We read every piece of feedback, and take your input very seriously.
To see all available qualifiers, see our documentation.
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
Hi,
I used rnaConvert.py to get secondary structure with
rnaConvert.py -T fasta 5nwq_A.pdb --pdb-annotation-tool MC-Annotate
The predicted SS is without pseudoknot base pairing, is it expected behavior for pseudoknot structures?
>5nwq_A CCGGACGAGGUGCGCCGUACCCGGUCAGGACAAGACGGCGC ...........(((((((................)))))))
Best, Mandar Kulkarni
The text was updated successfully, but these errors were encountered:
No branches or pull requests
Hi,
I used rnaConvert.py to get secondary structure with
The predicted SS is without pseudoknot base pairing, is it expected behavior for pseudoknot structures?
Best,
Mandar Kulkarni
The text was updated successfully, but these errors were encountered: