Crash when compressing sequence with 1-character name

[KirillKryukov]

Leon compression crashes when input has 1-character long sequence name. To reproduce:

Input file "1.fa":

>1
AGCGCGTCTGGCGTGTATAT
GGCTGCTGTGCATTGTGTTC

Input file "2.fa":

>12
AGCGCGTCTGGCGTGTATAT
GGCTGCTGTGCATTGTGTTC

(The only difference between these inputs is the extra character in sequence name).

Compression commands:
leon -file '1.fasta' -c -kmer-size 2
leon -file '2.fasta' -c -kmer-size 2

The first command crashes with this console output:

        Input format: Fasta
[DSK: nb solid kmers found : 3           ]  100  %   elapsed:   0 min 0  sec   remaining:   0 min 0  sec   cpu: 333.3 %   mem: [  82,   82,   82] MB
[Compressing headers                     ]  0    %   elapsed:   0 min 0  sec   remaining:   0 min 0  seczsh: segmentation fault (core dumped)  leon -file '1.fasta' -c -kmer-size 2

The second command completes without problems.

OS: Ubuntu 18.04.1 LTS

I found this problem while working on Sequence Compression Benchmark.