New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

a minor compaction bug #13

Open

rchikhi opened this issue Aug 10, 2016 · 0 comments

Assignees

Member

rchikhi commented Aug 10, 2016 •

edited

Loading

>1 a self-overlapping sequence (k=31) 
TATATATAAATATACATATAGATATATATAAATATACATATAGATATATATA
>2 a kmer that overlaps with the last kmer of sequence 1, to the left of it
TATATATATAAATATACATATAGATATATAT

it seems that bcalm incorrectly performs a compaction in this small example (sequence 1 should be splitted, but it is not)

The text was updated successfully, but these errors were encountered:

rchikhi assigned Malfoy

rchikhi changed the title ~~a compaction bug~~ a minor compaction bug

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment