Skip to content

Latest commit

 

History

History
102 lines (77 loc) · 5.33 KB

GnotoSOP.md

File metadata and controls

102 lines (77 loc) · 5.33 KB
Raw

GNO 004 Isolator Microbial Testing

1. Scope

This SOP applies to any personnel involved in the testing of the isolators.

2. Purpose

The purpose of this procedure is to maintain consistency in the testing of isolators to avoid contaminating the results and to maintain sterility. Sterility is tested both through aerobic and anaerobic culture, as well as quantitative PCR as a culture independent method.

3. References

Fill me In

4. Definitions

Term Definition
SOP Standard Operating Procedure
MSDS Material Safety Data Sheet
ARP Animal Resource Program
MST Microbial Swab Test
TSB Tryptic Soy Agar with 5% Sheeps Blood
BHI CHVR Brain Heart Infusion with Cysteine, Hemin, Vitamin K, and Rezasurin
Ct Threshold Cycle of Detection

5. Procedure

Materials and Equipment Needed

Item Storage Ordering Information
Microbial Swab Test RT
TSB agar 4˚C See recipe
BHI CHVR agar and broth 4˚C See recipe
Oligos -20˚C See Table 5.1
ZymoBIOMICS 96 MagBead DNA Kit RT Zymo D4302 OR D4308
Bio-Rad 96 Well Plate 200 µL skirted PCR plate RT Biorad HSP9601
384 Plates for qPCR RT Biorad #HSP3865)
Optically clear Plate Seals (Microseal ‘B’) - Biorad #MSB1001
iTaq Universal Probes Supermix -20˚C BioRad 1725132
2 x Opentrons filter 200ul tips RT link
2 x Opentrons filter 20ul tips RT link
CFX384 Thermocycler - -
Biospec Mini-Beadbeater-96 or similar - -
Opentrons OT-2 with gen 2 Magnetic module, 20ul single channel, 300ul multichannel, and tube rack. - -
Anaerobic Chamber with >0% CO2 or Anaerobic Jar - -
37˚C Degree Incubator - -
PCR Laminar Flow Hood - -

Table 5.1: Oligos

Oligo Sequence Stock [µM] Working [µM] Final [nM]
891F TGGAGCATGTGGTTTAATTCGA 100 2 200
1003R TGCGGGACTTAACCCAACA 100 2 200
1002P [6FAM]CACGAGCTGACGACARCCATGCA[BHQ1] 100 2 200

Sampling Frequency

All isolators housing mice will be tested on a monthly basis, either during the course of a routine port access or for surveillance. Mark date of testing on isolator activity sheet. Newly constructed isolators will be tested 1 week after assembly and 1 week after mice are transfered in. Allow up to 5 days after testing for cultures to be negative before moving mice into a new isolator. Note: when samples are submitted, please include a swab taken from mice known to be colonized or those from a conventional mouse room. Do not specify which swab this was when samples are dropped off.

5A Sampling Isolators

  • Sterilize external surface of MST using ExSpore Prepared as per Exspore SOP (1:4:1 base:water:actuvator made >15min <24h ahead of time) and transfer into isolator to be tested allowing for at least 45 minutes contact time as per Entering Supplies SOP.
  • Dry any remaining sterilant from MST and open packaging.
  • Swab any surfaces which mice may forseeably contact including inside of cages, wire racks, and fecal collection containers.
  • Swab mold trap (small cup containing water and food which may be left in isolator to test for mold contamination).
  • Return swab to transport media
  • Add ~ 0.5 mL drinking water from a water bottle to the transport media
  • If isolator contains animals: use forceps to collect 3 fecal pellets and place in transport media. Ideally fecal pellets will be collected from multiple cages.
  • Close MST and remove from isolator. Store at 4˚C until testing.

5B Culture Testing

  • On lab bench working by flame (or in BSC) vortex MST to homogenize fecal samples into transport media. Clean work space with 70% ethanol before use.
  • Remove swab and use quadrant streak method to innoculate a TSB plate and BHI CHVR plate.
  • Transfer the swab to a 15 mL conical tube containing 5 mL of BHI CHVR liquid media
  • Transfer TSB plate to 37˚C aerobic incubator
  • Transfer BHI CHVR plate and broth culture into 37˚C anaerobic incubator
  • Proceed to qPCR testing

5C qPCR Testing

Table 5.2: qPCR Cycling Parameters

Cycle Temperature (˚C) Time
Initial Denaturation 95 5min
40 cycles:
Denature 95˚C 5 sec
Anneal/Extend 60˚C 15 sec
Hold 4˚C Hold 0 sec

Expected Results:

Culture: It is expected that no colonies will form. Most detection should be spotted within ~2 days; however, give up to 5 days for contamination to become visible. If plates drying out becomes an issue, place them in a plastic bag with a wet papertowel for extended incubation. The broth culture should not become turbid.

qPCR: Quantitative comparison of germ-free mice against negative extraction controls should be conducted. It is expected that germ-free mice should have a Ct no more than 1 cycle greater than negative controls. The Positive control should amplify between cycles 10-15. **Note: all DNA extraction/PCR reagents contain trace microbial DNA, and as such, amplification is always expected in the cycle range ~33-38.

In the event of positive test: Retest immediately and/or send culture for Sanger 16S rRNA sequencing or MALDI-TOF.