+
+
+---
diff --git a/_materials/2_nanopore_sequencing.html b/_materials/2_nanopore_sequencing.html
new file mode 100755
index 0000000..c8cd5ee
--- /dev/null
+++ b/_materials/2_nanopore_sequencing.html
@@ -0,0 +1,33 @@
+---
+layout: slides
+title: "What is Nanopore Sequencing?"
+---
+
+
+
+---
+
+### How to Read DNA
+
+
+
+
+---
+
+### How to Read DNA
+
+
+
+Animation: Nanopore sequencing from Oxford Nanopore on Vimeo.
+ +--- + +### Ingredients + + +- **Fragmentation Mix (FRA):** to cut DNA into shorter pieces. +- **Rapid Sequencing Adapter (RAP):** to allow the DNA to dock to the nanopore. +- **Flush Tether (FLT):** to guide the motorprotein to the pores. +- **Seqeuncing Buffer (SQB):** to create our ionic current. +- **Flush Buffer (FB):** to wash. +- **Loading Beads (LB):** to suck the DNA from the loading port into the flowcell. diff --git a/_materials/3_bioinformatics.html b/_materials/3_bioinformatics.html new file mode 100755 index 0000000..ef1a755 --- /dev/null +++ b/_materials/3_bioinformatics.html @@ -0,0 +1,107 @@ +--- +layout: slides +title: "What is Bioinformatics?" +--- + +### Discuss: Where can you find Bioinformatics? + + + +--- + +### Where can you find Bioinformatics? + +Chemistry, Biology, Physics: Creating Software for Devices + +
+
+
+---
+
+### Where can you find Bioinformatics?
+
+Chemistry, Biology, Physics: Analysis of Sequence Data
+
+
+
+---
+
+### Where can you find Bioinformatics?
+
+Chemistry, Biology, Physics: Analysis of Image Data
+
+
+
+---
+
+### Where can you find Bioinformatics?
+
+Mathematics, Statistics: Computer Science, Algorithms
+
+
+
+---
+
+
+### Bioinformatics is the Bridge
+
+
+
+
+---
+
+### Discuss: What kind of data will we encounter?
+
+---
+
+### Types of Data We Will Have
+
+- **Raw Signal** (e.g., current/time-data of MinION)
+- **Sequence Data** (e.g., FASTQ data)
+- **Interpreted Data** (i.e., results of Kraken)
+
+---
+
+### Raw Signal Data
+
+
+
+
+---
+
+
+### Sequence Data: FASTQ Format
+
+```
+@SEQ_ID
+GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
++
+!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
+```
+
+- **Line 1:** Read ID
+- **Line 2:** Sequence
+- **Line 3:** Additional Information
+- **Line 4:** Quality String
+
+---
+
+### Interpreted Data: Kraken
+
+
+
+---
+
+### Interpreted Data: Kraken
+
+
+
+---
+
+### Interpreted Data: Kraken
+
+|Taxon | Read number |
+|-------|-------------|
+| d__Eukaryota | 2053 |
+| d__Eukaryota,k__Fungi | 2053 |
+|d__Eukaryota,k__Fungi,p__Ascomycota | 2049 |
diff --git a/_materials/4_nanopore_sequencing_extended.html b/_materials/4_nanopore_sequencing_extended.html
new file mode 100755
index 0000000..b5bc71f
--- /dev/null
+++ b/_materials/4_nanopore_sequencing_extended.html
@@ -0,0 +1,54 @@
+---
+layout: slides
+title: "Further Information about Nanopore Sequencing"
+---
+
+### Ingredients
+
+
+- **Fragmentation Mix (FRA):** Ligases (Exonucleases) to cut DNA into shorter pieces. Will cut at certain sequences.
+- **Rapid Sequencing Adapter (RAP):** Ligation of adapters to the DNA fragments (leader and hairpin adapter). The leader adapter will allow the DNA to dock to the nanopore. The hairpin adapter is then for the complement strand.
+- **Flush Tether (FLT):** Guides the motorprotein to the pores.
+- **Seqeuncing Buffer (SQB):** For the ionic current.
+- **Flush Buffer (FB):** For washing.
+- **Loading Beads (LB):** To increase the molecular weight of the DNA. Helps to suck the DNA from the loading port into the flowcell.
+
+---
+
+### Technical Remarks
+
+
+- Double strands are required for nanopore-sequencing, because single strands would stop at the point where you have your adapter (ds position).
+- The nanopore itself is strong enough to open up the ds. A helicase is not necessary.
+- The MinION has 4 pores for 512 channels (in total 2048 pores).
+- During the sequencing the MinION uses only one pore per channel. Every hour the lane will be checked and perhaps the MinION swaps to a different pore.
+- The quality of the reads not decreases at the end of a read like in Illumina Sequencing.
+- Average length 2-10 kb reads. Error Rate <10%, ~5-6% (which comes mostly from the basecalling).
+- Change between template and complement strand is recognized by a specific signal of a site located in the hairpin adapter.
+- [Literature](https://www.researchgate.net/publication/317848322_Nanopore_sequencing_data_analysis_state_of_the_art_applications_and_challenges)
+
+---
+
+### Base Calling
+
+
+- Decoding the raw current signal into a base.
+- Long stretches of the same base might induce a higher error (e.g., Poly-A-Tail problem).
+
+---
+
+### RNA Sequencing
+
+
+- RNA sequencing is possible but so far you need to do a RNA PCR into ds strands (see technical remarks).
+- Also possible is the standard way of a reverse trascription into cDNA and then a cDNA PCR.
+
+---
+
+### Max Scan
+
+
+- It is the name for Nanopore's Current Checking.
+- It will automatically determine which pores has the best electric field.
+- Then the MinION will pick those pores for seqeuncing.
+- This feature is important, since the quality can change over time for the base calling of the each pore.
diff --git a/images/materials/bioinformatics/1.svg b/images/materials/bioinformatics/1.svg
new file mode 100644
index 0000000..cebc1c3
--- /dev/null
+++ b/images/materials/bioinformatics/1.svg
@@ -0,0 +1,401 @@
+
+
+
+
diff --git a/images/materials/bioinformatics/2.svg b/images/materials/bioinformatics/2.svg
new file mode 100644
index 0000000..7758917
--- /dev/null
+++ b/images/materials/bioinformatics/2.svg
@@ -0,0 +1,775 @@
+
+
+
+
diff --git a/images/materials/bioinformatics/3.svg b/images/materials/bioinformatics/3.svg
new file mode 100644
index 0000000..bc095da
--- /dev/null
+++ b/images/materials/bioinformatics/3.svg
@@ -0,0 +1,899 @@
+
+
diff --git a/images/materials/bioinformatics/AI.png b/images/materials/bioinformatics/AI.png
new file mode 100644
index 0000000..c62d0c7
Binary files /dev/null and b/images/materials/bioinformatics/AI.png differ
diff --git a/images/materials/bioinformatics/Blood_Glucose_Testing.jpeg b/images/materials/bioinformatics/Blood_Glucose_Testing.jpeg
new file mode 100644
index 0000000..d7bc29d
Binary files /dev/null and b/images/materials/bioinformatics/Blood_Glucose_Testing.jpeg differ
diff --git a/images/materials/bioinformatics/cell_image.jpg b/images/materials/bioinformatics/cell_image.jpg
new file mode 100644
index 0000000..2159c77
Binary files /dev/null and b/images/materials/bioinformatics/cell_image.jpg differ
diff --git a/images/materials/nanopore/1.svg b/images/materials/nanopore/1.svg
new file mode 100644
index 0000000..d7bdf0d
--- /dev/null
+++ b/images/materials/nanopore/1.svg
@@ -0,0 +1,3403 @@
+
+
+
+