507	20
+COV	[508-508]	508	25
+COV	[509-509]	509	31
+COV	[510-510]	510	26
+COV	[511-511]	511	25
+COV	[512-512]	512	39
+COV	[513-513]	513	21
+COV	[514-514]	514	25
+COV	[515-515]	515	49
+COV	[516-516]	516	28
+COV	[517-517]	517	31
+COV	[518-518]	518	33
+COV	[519-519]	519	27
+COV	[520-520]	520	35
+COV	[521-521]	521	30
+COV	[522-522]	522	34
+COV	[523-523]	523	22
+COV	[524-524]	524	27
+COV	[525-525]	525	30
+COV	[526-526]	526	30
+COV	[527-527]	527	29
+COV	[528-528]	528	25
+COV	[529-529]	529	23
+COV	[530-530]	530	27
+COV	[531-531]	531	18
+COV	[532-532]	532	19
+COV	[533-533]	533	19
+COV	[534-534]	534	31
+COV	[535-535]	535	27
+COV	[536-536]	536	26
+COV	[537-537]	537	23
+COV	[538-538]	538	24
+COV	[539-539]	539	23
+COV	[540-540]	540	21
+COV	[541-541]	541	37
+COV	[542-542]	542	31
+COV	[543-543]	543	26
+COV	[544-544]	544	29
+COV	[545-545]	545	25
+COV	[546-546]	546	26
+COV	[547-547]	547	22
+COV	[548-548]	548	32
+COV	[549-549]	549	36
+COV	[550-550]	550	24
+COV	[551-551]	551	33
+COV	[552-552]	552	18
+COV	[553-553]	553	31
+COV	[554-554]	554	21
+COV	[555-555]	555	25
+COV	[556-556]	556	20
+COV	[557-557]	557	25
+COV	[558-558]	558	33
+COV	[559-559]	559	18
+COV	[560-560]	560	37
+COV	[561-561]	561	24
+COV	[562-562]	562	23
+COV	[563-563]	563	27
+COV	[564-564]	564	26
+COV	[565-565]	565	28
+COV	[566-566]	566	23
+COV	[567-567]	567	24
+COV	[568-568]	568	29
+COV	[569-569]	569	26
+COV	[570-570]	570	19
+COV	[571-571]	571	21
+COV	[572-572]	572	25
+COV	[573-573]	573	15
+COV	[574-574]	574	21
+COV	[575-575]	575	17
+COV	[576-576]	576	16
+COV	[577-577]	577	26
+COV	[578-578]	578	22
+COV	[579-579]	579	25
+COV	[580-580]	580	28
+COV	[581-581]	581	25
+COV	[582-582]	582	33
+COV	[583-583]	583	13
+COV	[584-584]	584	19
+COV	[585-585]	585	28
+COV	[586-586]	586	28
+COV	[587-587]	587	22
+COV	[588-588]	588	23
+COV	[589-589]	589	28
+COV	[590-590]	590	20
+COV	[591-591]	591	18
+COV	[592-592]	592	36
+COV	[593-593]	593	26
+COV	[594-594]	594	28
+COV	[595-595]	595	28
+COV	[596-596]	596	18
+COV	[597-597]	597	28
+COV	[598-598]	598	21
+COV	[599-599]	599	25
+COV	[600-600]	600	20
+COV	[601-601]	601	22
+COV	[602-602]	602	21
+COV	[603-603]	603	34
+COV	[604-604]	604	21
+COV	[605-605]	605	28
+COV	[606-606]	606	19
+COV	[607-607]	607	22
+COV	[608-608]	608	19
+COV	[609-609]	609	20
+COV	[610-610]	610	19
+COV	[611-611]	611	33
+COV	[612-612]	612	20
+COV	[613-613]	613	19
+COV	[614-614]	614	20
+COV	[615-615]	615	34
+COV	[616-616]	616	26
+COV	[617-617]	617	22
+COV	[618-618]	618	16
+COV	[619-619]	619	14
+COV	[620-620]	620	26
+COV	[621-621]	621	28
+COV	[622-622]	622	29
+COV	[623-623]	623	26
+COV	[624-624]	624	32
+COV	[625-625]	625	36
+COV	[626-626]	626	24
+COV	[627-627]	627	21
+COV	[628-628]	628	20
+COV	[629-629]	629	26
+COV	[630-630]	630	32
+COV	[631-631]	631	17
+COV	[632-632]	632	22
+COV	[633-633]	633	27
+COV	[634-634]	634	17
+COV	[635-635]	635	20
+COV	[636-636]	636	27
+COV	[637-637]	637	24
+COV	[638-638]	638	21
+COV	[639-639]	639	19
+COV	[640-640]	640	38
+COV	[641-641]	641	22
+COV	[642-642]	642	18
+COV	[643-643]	643	27
+COV	[644-644]	644	19
+COV	[645-645]	645	22
+COV	[646-646]	646	24
+COV	[647-647]	647	20
+COV	[648-648]	648	15
+COV	[649-649]	649	28
+COV	[650-650]	650	25
+COV	[651-651]	651	26
+COV	[652-652]	652	25
+COV	[653-653]	653	22
+COV	[654-654]	654	22
+COV	[655-655]	655	21
+COV	[656-656]	656	16
+COV	[657-657]	657	17
+COV	[658-658]	658	19
+COV	[659-659]	659	22
+COV	[660-660]	660	18
+COV	[661-661]	661	31
+COV	[662-662]	662	14
+COV	[663-663]	663	18
+COV	[664-664]	664	13
+COV	[665-665]	665	21
+COV	[666-666]	666	25
+COV	[667-667]	667	17
+COV	[668-668]	668	21
+COV	[669-669]	669	17
+COV	[670-670]	670	20
+COV	[671-671]	671	23
+COV	[672-672]	672	18
+COV	[673-673]	673	26
+COV	[674-674]	674	23
+COV	[675-675]	675	16
+COV	[676-676]	676	18
+COV	[677-677]	677	13
+COV	[678-678]	678	20
+COV	[679-679]	679	20
+COV	[680-680]	680	21
+COV	[681-681]	681	21
+COV	[682-682]	682	22
+COV	[683-683]	683	19
+COV	[684-684]	684	20
+COV	[685-685]	685	32
+COV	[686-686]	686	26
+COV	[687-687]	687	19
+COV	[688-688]	688	19
+COV	[689-689]	689	21
+COV	[690-690]	690	24
+COV	[691-691]	691	19
+COV	[692-692]	692	30
+COV	[693-693]	693	23
+COV	[694-694]	694	16
+COV	[695-695]	695	17
+COV	[696-696]	696	26
+COV	[697-697]	697	25
+COV	[698-698]	698	20
+COV	[699-699]	699	33
+COV	[700-700]	700	30
+COV	[701-701]	701	23
+COV	[702-702]	702	33
+COV	[703-703]	703	24
+COV	[704-704]	704	18
+COV	[705-705]	705	31
+COV	[706-706]	706	22
+COV	[707-707]	707	36
+COV	[708-708]	708	32
+COV	[709-709]	709	34
+COV	[710-710]	710	27
+COV	[711-711]	711	23
+COV	[712-712]	712	23
+COV	[713-713]	713	31
+COV	[714-714]	714	43
+COV	[715-715]	715	34
+COV	[716-716]	716	21
+COV	[717-717]	717	19
+COV	[718-718]	718	29
+COV	[719-719]	719	21
+COV	[720-720]	720	24
+COV	[721-721]	721	25
+COV	[722-722]	722	26
+COV	[723-723]	723	19
+COV	[724-724]	724	33
+COV	[725-725]	725	25
+COV	[726-726]	726	19
+COV	[727-727]	727	27
+COV	[728-728]	728	22
+COV	[729-729]	729	18
+COV	[730-730]	730	20
+COV	[731-731]	731	22
+COV	[732-732]	732	19
+COV	[733-733]	733	19
+COV	[734-734]	734	22
+COV	[735-735]	735	21
+COV	[736-736]	736	24
+COV	[737-737]	737	29
+COV	[738-738]	738	17
+COV	[739-739]	739	29
+COV	[740-740]	740	30
+COV	[741-741]	741	30
+COV	[742-742]	742	26
+COV	[743-743]	743	26
+COV	[744-744]	744	29
+COV	[745-745]	745	27
+COV	[746-746]	746	23
+COV	[747-747]	747	21
+COV	[748-748]	748	26
+COV	[749-749]	749	24
+COV	[750-750]	750	30
+COV	[751-751]	751	22
+COV	[752-752]	752	31
+COV	[753-753]	753	29
+COV	[754-754]	754	17
+COV	[755-755]	755	22
+COV	[756-756]	756	30
+COV	[757-757]	757	30
+COV	[758-758]	758	20
+COV	[759-759]	759	25
+COV	[760-760]	760	24
+COV	[761-761]	761	33
+COV	[762-762]	762	24
+COV	[763-763]	763	20
+COV	[764-764]	764	12
+COV	[765-765]	765	16
+COV	[766-766]	766	24
+COV	[767-767]	767	19
+COV	[768-768]	768	19
+COV	[769-769]	769	22
+COV	[770-770]	770	14
+COV	[771-771]	771	17
+COV	[772-772]	772	16
+COV	[773-773]	773	23
+COV	[774-774]	774	17
+COV	[775-775]	775	18
+COV	[776-776]	776	21
+COV	[777-777]	777	15
+COV	[778-778]	778	15
+COV	[779-779]	779	18
+COV	[780-780]	780	24
+COV	[781-781]	781	16
+COV	[782-782]	782	22
+COV	[783-783]	783	22
+COV	[784-784]	784	10
+COV	[785-785]	785	16
+COV	[786-786]	786	13
+COV	[787-787]	787	9
+COV	[788-788]	788	20
+COV	[789-789]	789	23
+COV	[790-790]	790	16
+COV	[791-791]	791	23
+COV	[792-792]	792	22
+COV	[793-793]	793	24
+COV	[794-794]	794	15
+COV	[795-795]	795	26
+COV	[796-796]	796	23
+COV	[797-797]	797	23
+COV	[798-798]	798	12
+COV	[799-799]	799	12
+COV	[800-800]	800	20
+COV	[801-801]	801	21
+COV	[802-802]	802	15
+COV	[803-803]	803	17
+COV	[804-804]	804	17
+COV	[805-805]	805	11
+COV	[806-806]	806	10
+COV	[807-807]	807	18
+COV	[808-808]	808	16
+COV	[809-809]	809	19
+COV	[810-810]	810	22
+COV	[811-811]	811	19
+COV	[812-812]	812	10
+COV	[813-813]	813	17
+COV	[814-814]	814	10
+COV	[815-815]	815	21
+COV	[816-816]	816	28
+COV	[817-817]	817	11
+COV	[818-818]	818	19
+COV	[819-819]	819	21
+COV	[820-820]	820	12
+COV	[821-821]	821	18
+COV	[822-822]	822	11
+COV	[823-823]	823	21
+COV	[824-824]	824	13
+COV	[825-825]	825	16
+COV	[826-826]	826	18
+COV	[827-827]	827	20
+COV	[828-828]	828	23
+COV	[829-829]	829	12
+COV	[830-830]	830	20
+COV	[831-831]	831	9
+COV	[832-832]	832	19
+COV	[833-833]	833	14
+COV	[834-834]	834	23
+COV	[835-835]	835	18
+COV	[836-836]	836	20
+COV	[837-837]	837	14
+COV	[838-838]	838	18
+COV	[839-839]	839	15
+COV	[840-840]	840	18
+COV	[841-841]	841	8
+COV	[842-842]	842	22
+COV	[843-843]	843	15
+COV	[844-844]	844	23
+COV	[845-845]	845	16
+COV	[846-846]	846	20
+COV	[847-847]	847	18
+COV	[848-848]	848	13
+COV	[849-849]	849	14
+COV	[850-850]	850	19
+COV	[851-851]	851	18
+COV	[852-852]	852	19
+COV	[853-853]	853	20
+COV	[854-854]	854	16
+COV	[855-855]	855	11
+COV	[856-856]	856	18
+COV	[857-857]	857	9
+COV	[858-858]	858	15
+COV	[859-859]	859	25
+COV	[860-860]	860	17
+COV	[861-861]	861	18
+COV	[862-862]	862	14
+COV	[863-863]	863	22
+COV	[864-864]	864	9
+COV	[865-865]	865	15
+COV	[866-866]	866	20
+COV	[867-867]	867	9
+COV	[868-868]	868	20
+COV	[869-869]	869	15
+COV	[870-870]	870	19
+COV	[871-871]	871	12
+COV	[872-872]	872	23
+COV	[873-873]	873	13
+COV	[874-874]	874	25
+COV	[875-875]	875	15
+COV	[876-876]	876	15
+COV	[877-877]	877	22
+COV	[878-878]	878	19
+COV	[879-879]	879	12
+COV	[880-880]	880	22
+COV	[881-881]	881	16
+COV	[882-882]	882	23
+COV	[883-883]	883	12
+COV	[884-884]	884	15
+COV	[885-885]	885	18
+COV	[886-886]	886	16
+COV	[887-887]	887	11
+COV	[888-888]	888	19
+COV	[889-889]	889	24
+COV	[890-890]	890	17
+COV	[891-891]	891	11
+COV	[892-892]	892	24
+COV	[893-893]	893	25
+COV	[894-894]	894	16
+COV	[895-895]	895	21
+COV	[896-896]	896	17
+COV	[897-897]	897	23
+COV	[898-898]	898	18
+COV	[899-899]	899	16
+COV	[900-900]	900	14
+COV	[901-901]	901	25
+COV	[902-902]	902	19
+COV	[903-903]	903	19
+COV	[904-904]	904	18
+COV	[905-905]	905	15
+COV	[906-906]	906	9
+COV	[907-907]	907	20
+COV	[908-908]	908	11
+COV	[909-909]	909	14
+COV	[910-910]	910	20
+COV	[911-911]	911	12
+COV	[912-912]	912	15
+COV	[913-913]	913	8
+COV	[914-914]	914	20
+COV	[915-915]	915	15
+COV	[916-916]	916	19
+COV	[917-917]	917	16
+COV	[918-918]	918	13
+COV	[919-919]	919	23
+COV	[920-920]	920	7
+COV	[921-921]	921	17
+COV	[922-922]	922	16
+COV	[923-923]	923	13
+COV	[924-924]	924	15
+COV	[925-925]	925	7
+COV	[926-926]	926	12
+COV	[927-927]	927	3
+COV	[928-928]	928	16
+COV	[929-929]	929	10
+COV	[930-930]	930	12
+COV	[931-931]	931	11
+COV	[932-932]	932	15
+COV	[933-933]	933	12
+COV	[934-934]	934	18
+COV	[935-935]	935	15
+COV	[936-936]	936	16
+COV	[937-937]	937	10
+COV	[938-938]	938	11
+COV	[939-939]	939	16
+COV	[940-940]	940	20
+COV	[941-941]	941	18
+COV	[942-942]	942	20
+COV	[943-943]	943	17
+COV	[944-944]	944	14
+COV	[945-945]	945	10
+COV	[946-946]	946	15
+COV	[947-947]	947	12
+COV	[948-948]	948	7
+COV	[949-949]	949	9
+COV	[950-950]	950	16
+COV	[951-951]	951	9
+COV	[952-952]	952	25
+COV	[953-953]	953	16
+COV	[954-954]	954	12
+COV	[955-955]	955	12
+COV	[956-956]	956	24
+COV	[957-957]	957	19
+COV	[958-958]	958	11
+COV	[959-959]	959	14
+COV	[960-960]	960	18
+COV	[961-961]	961	17
+COV	[962-962]	962	14
+COV	[963-963]	963	18
+COV	[964-964]	964	15
+COV	[965-965]	965	14
+COV	[966-966]	966	9
+COV	[967-967]	967	7
+COV	[968-968]	968	12
+COV	[969-969]	969	20
+COV	[970-970]	970	20
+COV	[971-971]	971	13
+COV	[972-972]	972	14
+COV	[973-973]	973	11
+COV	[974-974]	974	12
+COV	[975-975]	975	16
+COV	[976-976]	976	13
+COV	[977-977]	977	16
+COV	[978-978]	978	11
+COV	[979-979]	979	11
+COV	[980-980]	980	22
+COV	[981-981]	981	13
+COV	[982-982]	982	16
+COV	[983-983]	983	19
+COV	[984-984]	984	17
+COV	[985-985]	985	16
+COV	[986-986]	986	13
+COV	[987-987]	987	14
+COV	[988-988]	988	24
+COV	[989-989]	989	10
+COV	[990-990]	990	16
+COV	[991-991]	991	12
+COV	[992-992]	992	16
+COV	[993-993]	993	18
+COV	[994-994]	994	16
+COV	[995-995]	995	15
+COV	[996-996]	996	14
+COV	[997-997]	997	20
+COV	[998-998]	998	17
+COV	[999-999]	999	13
+COV	[1000-1000]	1000	19
+COV	[1000<]	1000	19954
+# GC-depth. Use `grep ^GCD | cut -f 2-` to extract this part. The columns are: GC%, unique sequence percentiles, 10th, 25th, 50th, 75th and 90th depth percentile
+GCD	0.0	0.004	0.000	0.000	0.002	0.002	0.002
+GCD	2.0	0.008	0.002	0.002	0.002	0.007	0.012
+GCD	3.0	0.010	0.005	0.005	0.005	0.007	0.007
+GCD	4.0	0.014	0.002	0.002	0.002	0.002	0.005
+GCD	5.0	0.015	0.005	0.005	0.005	0.005	0.005
+GCD	5.3	0.015	0.020	0.020	0.020	0.020	0.020
+GCD	6.0	0.016	0.002	0.002	0.002	0.002	0.002
+GCD	7.0	0.018	0.005	0.005	0.005	0.005	0.005
+GCD	10.0	0.020	0.002	0.002	0.002	0.010	0.010
+GCD	11.0	0.021	0.005	0.005	0.005	0.005	0.005
+GCD	12.0	0.024	0.002	0.002	0.002	0.002	0.002
+GCD	13.0	0.026	0.005	0.005	0.005	0.005	0.005
+GCD	14.0	0.032	0.002	0.002	0.002	0.005	0.005
+GCD	15.0	0.035	0.005	0.005	0.005	0.005	0.017
+GCD	16.0	0.039	0.002	0.002	0.002	0.002	0.005
+GCD	17.0	0.042	0.007	0.007	0.007	0.010	0.010
+GCD	18.0	0.045	0.002	0.002	0.002	0.007	0.007
+GCD	19.0	0.049	0.005	0.005	0.007	0.015	0.020
+GCD	20.0	0.057	0.002	0.002	0.002	0.005	0.007
+GCD	21.0	0.061	0.002	0.002	0.005	0.005	0.007
+GCD	22.0	0.067	0.002	0.002	0.002	0.005	0.007
+GCD	23.0	0.074	0.002	0.005	0.007	0.010	0.022
+GCD	24.0	0.092	0.002	0.002	0.002	0.005	0.010
+GCD	25.0	0.104	0.002	0.005	0.005	0.005	0.005
+GCD	26.0	0.120	0.002	0.002	0.002	0.005	0.010
+GCD	27.0	0.132	0.002	0.005	0.007	0.015	0.919
+GCD	28.0	0.146	0.002	0.002	0.005	0.012	0.044
+GCD	29.0	0.158	0.005	0.005	0.007	0.010	0.020
+GCD	30.0	0.180	0.002	0.002	0.012	0.027	0.301
+GCD	31.0	0.231	0.007	0.020	0.252	0.309	0.321
+GCD	32.0	0.420	0.007	0.235	0.287	0.316	0.336
+GCD	33.0	1.041	0.235	0.272	0.299	0.321	0.345
+GCD	34.0	2.836	0.245	0.277	0.301	0.326	0.345
+GCD	35.0	6.596	0.250	0.279	0.306	0.331	0.353
+GCD	36.0	12.687	0.252	0.282	0.309	0.333	0.355
+GCD	37.0	21.038	0.252	0.284	0.309	0.336	0.360
+GCD	38.0	30.804	0.257	0.287	0.314	0.338	0.363
+GCD	39.0	40.686	0.255	0.287	0.314	0.341	0.368
+GCD	40.0	50.215	0.255	0.289	0.316	0.341	0.368
+GCD	41.0	58.702	0.252	0.287	0.316	0.343	0.370
+GCD	42.0	66.415	0.252	0.284	0.314	0.341	0.370
+GCD	43.0	73.332	0.255	0.287	0.314	0.341	0.370
+GCD	44.0	79.256	0.252	0.284	0.314	0.341	0.370
+GCD	45.0	84.178	0.255	0.284	0.314	0.341	0.372
+GCD	46.0	88.180	0.250	0.282	0.311	0.341	0.375
+GCD	47.0	91.323	0.247	0.282	0.311	0.341	0.375
+GCD	48.0	93.860	0.245	0.277	0.309	0.341	0.375
+GCD	49.0	95.781	0.250	0.279	0.309	0.341	0.375
+GCD	50.0	97.275	0.240	0.277	0.309	0.336	0.375
+GCD	51.0	98.341	0.247	0.277	0.306	0.341	0.380
+GCD	52.0	99.080	0.240	0.274	0.306	0.341	0.382
+GCD	53.0	99.534	0.240	0.274	0.306	0.345	0.399
+GCD	54.0	99.780	0.221	0.265	0.299	0.336	0.390
+GCD	55.0	99.894	0.233	0.267	0.296	0.326	0.350
+GCD	56.0	99.952	0.211	0.255	0.299	0.331	0.392
+GCD	57.0	99.976	0.223	0.265	0.309	0.345	0.639
+GCD	58.0	99.985	0.002	0.265	0.490	0.615	0.649
+GCD	59.0	99.988	0.260	0.260	0.289	0.835	0.835
+GCD	60.0	99.992	0.002	0.002	0.123	0.289	0.404
+GCD	62.0	99.995	0.002	0.002	0.002	0.002	0.713
+GCD	63.0	99.996	0.652	0.652	0.652	0.711	0.711
+GCD	64.0	99.998	0.622	0.622	0.622	11.324	11.324
+GCD	65.0	99.999	0.002	0.002	0.002	0.002	0.002
+GCD	66.0	100.000	0.002	0.002	0.002	0.002	0.002
diff --git a/src/multiqc/test_data/script.sh b/src/multiqc/test_data/script.sh
new file mode 100644
index 00000000..614b032e
--- /dev/null
+++ b/src/multiqc/test_data/script.sh
@@ -0,0 +1,9 @@
+# multiqc test data
+
+# Test data from https://github.com/snakemake/snakemake-wrappers/tree/master/bio/busco/test
+
+if [ ! -d /tmp/snakemake-wrappers ]; then
+  git clone --depth 1 --single-branch --branch master https://github.com/snakemake/snakemake-wrappers /tmp/snakemake-wrappers
+fi
+
+cp -r /tmp/snakemake-wrappers/bio/multiqc/test/samtools_stats/* src/multiqc/test_data
diff --git a/src/samtools/samtools_faidx/config.vsh.yaml b/src/samtools/samtools_faidx/config.vsh.yaml
new file mode 100644
index 00000000..c1c9325d
--- /dev/null
+++ b/src/samtools/samtools_faidx/config.vsh.yaml
@@ -0,0 +1,95 @@
+name: samtools_faidx
+namespace: samtools
+description: Indexes FASTA files to enable random access to fasta and fastq files.
+keywords: [ idex, fasta, faidx ]
+links:
+  homepage: https://www.htslib.org/
+  documentation: https://www.htslib.org/doc/samtools-faidx.html
+  repository: https://github.com/samtools/samtools
+references: 
+  doi: [10.1093/bioinformatics/btp352, 10.1093/gigascience/giab008]
+license: MIT/Expat
+
+argument_groups:
+  - name: Inputs
+    arguments:
+    - name: --input
+      type: file
+      description: |
+        FASTA input file.
+    - name: --length 
+      alternatives: -n
+      type: integer
+      description: |
+        Length for FASTA sequence line wrapping. If zero, this means do not
+        line wrap. Defaults to the line length in the input file.
+      default: 60
+    - name: --region_file
+      alternatives: -r
+      type: file
+      description: |
+        File of regions. Format is chr:from-to. One per line.
+        Must be used with --output to avoid sending output to stdout.
+  - name: Options
+    arguments:
+    - name: --continue
+      type: boolean_true
+      description: |
+        Continue working if a non-existent region is requested.
+    - name: --reverse_complement
+      alternatives: -i
+      type: boolean_true
+      description: |
+        Reverse complement sequences.
+  - name: Outputs 
+    arguments:
+    - name: --output
+      alternatives: -o
+      type: file 
+      description: |
+        Write output to file.
+      direction: output
+      required: true
+      example: output.fasta
+    - name: --mark_strand
+      type: string
+      description: |
+        Add strand indicator to sequence name. Options are:
+        [ rc, no, sign, custom,<pos>,<neg> ]
+      default: rc
+    - name: --fai_idx
+      type: file
+      description: |
+        Read/Write to specified index file (default file.fa.fai).
+      direction: output
+      example: file.fa.fai
+    - name: --gzi_idx
+      type: file
+      description: |
+        Read/Write to specified compressed file index (used with .gz files, default file.fa.gz.gzi).
+      direction: output
+      example: file.fa.gz.gzi
+    - name: --fastq
+      type: boolean_true
+      description: |
+        Read FASTQ files and output extracted sequences in FASTQ format. Same as using samtools fqidx.
+   
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - type: file
+    path: test_data
+engines:
+  - type: docker
+    image: quay.io/biocontainers/samtools:1.19.2--h50ea8bc_1
+    setup:
+      - type: docker
+        run: |
+          samtools --version 2>&1 | grep -E '^(samtools|Using htslib)' | \
+          sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
+runners:
+- type: executable
+- type: nextflow
diff --git a/src/samtools/samtools_faidx/help.txt b/src/samtools/samtools_faidx/help.txt
new file mode 100644
index 00000000..89320c6f
--- /dev/null
+++ b/src/samtools/samtools_faidx/help.txt
@@ -0,0 +1,19 @@
+```sh
+samtools faidx -h
+```
+Usage: samtools faidx <file.fa|file.fa.gz> [<reg> [...]]
+Option: 
+ -o, --output FILE        Write FASTA to file.
+ -n, --length INT         Length of FASTA sequence line. [60]
+ -c, --continue           Continue after trying to retrieve missing region.
+ -r, --region-file FILE   File of regions.  Format is chr:from-to. One per line.
+ -i, --reverse-complement Reverse complement sequences.
+     --mark-strand TYPE   Add strand indicator to sequence name
+                          TYPE = rc   for /rc on negative strand (default)
+                                 no   for no strand indicator
+                                 sign for (+) / (-)
+                                 custom,<pos>,<neg> for custom indicator
+     --fai-idx      FILE  name of the index file (default file.fa.fai).
+     --gzi-idx      FILE  name of compressed file index (default file.fa.gz.gzi).
+ -f, --fastq              File and index in FASTQ format.
+ -h, --help               This message.
\ No newline at end of file
diff --git a/src/samtools/samtools_faidx/script.sh b/src/samtools/samtools_faidx/script.sh
new file mode 100644
index 00000000..61502d5f
--- /dev/null
+++ b/src/samtools/samtools_faidx/script.sh
@@ -0,0 +1,24 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+set -e
+
+[[ "$par_continue" == "false" ]] && unset par_continue
+[[ "$par_reverse_complement" == "false" ]] && unset par_reverse_complement
+[[ "$par_fastq" == "false" ]] && unset par_fastq
+
+samtools faidx \
+    "$par_input" \
+    ${par_output:+-o "$par_output"} \
+    ${par_length:+-n "$par_length"} \
+    ${par_continue:+-c} \
+    ${par_region_file:+-r "$par_region_file"} \
+    ${par_reverse_complement:+-r} \
+    ${par_mark_strand:+--mark-strand "$par_mark_strand"} \
+    ${par_fai_idx:+--fai-idx "$par_fai_idx"} \
+    ${par_gzi_idx:+--gzi-idx "$par_gzi_idx"} \
+    ${par_fastq:+-f}
+
+exit 0
\ No newline at end of file
diff --git a/src/samtools/samtools_faidx/test.sh b/src/samtools/samtools_faidx/test.sh
new file mode 100644
index 00000000..10627c16
--- /dev/null
+++ b/src/samtools/samtools_faidx/test.sh
@@ -0,0 +1,104 @@
+#!/bin/bash
+
+test_dir="${meta_resources_dir}/test_data"
+echo ">>> Testing $meta_functionality_name"
+
+"$meta_executable" \
+  --input "$test_dir/test.fasta" \
+  --output "$test_dir/test.fasta.fai"
+
+echo "$meta_executable"
+echo "$test_dir/test.fasta"
+
+echo ">>> Checking whether output exists"
+[ ! -f "$test_dir/test.fasta.fai" ] && echo "File 'test.fasta.fai' does not exist!" && exit 1
+
+echo ">>> Checking whether output is non-empty"
+[ ! -s "$test_dir/test.fasta.fai" ] && echo "File 'test.fasta.fai' is empty!" && exit 1
+
+echo ">>> Checking whether output is correct"
+diff "$test_dir/test.fasta.fai" "$test_dir/output/test.fasta.fai" || \
+    (echo "Output file test.fasta.fai does not match expected output" && exit 1)
+
+rm "$test_dir/test.fasta.fai"
+
+####################################################################################################
+
+echo ">>> Test 2: ${meta_functionality_name} with bgzipped input"
+
+"$meta_executable" \
+  --input "$test_dir/test.fasta.gz" \
+  --output "$test_dir/test.fasta.gz.fai"
+
+echo ">>> Checking whether output exists"1
+[ ! -f "$test_dir/test.fasta.gz.fai" ] && echo "File 'test.fasta.gz.fai' does not exist!" && exit 1
+[ ! -f "$test_dir/test.fasta.gz.gzi" ] && echo "File 'test.fasta.gz.gzi' does not exist!" && exit 1
+
+echo ">>> Checking whether output is non-empty"
+[ ! -s "$test_dir/test.fasta.gz.fai" ] && echo "File 'test.fasta.gz.fai' is empty!" && exit 1
+[ ! -s "$test_dir/test.fasta.gz.gzi" ] && echo "File 'test.fasta.gz.gzi' is empty!" && exit 1
+
+echo ">>> Checking whether output is correct"
+diff "$test_dir/test.fasta.gz.fai" "$test_dir/output/test.fasta.gz.fai" || \
+    (echo "Output file test_zip.fasta.gz.fai does not match expected output" && exit 1)
+diff "$test_dir/test.fasta.gz.gzi" "$test_dir/output/test.fasta.gz.gzi" || \
+    (echo "Output file test2.fasta.gz.gzi does not match expected output" && exit 1)
+
+rm "$test_dir/test.fasta.gz.fai"
+rm "$test_dir/test.fasta.gz.gzi"
+
+####################################################################################################
+
+echo ">>> Test 3: ${meta_functionality_name} with fastq input"
+
+"$meta_executable" \
+  --input "$test_dir/test.fastq" \
+  --output "$test_dir/test.fastq.fai"
+
+echo ">>> Checking whether output exists"
+[ ! -f "$test_dir/test.fastq.fai" ] && echo "File 'test.fastq.fai' does not exist!" && exit 1
+
+echo ">>> Checking whether output is non-empty"
+[ ! -s "$test_dir/test.fastq.fai" ] && echo "File 'test.fastq.fai' is empty!" && exit 1
+
+echo ">>> Checking whether output is correct"
+diff "$test_dir/test.fastq.fai" "$test_dir/output/test.fastq.fai" || \
+    (echo "Output file test.fastq.fai does not match expected output" && exit 1)
+
+rm "$test_dir/test.fastq.fai"
+
+####################################################################################################
+
+echo ">>> Test 4: ${meta_functionality_name} with region file containing non-existent regions and 
+      specific fasta line wrap length"
+
+"$meta_executable" \
+  --input "$test_dir/test.fasta" \
+  --output "$test_dir/regions.fasta" \
+  --length 10 \
+  --continue \
+  --region_file "$test_dir/test.regions" \
+  --fai_idx "$test_dir/regions.fasta.fai"
+
+echo ">>> Checking whether output exists"
+[ ! -f "$test_dir/regions.fasta" ] && echo "File 'regions.fasta' does not exist!" && exit 1
+[ ! -f "$test_dir/regions.fasta.fai" ] && echo "File 'regions.fasta.fai' does not exist!" && exit 1
+
+echo ">>> Checking whether output is non-empty"
+[ ! -s "$test_dir/regions.fasta" ] && echo "File 'regions.fasta' is empty!" && exit 1
+[ ! -s "$test_dir/regions.fasta.fai" ] && echo "File 'regions.fasta.fai' is empty!" && exit 1
+
+echo ">>> Checking whether output is correct"
+diff "$test_dir/regions.fasta" "$test_dir/output/regions.fasta" || \
+    (echo "Output file regions.fasta does not match expected output" && exit 1)
+diff "$test_dir/regions.fasta.fai" "$test_dir/output/regions.fasta.fai" || \
+    (echo "Output file regions.fasta.fai does not match expected output" && exit 1)
+
+rm "$test_dir/regions.fasta"
+rm "$test_dir/regions.fasta.fai"
+
+####################################################################################################
+
+echo "All tests succeeded!"
+exit 0
+
diff --git a/src/samtools/samtools_faidx/test_data/output/regions.fasta b/src/samtools/samtools_faidx/test_data/output/regions.fasta
new file mode 100644
index 00000000..6953e46d
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/output/regions.fasta
@@ -0,0 +1,14 @@
+>YAL069W:300-315
+CCCAAATATT
+GTATAA
+>YAL068C:200-230
+CTGAAGCCGT
+TTTCAACTAC
+GGTGACTTCA
+C
+>YAL067W-A:115-145
+GCTTATTGTC
+TAAGCCTGAA
+TTCAGTCTGC
+T
+>chr1:1-100
diff --git a/src/samtools/samtools_faidx/test_data/output/regions.fasta.fai b/src/samtools/samtools_faidx/test_data/output/regions.fasta.fai
new file mode 100644
index 00000000..475dde4d
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/output/regions.fasta.fai
@@ -0,0 +1,4 @@
+YAL069W	315	19	70	71
+YAL068W-A	255	360	70	71
+YAL068C	363	638	70	71
+YAL067W-A	228	1028	70	71
diff --git a/src/samtools/samtools_faidx/test_data/output/test.fasta.fai b/src/samtools/samtools_faidx/test_data/output/test.fasta.fai
new file mode 100644
index 00000000..475dde4d
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/output/test.fasta.fai
@@ -0,0 +1,4 @@
+YAL069W	315	19	70	71
+YAL068W-A	255	360	70	71
+YAL068C	363	638	70	71
+YAL067W-A	228	1028	70	71
diff --git a/src/samtools/samtools_faidx/test_data/output/test.fasta.gz.fai b/src/samtools/samtools_faidx/test_data/output/test.fasta.gz.fai
new file mode 100644
index 00000000..475dde4d
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/output/test.fasta.gz.fai
@@ -0,0 +1,4 @@
+YAL069W	315	19	70	71
+YAL068W-A	255	360	70	71
+YAL068C	363	638	70	71
+YAL067W-A	228	1028	70	71
diff --git a/src/samtools/samtools_faidx/test_data/output/test.fasta.gz.gzi b/src/samtools/samtools_faidx/test_data/output/test.fasta.gz.gzi
new file mode 100644
index 00000000..1b1cb4d4
Binary files /dev/null and b/src/samtools/samtools_faidx/test_data/output/test.fasta.gz.gzi differ
diff --git a/src/samtools/samtools_faidx/test_data/output/test.fastq.fai b/src/samtools/samtools_faidx/test_data/output/test.fastq.fai
new file mode 100644
index 00000000..d489386a
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/output/test.fastq.fai
@@ -0,0 +1,2 @@
+fastq1	66	8	30	31	79
+fastq2	28	156	14	15	188
diff --git a/src/samtools/samtools_faidx/test_data/script.sh b/src/samtools/samtools_faidx/test_data/script.sh
new file mode 100644
index 00000000..ffd5b789
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/script.sh
@@ -0,0 +1,10 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+wget https://raw.githubusercontent.com/nf-core/test-datasets/rnaseq3/reference/transcriptome.fasta
+
+head -n 23 transcriptome.fasta > test.fasta # kepp only 4 first entries of the file for testing.
+
+rm transcriptome.fasta
\ No newline at end of file
diff --git a/src/samtools/samtools_faidx/test_data/test.fasta b/src/samtools/samtools_faidx/test_data/test.fasta
new file mode 100644
index 00000000..eee04dde
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/test.fasta
@@ -0,0 +1,23 @@
+>YAL069W CDS=1-315
+ATGATCGTAAATAACACACACGTGCTTACCCTACCACTTTATACCACCACCACATGCCATACTCACCCTC
+ACTTGTATACTGATTTTACGTACGCACACGGATGCTACAGTATATACCATCTCAAACTTACCCTACTCTC
+AGATTCCACTTCACTCCATGGCCCATCTCTCACTGAATCAGTACCAAATGCACTCACATCATTATGCACG
+GCACTTGCCTCAGCGGTCTATACCCTGTGCCATTTACCCATAACGCCCATCATTATCCACATTTTGATAT
+CTATATCTCATTCGGCGGTCCCAAATATTGTATAA
+>YAL068W-A CDS=1-255
+ATGCACGGCACTTGCCTCAGCGGTCTATACCCTGTGCCATTTACCCATAACGCCCATCATTATCCACATT
+TTGATATCTATATCTCATTCGGCGGTCCCAAATATTGTATAACTGCCCTTAATACATACGTTATACCACT
+TTTGCACCATATACTTACCACTCCATTTATATACACTTATGTCAATATTACAGAAAAATCCCCACAAAAA
+TCACCTAAACATAAAAATATTCTACTTTTCAACAATAATACATAA
+>YAL068C CDS=1-363
+ATGGTCAAATTAACTTCAATCGCCGCTGGTGTCGCTGCCATCGCTGCTACTGCTTCTGCAACCACCACTC
+TAGCTCAATCTGACGAAAGAGTCAACTTGGTGGAATTGGGTGTCTACGTCTCTGATATCAGAGCTCACTT
+AGCCCAATACTACATGTTCCAAGCCGCCCACCCAACTGAAACCTACCCAGTCGAAGTTGCTGAAGCCGTT
+TTCAACTACGGTGACTTCACCACCATGTTGACCGGTATTGCTCCAGACCAAGTGACCAGAATGATCACCG
+GTGTTCCATGGTACTCCAGCAGATTAAAGCCAGCCATCTCCAGTGCTCTATCCAAGGACGGTATCTACAC
+TATCGCAAACTAG
+>YAL067W-A CDS=1-228
+ATGCCAATTATAGGGGTGCCGAGGTGCCTTATAAAACCCTTTTCTGTGCCTGTGACATTTCCTTTTTCGG
+TCAAAAAGAATATCCGAATTTTAGATTTGGACCCTCGTACAGAAGCTTATTGTCTAAGCCTGAATTCAGT
+CTGCTTTAAACGGCTTCCGCGGAGGAAATATTTCCATCTCTTGAATTCGTACAACATTAAACGTGTGTTG
+GGAGTCGTATACTGTTAG
diff --git a/src/samtools/samtools_faidx/test_data/test.fasta.gz b/src/samtools/samtools_faidx/test_data/test.fasta.gz
new file mode 100644
index 00000000..d21edc57
Binary files /dev/null and b/src/samtools/samtools_faidx/test_data/test.fasta.gz differ
diff --git a/src/samtools/samtools_faidx/test_data/test.fastq b/src/samtools/samtools_faidx/test_data/test.fastq
new file mode 100644
index 00000000..b8f8c917
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/test.fastq
@@ -0,0 +1,14 @@
+@fastq1
+ATGCATGCATGCATGCATGCATGCATGCAT
+GCATGCATGCATGCATGCATGCATGCATGC
+ATGCAT
++
+FFFA@@FFFFFFFFFFHHB:::@BFFFFGG
+HIHIIIIIIIIIIIIIIIIIIIIIIIFFFF
+8011<<
+@fastq2
+ATGCATGCATGCAT
+GCATGCATGCATGC
++
+IIA94445EEII==
+=>IIIIIIIIICCC
\ No newline at end of file
diff --git a/src/samtools/samtools_faidx/test_data/test.regions b/src/samtools/samtools_faidx/test_data/test.regions
new file mode 100644
index 00000000..2034aaf0
--- /dev/null
+++ b/src/samtools/samtools_faidx/test_data/test.regions
@@ -0,0 +1,4 @@
+YAL069W:300-315
+YAL068C:200-230
+YAL067W-A:115-145
+chr1:1-100