write.dna cuts off dna sequences when put in a list

[TheLaughingDuck]

Essentially, when the data going into write.dna is of the DNAbin class, the output dnabin.fasta file is nicely formatted.

Reproducible example:

# This produces a fasta file with nicely formatted sequences
dnabin_sequences <- ape::read.GenBank(c("JF806202", "HM161150", "FJ356743"))
ape::write.dna(dnabin_sequences,
               file ="dnabin.fasta",
               format = "fasta")

When the data going into write.dna is a list of sequences, the file test_fasta contains sequences that are not broken apart with spaces, and they cut off after 10 bases. I played around with the arguments, and the closest I got was setting the colw argument to some absurdly large value so that the entire sequences were included.

# This produces a fasta file without separation, and it cuts off the sequences
list_sequences <- list("ggaggccatagagcagatgctgaggtgatagatggaacatga",
                       "ggaggccatagagcagatgctgaggtgatagatggaacatga",
                       "ggaggccatagagcagatgctgaggtgatagatggaacatga")

ape::write.dna(list_sequences,
               file ="test.fasta",
               format = "fasta")

[emmanuelparadis]

Hi,

Your object list_sequences is not of the correct class. You can convert it with;

list_sequences <- as.DNAbin(sapply(list_sequences, strsplit, split = ""))

then it'll be usable by ape. See this doc for explanations about how "DNAbin" objects are coded.

Emmanuel

[TheLaughingDuck]

Aaah I see, thank you!