diff --git a/workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4/.dockstore.yml b/workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4/.dockstore.yml new file mode 100644 index 000000000..67d448932 --- /dev/null +++ b/workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4/.dockstore.yml @@ -0,0 +1,7 @@ +version: 1.2 +workflows: +- name: main + primaryDescriptorPath: /Assembly-Hifi-HiC-phasing-VGP4.ga + subclass: Galaxy + testParameterFiles: + - /Assembly-Hifi-HiC-phasing-VGP4-tests.yml diff --git a/workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4/Assembly-Hifi-HiC-phasing-VGP4-tests.yml b/workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4/Assembly-Hifi-HiC-phasing-VGP4-tests.yml new file mode 100644 index 000000000..1e9bad77e --- /dev/null +++ b/workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4/Assembly-Hifi-HiC-phasing-VGP4-tests.yml @@ -0,0 +1,60 @@ +- doc: Test outline for Assembly-Hifi-HiC-phasing-VGP4 + job: + HiC forward reads: + class: File + location: https://www.dropbox.com/scl/fi/i9qntoxnrw8bu5wtioc02/HiC-forward-reads.fastqsanger.gz?rlkey=r4fml1n7c7jq21yoq4rvrsh25&dl=1 + filetype: fastqsanger.gz + HiC reverse reads: + class: File + location: https://www.dropbox.com/scl/fi/zq29m4094bf5lgo2cgudl/HiC-reverse-reads.fastqsanger.gz?rlkey=iry8y83zzp3ygjit2ejiyaiyl&dl=1 + filetype: fastqsanger.gz + Genomescope Model Parameters: + class: File + path: test-data/Genomescope Model Parameters.tabular + filetype: tabular + Genomescope Summary: + class: File + location: https://zenodo.org/record/8371053/files/GenomeScope_Summary.txt?download=1 + filetype: txt + Meryl Database: + class: File + location: https://zenodo.org/record/8371053/files/Meryl-db.meryldb?download=1 + filetype: meryldb + Pacbio Reads Collection: + class: Collection + collection_type: list + elements: + - class: File + identifier: yeast_reads_sub1.fastq.gz + location: https://zenodo.org/record/8371053/files/yeast_reads_sub1.fastq.gz?download=1 + Bits for bloom filter: '32' + SAK input file (Optional): null + Name for Haplotype 1: Hap1 + Name for Haplotype 2: Hap2 + outputs: + Hifiasm HiC hap1: + assert: + has_n_line: + n: 168 + Estimated Genome size: + asserts: + has_text: + text: "2288021" + Busco Summary Hap1: + asserts: + has_text: + text: "C:1.0%[S:1.0%,D:0.0%],F:0.4%,M:98.6%,n:3354" + Nx Plot: + asserts: + has_size: + value: 65000 + delta: 10000 + path: test-data/Nx Plot.png + usable hap1 gfa: + assert: + has_n_line: + n: 173 + Assembly statistics fir Hap1 and Hap2: + asserts: + has_text: + text: "Metric hap1 hap2" diff --git a/workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4/Assembly-Hifi-HiC-phasing-VGP4.ga b/workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4/Assembly-Hifi-HiC-phasing-VGP4.ga new file mode 100644 index 000000000..0ec1ae18d --- /dev/null +++ b/workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4/Assembly-Hifi-HiC-phasing-VGP4.ga @@ -0,0 +1,3311 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "", + "creator": [ + { + "class": "Organization", + "name": "Galaxy" + }, + { + "class": "Organization", + "name": "VGP", + "url": "https://vertebrategenomeproject.org" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "CC-BY-4.0", + "release": "0.1", + "name": "Assembly-Hifi-HiC-phasing-VGP4", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Pacbio Reads Collection" + } + ], + "label": "Pacbio Reads Collection", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 601.6407359730115 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "f7ef62fa-eb54-4489-b444-b6be262a45c0", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "HiC forward reads" + } + ], + "label": "HiC forward reads", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 360.5990149758079, + "top": 821.284901012074 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "d5d37559-d0fd-4d56-bb2f-a89335984a73", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "HiC reverse reads" + } + ], + "label": "HiC reverse reads", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 627.265722101385, + "top": 928.5504890210702 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "94594456-f087-4983-9b0e-014e36084354", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Genomescope Model Parameters" + } + ], + "label": "Genomescope Model Parameters", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 368.9063158902255, + "top": 1208.8194876006157 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "0735f7ce-74e8-4ae0-8142-e6d2fd89c89e", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Genomescope Summary" + } + ], + "label": "Genomescope Summary", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 377.2136225844875, + "top": 1460.503688003078 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "1844cbb3-ba5f-4997-a3cd-ce70f4570a99", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Meryl Database" + } + ], + "label": "Meryl Database", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 1730.5817343971949, + "top": 419.62677926728225 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "fcb0f86e-455a-4a6e-9c86-d8994caf0493", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "Defaults to 37 if not specified. For genomes much larger than human, applying -f38 or even -f39 is preferred to save memory on k-mer counting.", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "Defaults to 37 if not specified. For genomes much larger than human, applying -f38 or even -f39 is preferred to save memory on k-mer counting.", + "name": "Bits for bloom filter" + } + ], + "label": "Bits for bloom filter", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 906.03125, + "top": 1704.0625 + }, + "tool_id": null, + "tool_state": "{\"default\": 37, \"parameter_type\": \"integer\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "b949921b-95a3-4d43-81b2-4006a4909e4b", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "105bb189-a2d4-4cfc-8cb8-39ab70af0277" + } + ] + }, + "7": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 7, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "SAK input file (Optional)" + } + ], + "label": "SAK input file (Optional)", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 1785.3040059407554, + "top": 1450.859578450521 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "557a2e2b-008c-4566-836a-6509950aa85b", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "2a6cc6ed-3248-4048-9208-a683e43f1c0f" + } + ] + }, + "8": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 8, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name for Haplotype 1" + } + ], + "label": "Name for Haplotype 1", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 3629.8615195534453, + "top": 1523.559107924953 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Hap1\", \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "41d1bb31-75f9-4034-abad-96aed4916b45", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "2eef5014-6358-446d-9d97-4a9b43f83e75" + } + ] + }, + "9": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 9, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name for Haplotype 2" + } + ], + "label": "Name for Haplotype 2", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 3641.8580719918923, + "top": 1674.3751294685135 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Hap2\", \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "6d5afa06-c3e8-4eb7-8819-8cfe8300c462", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "5f6be88c-dc8a-40ce-8865-c36f26d826d7" + } + ] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "errors": null, + "id": 10, + "input_connections": { + "library|input_1": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Cutadapt", + "outputs": [ + { + "name": "out1", + "type": "fastqsanger" + }, + { + "name": "report", + "type": "txt" + } + ], + "position": { + "left": 476.8230091441762, + "top": 589.340302438447 + }, + "post_job_actions": { + "HideDatasetActionreport": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report" + }, + "RenameDatasetActionout1": { + "action_arguments": { + "newname": "Cutadapt on #{library.input_1 }" + }, + "action_type": "RenameDatasetAction", + "output_name": "out1" + }, + "TagDatasetActionout1": { + "action_arguments": { + "tags": "trimmed_hifi" + }, + "action_type": "TagDatasetAction", + "output_name": "out1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "tool_shed_repository": { + "changeset_revision": "135b80fb1ac2", + "name": "cutadapt", + "owner": "lparsons", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"35\", \"match_read_wildcards\": \" \", \"revcomp\": true}, \"filter_options\": {\"discard_trimmed\": true, \"discard_untrimmed\": false, \"minimum_length\": null, \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"anywhere_adapter_source\": {\"anywhere_adapter_source_list\": \"user\", \"__current_case__\": 0, \"anywhere_adapter_name\": \"\", \"anywhere_adapter\": \"ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT\"}, \"single_noindels\": false}, {\"__index__\": 1, \"anywhere_adapter_source\": {\"anywhere_adapter_source_list\": \"user\", \"__current_case__\": 0, \"anywhere_adapter_name\": \"\", \"anywhere_adapter\": \"ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT\"}, \"single_noindels\": false}], \"cut\": \"0\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"0\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "4.0+galaxy1", + "type": "tool", + "uuid": "64ce3a66-9497-4937-a1b6-7f72814f1fe1", + "when": null, + "workflow_outputs": [ + { + "label": "Cutadapt on input dataset(s): Read 1 Output", + "output_name": "out1", + "uuid": "24af0265-1dce-43a5-9fd2-51b414f0c1ea" + } + ] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "errors": null, + "id": 11, + "input_connections": { + "input": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 623.1337807395242, + "top": 1208.8194876006157 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "tool_shed_repository": { + "changeset_revision": "6595517c2dd8", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"c3*2\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0", + "type": "tool", + "uuid": "bfa738cb-d9c1-4b3c-a89b-71135d65a3b6", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", + "errors": null, + "id": 12, + "input_connections": { + "infile": { + "id": 4, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Search in textfiles", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 616.7448795203007, + "top": 1458.837058327415 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"case_sensitive\": \"-i\", \"color\": \"NOCOLOR\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"invert\": \"\", \"lines_after\": \"0\", \"lines_before\": \"0\", \"regex_type\": \"-G\", \"url_paste\": \"Haploid\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.1", + "type": "tool", + "uuid": "72b7138a-e0d4-4922-9895-c6cbacddbb90", + "when": null, + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", + "errors": null, + "id": 13, + "input_connections": { + "results_0|software_cond|input": { + "id": 10, + "output_name": "report" + } + }, + "inputs": [], + "label": null, + "name": "MultiQC", + "outputs": [ + { + "name": "stats", + "type": "input" + }, + { + "name": "html_report", + "type": "html" + } + ], + "position": { + "left": 1017.3959674257222, + "top": 787.7344304865057 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", + "tool_shed_repository": { + "changeset_revision": "abfd8a6544d7", + "name": "multiqc", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": false, \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.11+galaxy1", + "type": "tool", + "uuid": "c60d4342-a7fb-4dd1-8f5f-206fa7e423b8", + "when": null, + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 14, + "input_connections": { + "input": { + "id": 11, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 875.2518393776635, + "top": 1212.2222900390627 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c7\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "ca6bbaa5-0c32-4504-94ba-6f8644e6f655", + "when": null, + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/1.1.2", + "errors": null, + "id": 15, + "input_connections": { + "infile": { + "id": 12, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Replace Text", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 872.2483548251066, + "top": 1459.5748438979645 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \"bp\", \"replace_pattern\": \"\"}, {\"__index__\": 1, \"find_pattern\": \",\", \"replace_pattern\": \"\"}, {\"__index__\": 2, \"find_pattern\": \"([a-z])\\\\s+([A-Z])\", \"replace_pattern\": \"\\\\1_\\\\2\"}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "565beb6a-79f6-4ceb-80f3-46939db4d9c9", + "when": null, + "workflow_outputs": [] + }, + "16": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 16, + "input_connections": { + "input1": { + "id": 14, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Estimated homozygous read coverage", + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 1109.154712670362, + "top": 1218.6660569445944 + }, + "post_job_actions": { + "RenameDatasetActioninteger_param": { + "action_arguments": { + "newname": "Estimated homozygous read coverage" + }, + "action_type": "RenameDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "e1360db3-bf77-402c-a450-36d74adbddc6", + "when": null, + "workflow_outputs": [] + }, + "17": { + "annotation": "", + "content_id": "Convert characters1", + "errors": null, + "id": 17, + "input_connections": { + "input": { + "id": 15, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Convert", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1116.4237051299124, + "top": 1467.821248372396 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Convert characters1", + "tool_state": "{\"condense\": true, \"convert_from\": \"s\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"strip\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "e901d941-c0fe-4915-b9e7-1a7e69596bd2", + "when": null, + "workflow_outputs": [] + }, + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.16.1+galaxy4", + "errors": null, + "id": 18, + "input_connections": { + "assembly_options|hom_cov": { + "id": 16, + "output_name": "integer_param" + }, + "filter_bits": { + "id": 6, + "output_name": "output" + }, + "hic_partition|h1": { + "id": 1, + "output_name": "output" + }, + "hic_partition|h2": { + "id": 2, + "output_name": "output" + }, + "mode|reads": { + "id": 10, + "output_name": "out1" + } + }, + "inputs": [], + "label": null, + "name": "Hifiasm", + "outputs": [ + { + "name": "noseq files", + "type": "input" + }, + { + "name": "hic_pcontig_graph", + "type": "gfa1" + }, + { + "name": "hic_acontig_graph", + "type": "gfa1" + }, + { + "name": "hic_balanced_contig_hap1_graph", + "type": "gfa1" + }, + { + "name": "hic_balanced_contig_hap2_graph", + "type": "gfa1" + }, + { + "name": "hic_raw_initig", + "type": "gfa1" + }, + { + "name": "log_file", + "type": "txt" + } + ], + "position": { + "left": 1650.198023834119, + "top": 729.0981977671058 + }, + "post_job_actions": { + "HideDatasetActionhic_acontig_graph": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "hic_acontig_graph" + }, + "HideDatasetActionhic_pcontig_graph": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "hic_pcontig_graph" + }, + "TagDatasetActionhic_balanced_contig_hap1_graph": { + "action_arguments": { + "tags": "hifiasm_hic_hap1_gfa, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "hic_balanced_contig_hap1_graph" + }, + "TagDatasetActionhic_balanced_contig_hap2_graph": { + "action_arguments": { + "tags": "hifiasm_hic_hap2_gfa, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "hic_balanced_contig_hap2_graph" + }, + "TagDatasetActionhic_raw_initig": { + "action_arguments": { + "tags": "hifiasm_hic_unitig_gfa" + }, + "action_type": "TagDatasetAction", + "output_name": "hic_raw_initig" + }, + "TagDatasetActionlog_file": { + "action_arguments": { + "tags": "hifiasm_hic_log" + }, + "action_type": "TagDatasetAction", + "output_name": "log_file" + }, + "TagDatasetActionnoseq files": { + "action_arguments": { + "tags": "noseq_hifiasm" + }, + "action_type": "TagDatasetAction", + "output_name": "noseq files" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.16.1+galaxy4", + "tool_shed_repository": { + "changeset_revision": "5f625c63b8bc", + "name": "hifiasm", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advanced_options\": {\"advanced_selector\": \"blank\", \"__current_case__\": 0}, \"assembly_options\": {\"assembly_selector\": \"set\", \"__current_case__\": 1, \"cleaning_rounds\": \"4\", \"adapter_length\": \"0\", \"pop_contigs\": \"10000000\", \"pop_unitigs\": \"100000\", \"remove_tips\": \"3\", \"max_overlap\": \"0.8\", \"min_overlap\": \"0.2\", \"disable_post_join\": false, \"ignore_error_corrected\": false, \"hom_cov\": {\"__class__\": \"ConnectedValue\"}}, \"filter_bits\": {\"__class__\": \"ConnectedValue\"}, \"hic_partition\": {\"hic_partition_selector\": \"set\", \"__current_case__\": 1, \"h1\": {\"__class__\": \"ConnectedValue\"}, \"h2\": {\"__class__\": \"ConnectedValue\"}, \"seed\": null, \"n_weight\": null, \"n_perturb\": null, \"f_perturb\": null, \"l_msjoin\": \"500000\"}, \"log_out\": true, \"mode\": {\"mode_selector\": \"standard\", \"__current_case__\": 0, \"reads\": {\"__class__\": \"ConnectedValue\"}}, \"purge_options\": {\"purge_selector\": \"blank\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.16.1+galaxy4", + "type": "tool", + "uuid": "0178b5a1-d244-43bc-85e4-e83d1360a94e", + "when": null, + "workflow_outputs": [] + }, + "19": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 19, + "input_connections": { + "input": { + "id": 17, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1364.3925291119203, + "top": 1599.019091057055 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c3\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "34ffee0e-99e4-4c04-ad64-1d3a50b39102", + "when": null, + "workflow_outputs": [] + }, + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 20, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap1_graph" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "mode_condition" + } + ], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 2078.7762035023084, + "top": 3.9236357717803685 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "usable hap1 gfa" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "hic_hap1_gfa" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"RuntimeValue\"}, \"output_condition\": {\"out_format\": \"gfa\", \"__current_case__\": 4, \"terminal_overlaps_condition\": {\"terminal_overlaps_select\": \"no\", \"__current_case__\": 0}}, \"discover_paths\": true, \"sort\": \"\", \"homopolymer_compress\": null}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "2bf6f1be-461a-45e1-aa5f-0af394563a23", + "when": null, + "workflow_outputs": [ + { + "label": "usable hap1 gfa", + "output_name": "output", + "uuid": "853d982b-69e8-436f-a791-4f7875034109" + } + ] + }, + "21": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 21, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap1_graph" + }, + "mode_condition|swiss_army_knife": { + "id": 7, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 2233.6199904933123, + "top": 369.32299064867425 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"ConnectedValue\"}, \"output_condition\": {\"out_format\": \"fasta\", \"__current_case__\": 0, \"line_length\": null}, \"discover_paths\": true, \"sort\": \"\", \"homopolymer_compress\": null}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "cd65bf95-931d-4514-8851-6652198c7ab7", + "when": null, + "workflow_outputs": [] + }, + "22": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 22, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap2_graph" + }, + "mode_condition|swiss_army_knife": { + "id": 7, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 2240.694704922763, + "top": 636.0591079249527 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"ConnectedValue\"}, \"output_condition\": {\"out_format\": \"fasta\", \"__current_case__\": 0, \"line_length\": null}, \"discover_paths\": true, \"sort\": \"\", \"homopolymer_compress\": null}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "596ea56e-3c73-402a-b1ae-e2be1bb91227", + "when": null, + "workflow_outputs": [] + }, + "23": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 23, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap2_graph" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "mode_condition" + } + ], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 2414.062661835642, + "top": 0 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "usable hap2 gfa" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "hic_hap2_gfa" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"RuntimeValue\"}, \"output_condition\": {\"out_format\": \"gfa\", \"__current_case__\": 4, \"terminal_overlaps_condition\": {\"terminal_overlaps_select\": \"no\", \"__current_case__\": 0}}, \"discover_paths\": true, \"sort\": \"\", \"homopolymer_compress\": null}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "4d4a30a0-d2e9-4814-afc2-74e4194ebdf5", + "when": null, + "workflow_outputs": [ + { + "label": "usable hap2 gfa", + "output_name": "output", + "uuid": "03228d5f-a300-4321-b715-ffc466c21246" + } + ] + }, + "24": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bandage/bandage_image/2022.09+galaxy4", + "errors": null, + "id": 24, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_raw_initig" + } + }, + "inputs": [], + "label": "Raw Unitig Image", + "name": "Bandage Image", + "outputs": [ + { + "name": "outfile", + "type": "jpg" + } + ], + "position": { + "left": 2310.4689858176494, + "top": 961.6668701171877 + }, + "post_job_actions": { + "TagDatasetActionoutfile": { + "action_arguments": { + "tags": "utg_png" + }, + "action_type": "TagDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bandage/bandage_image/2022.09+galaxy4", + "tool_shed_repository": { + "changeset_revision": "ddddce450736", + "name": "bandage", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"fontsize\": null, \"height\": \"2000\", \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"lengths\": false, \"names\": false, \"nodewidth\": \"25.0\", \"output_format\": \"png\", \"width\": null, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2022.09+galaxy4", + "type": "tool", + "uuid": "c023af81-3c79-43f9-96df-8d982b19e4ed", + "when": null, + "workflow_outputs": [] + }, + "25": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 25, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap1_graph" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2835.987005198547, + "top": 1467.2530248543883 + }, + "post_job_actions": { + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "Contig sizes for hap1" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_contigs_hap1, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"size\", \"__current_case__\": 0, \"out_size\": \"c\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": true}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "ed95e95b-68f3-47f4-ac03-eb4fb01d3020", + "when": null, + "workflow_outputs": [] + }, + "26": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 26, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap2_graph" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2836.927541097006, + "top": 1803.8369843454075 + }, + "post_job_actions": { + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "Contig sizes for hap2" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_contigs_hap2, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"size\", \"__current_case__\": 0, \"out_size\": \"c\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": true}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "723d5c3e-c0ec-4085-bccd-29d5d97ce3f8", + "when": null, + "workflow_outputs": [] + }, + "27": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 27, + "input_connections": { + "input1": { + "id": 19, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Estimated genome size", + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 1645.6251433401399, + "top": 1621.8578916607485 + }, + "post_job_actions": { + "RenameDatasetActioninteger_param": { + "action_arguments": { + "newname": "Estimated Genome size" + }, + "action_type": "RenameDatasetAction", + "output_name": "integer_param" + }, + "TagDatasetActioninteger_param": { + "action_arguments": { + "tags": "estimated_genome_size" + }, + "action_type": "TagDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "e0531bfd-5007-4e75-8f71-2f06c123831b", + "when": null, + "workflow_outputs": [ + { + "label": "Estimated Genome size", + "output_name": "integer_param", + "uuid": "a6854349-56a1-4ebd-845b-237f3600a0a6" + } + ] + }, + "28": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/1.1.1", + "errors": null, + "id": 28, + "input_connections": { + "infile": { + "id": 21, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Text transformation", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 2487.5695199677443, + "top": 342.17880711411 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Hifiasm HiC hap1" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "hifiasm_hic_hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/1.1.1", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv_opts\": {\"adv_opts_selector\": \"basic\", \"__current_case__\": 0}, \"code\": \"s/_path//g\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.1", + "type": "tool", + "uuid": "82af5c81-e733-4e57-b931-8234ab6c8056", + "when": null, + "workflow_outputs": [ + { + "label": "Hifiasm HiC hap1", + "output_name": "output", + "uuid": "08ba11ee-88b3-41f3-9d0a-93be5308820d" + } + ] + }, + "29": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/1.1.1", + "errors": null, + "id": 29, + "input_connections": { + "infile": { + "id": 22, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Text transformation", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 2490.9810152920813, + "top": 512.5868363813922 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Hifiasm HiC hap2" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "hifiasm_hic_hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/1.1.1", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv_opts\": {\"adv_opts_selector\": \"basic\", \"__current_case__\": 0}, \"code\": \"s/_path//g\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.1", + "type": "tool", + "uuid": "d8a10e0c-5a9c-4c4f-910a-8a94cdcba7f0", + "when": null, + "workflow_outputs": [ + { + "label": "Hifiasm HiC hap2", + "output_name": "output", + "uuid": "550d450c-009c-4e14-bbc5-a9ab7e3e55ab" + } + ] + }, + "30": { + "annotation": "", + "id": 30, + "input_connections": { + "gfa_stats": { + "id": 25, + "input_subworkflow_step_id": 0, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "gfastats_data_prep", + "outputs": [], + "position": { + "left": 3927.4223327636723, + "top": 833.7675152402937 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "format-version": "0.1", + "name": "gfastats_data_prep", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "gfa_stats" + } + ], + "label": "gfa_stats", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0.0, + "top": 189.90056800842285 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "7f250de3-98cc-448b-b573-6b8a85c71352", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "sort1", + "errors": null, + "id": 1, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Sort", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 302.6136245727539, + "top": 0.0 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "sort1", + "tool_state": "{\"column\": \"2\", \"column_set\": [], \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"order\": \"DESC\", \"style\": \"num\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.0", + "type": "tool", + "uuid": "55d86a03-5706-4070-b468-5e8407d3c871", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 2, + "input_connections": { + "infile": { + "id": 1, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 292.1306838989258, + "top": 235.1562442779541 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"{total += $2; $3 = total}1\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "69c7b2e7-5c82-49ec-8301-737e5ec1739b", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "errors": null, + "id": 3, + "input_connections": { + "in_file": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Datamash", + "outputs": [ + { + "name": "out_file", + "type": "input" + } + ], + "position": { + "left": 595.0994338989258, + "top": 116.0227222442627 + }, + "post_job_actions": { + "HideDatasetActionout_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "tool_shed_repository": { + "changeset_revision": "746e8e4bf929", + "name": "datamash_ops", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"grouping\": \"\", \"header_in\": false, \"header_out\": false, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": false, \"operations\": [{\"__index__\": 0, \"op_name\": \"absmax\", \"op_column\": \"3\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0+galaxy2", + "type": "tool", + "uuid": "1cdafa6b-ccdb-4b90-8dc6-ea1f92425715", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "addValue", + "errors": null, + "id": 4, + "input_connections": { + "input": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 479.0482864379883, + "top": 456.17896461486816 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "addValue", + "tool_state": "{\"exp\": \"1\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"yes\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "9a266291-d20c-42ff-b55f-bb334bd520d8", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 5, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 693.4658889770508, + "top": 299.4318027496338 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "81bf512c-89b3-4b18-b7e9-36ae448a828f", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "errors": null, + "id": 6, + "input_connections": { + "components_1|param_type|component_value": { + "id": 5, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Compose text parameter value", + "outputs": [ + { + "name": "out1", + "type": "expression.json" + } + ], + "position": { + "left": 885.0994338989258, + "top": 493.36646461486816 + }, + "post_job_actions": { + "HideDatasetActionout1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_shed_repository": { + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"c3/\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.1", + "type": "tool", + "uuid": "bda1a1ff-ab78-4338-a511-d24f851ec102", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "errors": null, + "id": 7, + "input_connections": { + "input": { + "id": 4, + "output_name": "out_file1" + }, + "ops|expressions_0|cond": { + "id": 6, + "output_name": "out1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Compute", + "name": "input" + } + ], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1115.0993728637695, + "top": 735.5255222320557 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "gfastats data for plotting" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "tool_shed_repository": { + "changeset_revision": "6595517c2dd8", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"RuntimeValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": {\"__class__\": \"ConnectedValue\"}, \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 1, \"cond\": \"c2/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 2, \"cond\": \"c3/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0", + "type": "tool", + "uuid": "c93568ca-103f-4d8e-af88-d6de721e30cd", + "when": null, + "workflow_outputs": [ + { + "label": "gfastats data for plotting", + "output_name": "out_file1", + "uuid": "68af2c3b-8f48-4bde-9dd1-a78151d6de1a" + } + ] + } + }, + "tags": "", + "uuid": "7bd25948-5c58-440c-af93-0d71235a782a" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "7df6c0b4-4fdc-43fc-bb3e-cc1d43c5ad0b", + "when": null, + "workflow_outputs": [] + }, + "31": { + "annotation": "", + "id": 31, + "input_connections": { + "gfa_stats": { + "id": 26, + "input_subworkflow_step_id": 0, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "gfastats_data_prep", + "outputs": [], + "position": { + "left": 3922.431136622574, + "top": 1057.8214703184187 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "format-version": "0.1", + "name": "gfastats_data_prep", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "gfa_stats" + } + ], + "label": "gfa_stats", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0.0, + "top": 189.90056800842285 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "7f250de3-98cc-448b-b573-6b8a85c71352", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "sort1", + "errors": null, + "id": 1, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Sort", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 302.6136245727539, + "top": 0.0 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "sort1", + "tool_state": "{\"column\": \"2\", \"column_set\": [], \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"order\": \"DESC\", \"style\": \"num\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.0", + "type": "tool", + "uuid": "55d86a03-5706-4070-b468-5e8407d3c871", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 2, + "input_connections": { + "infile": { + "id": 1, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 292.1306838989258, + "top": 235.1562442779541 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"{total += $2; $3 = total}1\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "69c7b2e7-5c82-49ec-8301-737e5ec1739b", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "errors": null, + "id": 3, + "input_connections": { + "in_file": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Datamash", + "outputs": [ + { + "name": "out_file", + "type": "input" + } + ], + "position": { + "left": 595.0994338989258, + "top": 116.0227222442627 + }, + "post_job_actions": { + "HideDatasetActionout_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "tool_shed_repository": { + "changeset_revision": "746e8e4bf929", + "name": "datamash_ops", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"grouping\": \"\", \"header_in\": false, \"header_out\": false, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": false, \"operations\": [{\"__index__\": 0, \"op_name\": \"absmax\", \"op_column\": \"3\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0+galaxy2", + "type": "tool", + "uuid": "1cdafa6b-ccdb-4b90-8dc6-ea1f92425715", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "addValue", + "errors": null, + "id": 4, + "input_connections": { + "input": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 479.0482864379883, + "top": 456.17896461486816 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "addValue", + "tool_state": "{\"exp\": \"1\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"yes\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "9a266291-d20c-42ff-b55f-bb334bd520d8", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 5, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 693.4658889770508, + "top": 299.4318027496338 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "81bf512c-89b3-4b18-b7e9-36ae448a828f", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "errors": null, + "id": 6, + "input_connections": { + "components_1|param_type|component_value": { + "id": 5, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Compose text parameter value", + "outputs": [ + { + "name": "out1", + "type": "expression.json" + } + ], + "position": { + "left": 885.0994338989258, + "top": 493.36646461486816 + }, + "post_job_actions": { + "HideDatasetActionout1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_shed_repository": { + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"c3/\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.1", + "type": "tool", + "uuid": "bda1a1ff-ab78-4338-a511-d24f851ec102", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "errors": null, + "id": 7, + "input_connections": { + "input": { + "id": 4, + "output_name": "out_file1" + }, + "ops|expressions_0|cond": { + "id": 6, + "output_name": "out1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Compute", + "name": "input" + } + ], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1115.0993728637695, + "top": 735.5255222320557 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "gfastats data for plotting" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "tool_shed_repository": { + "changeset_revision": "6595517c2dd8", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"RuntimeValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": {\"__class__\": \"ConnectedValue\"}, \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 1, \"cond\": \"c2/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 2, \"cond\": \"c3/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0", + "type": "tool", + "uuid": "c93568ca-103f-4d8e-af88-d6de721e30cd", + "when": null, + "workflow_outputs": [ + { + "label": "gfastats data for plotting", + "output_name": "out_file1", + "uuid": "68af2c3b-8f48-4bde-9dd1-a78151d6de1a" + } + ] + } + }, + "tags": "", + "uuid": "7bd25948-5c58-440c-af93-0d71235a782a" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "9d2e48a6-d050-49ee-af0a-31ca952c4535", + "when": null, + "workflow_outputs": [] + }, + "32": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 32, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap1_graph" + }, + "mode_condition|statistics_condition|expected_genomesize": { + "id": 27, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2827.101065895775, + "top": 1285.946470318419 + }, + "post_job_actions": { + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "Assembly stats for hap1" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_asm_hap1, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"assembly\", \"__current_case__\": 2, \"expected_genomesize\": {\"__class__\": \"ConnectedValue\"}}, \"locale\": true, \"tabular\": true, \"discover_paths\": true}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "fe43bf41-0e43-482e-99bb-7a855d4bcb2f", + "when": null, + "workflow_outputs": [] + }, + "33": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 33, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap2_graph" + }, + "mode_condition|statistics_condition|expected_genomesize": { + "id": 27, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2835.8424100008883, + "top": 1631.1285770300665 + }, + "post_job_actions": { + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "Assembly stats for hap2" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_asm_hap2, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"assembly\", \"__current_case__\": 2, \"expected_genomesize\": {\"__class__\": \"ConnectedValue\"}}, \"locale\": true, \"tabular\": true, \"discover_paths\": true}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "001f8c0e-234a-4406-9d8b-a26b8e878c56", + "when": null, + "workflow_outputs": [] + }, + "34": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "errors": null, + "id": 34, + "input_connections": { + "input": { + "id": 28, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Busco", + "outputs": [ + { + "name": "busco_sum", + "type": "txt" + }, + { + "name": "busco_table", + "type": "tabular" + }, + { + "name": "busco_missing", + "type": "tabular" + }, + { + "name": "summary_image", + "type": "png" + } + ], + "position": { + "left": 3074.6484375, + "top": 65.95703125 + }, + "post_job_actions": { + "TagDatasetActionbusco_missing": { + "action_arguments": { + "tags": "busco_hap1_missing, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_missing" + }, + "TagDatasetActionbusco_sum": { + "action_arguments": { + "tags": "busco_hap1_summ, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_sum" + }, + "TagDatasetActionbusco_table": { + "action_arguments": { + "tags": "busco_hap1_full, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_table" + }, + "TagDatasetActionsummary_image": { + "action_arguments": { + "tags": "busco_hap1_img, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "summary_image" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "tool_shed_repository": { + "changeset_revision": "41030a6c03b7", + "name": "busco", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": \"vertebrata_odb10\"}, \"outputs\": [\"short_summary\", \"missing\", \"image\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "5.3.2+galaxy0", + "type": "tool", + "uuid": "a4957dee-45cc-4f34-ae2e-e07f93b9fcc4", + "when": null, + "workflow_outputs": [ + { + "label": "Busco Summary Image Hap1", + "output_name": "summary_image", + "uuid": "cfac3083-4c1e-4bb4-91a5-eba5d19f2757" + }, + { + "label": "Busco Summary Hap1", + "output_name": "busco_sum", + "uuid": "bd6443ea-5266-4dfc-8f1e-aded27317da8" + } + ] + }, + "35": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy2", + "errors": null, + "id": 35, + "input_connections": { + "mode|assembly_options|assembly_01": { + "id": 28, + "output_name": "output" + }, + "mode|assembly_options|assembly_02": { + "id": 29, + "output_name": "output" + }, + "mode|meryldb_F1": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Merqury", + "outputs": [ + { + "name": "qv_files", + "type": "input" + }, + { + "name": "png_files", + "type": "input" + }, + { + "name": "stats_files", + "type": "input" + }, + { + "name": "log_file", + "type": "txt" + } + ], + "position": { + "left": 2855.921875, + "top": 789.0859375 + }, + "post_job_actions": { + "HideDatasetActionlog_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "log_file" + }, + "TagDatasetActionbed_files": { + "action_arguments": { + "tags": "merqury_hifi_hic_bed, #hic_phased" + }, + "action_type": "TagDatasetAction", + "output_name": "bed_files" + }, + "TagDatasetActionpng_files": { + "action_arguments": { + "tags": "merqury_hifi_hic_png, #hic_phased" + }, + "action_type": "TagDatasetAction", + "output_name": "png_files" + }, + "TagDatasetActionqv_files": { + "action_arguments": { + "tags": "merqury_hifi_hic_qv, #hic_phased" + }, + "action_type": "TagDatasetAction", + "output_name": "qv_files" + }, + "TagDatasetActionsizes_files": { + "action_arguments": { + "tags": "merqury_hifi_hic_sizes, #hic_phased" + }, + "action_type": "TagDatasetAction", + "output_name": "sizes_files" + }, + "TagDatasetActionstats_files": { + "action_arguments": { + "tags": "merqury_hifi_hic_stats, #hic_phased" + }, + "action_type": "TagDatasetAction", + "output_name": "stats_files" + }, + "TagDatasetActionwig_files": { + "action_arguments": { + "tags": "merqury_hifi_hic_wig, #hic_phased" + }, + "action_type": "TagDatasetAction", + "output_name": "wig_files" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy2", + "tool_shed_repository": { + "changeset_revision": "f8113c25bc6b", + "name": "merqury", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"label\": \"output_merqury\", \"mode\": {\"options\": \"default\", \"__current_case__\": 0, \"meryldb_F1\": {\"__class__\": \"ConnectedValue\"}, \"assembly_options\": {\"number_assemblies\": \"two\", \"__current_case__\": 1, \"assembly_01\": {\"__class__\": \"ConnectedValue\"}, \"assembly_02\": {\"__class__\": \"ConnectedValue\"}}}, \"output_add_headers\": true, \"output_selector\": [\"qv\", \"plots\", \"stats\", \"log\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3+galaxy2", + "type": "tool", + "uuid": "9985e575-3113-4c2c-bc2c-78faab3a1291", + "when": null, + "workflow_outputs": [ + { + "label": "Merqury images", + "output_name": "png_files", + "uuid": "4983a97f-9dd1-44d2-a4be-d13e9a651f41" + } + ] + }, + "36": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "errors": null, + "id": 36, + "input_connections": { + "input": { + "id": 29, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Busco", + "outputs": [ + { + "name": "busco_sum", + "type": "txt" + }, + { + "name": "busco_table", + "type": "tabular" + }, + { + "name": "busco_missing", + "type": "tabular" + }, + { + "name": "summary_image", + "type": "png" + } + ], + "position": { + "left": 3079.7265625, + "top": 499.28515625 + }, + "post_job_actions": { + "TagDatasetActionbusco_missing": { + "action_arguments": { + "tags": "busco_hap2_missing, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_missing" + }, + "TagDatasetActionbusco_sum": { + "action_arguments": { + "tags": "busco_hap2_summ, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_sum" + }, + "TagDatasetActionbusco_table": { + "action_arguments": { + "tags": "busco_hap2_full, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_table" + }, + "TagDatasetActionsummary_image": { + "action_arguments": { + "tags": "busco_hap2_img, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "summary_image" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "tool_shed_repository": { + "changeset_revision": "41030a6c03b7", + "name": "busco", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": \"vertebrata_odb10\"}, \"outputs\": [\"short_summary\", \"missing\", \"image\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "5.3.2+galaxy0", + "type": "tool", + "uuid": "08066bc3-0992-4606-844d-16be3c56691a", + "when": null, + "workflow_outputs": [ + { + "label": "Busco Summary Hap2", + "output_name": "busco_sum", + "uuid": "bf7e959c-5252-467e-bb58-2b8cabbd0f3b" + }, + { + "label": "Busco Summary Image Hap2", + "output_name": "summary_image", + "uuid": "84725fc4-3480-44a2-abc0-abc8f54addb1" + } + ] + }, + "37": { + "annotation": "", + "id": 37, + "input_connections": { + "Alternate data": { + "id": 31, + "input_subworkflow_step_id": 1, + "output_name": "gfastats data for plotting" + }, + "Name of alternate assembly": { + "id": 9, + "input_subworkflow_step_id": 3, + "output_name": "output" + }, + "Name of primary assembly": { + "id": 8, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "Primary data": { + "id": 30, + "input_subworkflow_step_id": 0, + "output_name": "gfastats data for plotting" + } + }, + "inputs": [], + "label": null, + "name": "gfastats_plot", + "outputs": [], + "position": { + "left": 4346.40625, + "top": 866.4609375 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "creator": [ + { + "class": "Organization", + "name": "Galaxy" + }, + { + "class": "Organization", + "name": "VGP", + "url": "https://vertebrategenomeproject.org" + } + ], + "format-version": "0.1", + "license": "CC-BY-4.0", + "name": "gfastats_plot", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Primary data" + } + ], + "label": "Primary data", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0.0, + "top": 0.0 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "a9a972e8-76f3-416f-9148-77203f6df3b8", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Alternate data" + } + ], + "label": "Alternate data", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 6.960205078125, + "top": 143.53692626953125 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "a5ce76b6-ae69-4c5d-b42f-dc211c9b64cc", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name of primary assembly" + } + ], + "label": "Name of primary assembly", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 4.55963134765625, + "top": 296.3210144042969 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Primary\", \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "6118c82a-61da-4856-9e25-1f0d93297527", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "894be62c-079d-4209-a098-1858de70948a" + } + ] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name of alternate assembly" + } + ], + "label": "Name of alternate assembly", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 7.428955078125, + "top": 440.4403076171875 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Alternate\", \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "3204b6e0-bd83-4a8d-8ddb-3b0dd89dbd04", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "3d7657f7-0651-43c1-80bb-57c4fa6d3502" + } + ] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "errors": null, + "id": 4, + "input_connections": { + "exp": { + "id": 2, + "output_name": "output" + }, + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1139.7584686279297, + "top": 107.42897033691406 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "tool_shed_repository": { + "changeset_revision": "745871c0b055", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"exp\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "8bc6adbb-1346-4521-bd69-ffa2738bad07", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "errors": null, + "id": 5, + "input_connections": { + "exp": { + "id": 3, + "output_name": "output" + }, + "input": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1151.7044982910156, + "top": 392.65625 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "tool_shed_repository": { + "changeset_revision": "745871c0b055", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"exp\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "63c7b63c-5179-4ab3-9682-7d150029446e", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/0.1.1", + "errors": null, + "id": 6, + "input_connections": { + "inputs": { + "id": 4, + "output_name": "out_file1" + }, + "queries_0|inputs2": { + "id": 5, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Concatenate datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1441.193115234375, + "top": 216.59091186523438 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/0.1.1", + "tool_shed_repository": { + "changeset_revision": "d698c222f354", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [{\"__index__\": 0, \"inputs2\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.1", + "type": "tool", + "uuid": "edbf8363-cf44-4536-b45c-60d54088e0fb", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 7, + "input_connections": { + "input": { + "id": 6, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1780.3265991210938, + "top": 182.99716186523438 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c8,c5,c6\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "ffa38570-79c9-41e6-9a55-3245d5427fa1", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 8, + "input_connections": { + "input": { + "id": 6, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1781.349365234375, + "top": 387.96875 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c8,c4,c7\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "6567b833-44b5-41e6-885b-d1d17b5d9376", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "errors": null, + "id": 9, + "input_connections": { + "input1": { + "id": 7, + "output_name": "out_file1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Scatterplot with ggplot2", + "name": "input1" + } + ], + "label": "Nx Plot", + "name": "Scatterplot with ggplot2", + "outputs": [ + { + "name": "output1", + "type": "png" + } + ], + "position": { + "left": 2068.1390991210938, + "top": 31.988632202148438 + }, + "post_job_actions": { + "RenameDatasetActionoutput1": { + "action_arguments": { + "newname": "Nx Plot" + }, + "action_type": "RenameDatasetAction", + "output_name": "output1" + }, + "TagDatasetActionoutput1": { + "action_arguments": { + "tags": "#nx_plot" + }, + "action_type": "TagDatasetAction", + "output_name": "output1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "5fe1dc76176e", + "name": "ggplot2_point", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"type_conditional\": {\"type_options\": \"lines\", \"__current_case__\": 2}, \"factor\": {\"factoring\": \"Single\", \"__current_case__\": 1, \"factorcol\": \"1\", \"colors\": \"Set1\", \"colororder\": \"1\"}, \"axis_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"axis_text_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"plot_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"gridlinecust\": \"default\", \"transform\": \"none\", \"scaling\": {\"plot_scaling\": \"Automatic\", \"__current_case__\": 0}, \"theme\": \"bw\", \"legend\": \"yes\"}, \"input1\": {\"__class__\": \"RuntimeValue\"}, \"out\": {\"unit_output_dim\": \"in\", \"width_output_dim\": \"6.0\", \"height_output_dim\": \"4.0\", \"dpi_output_dim\": \"300.0\", \"additional_output_format\": \"none\"}, \"title\": \"\", \"xlab\": \"x\", \"xplot\": \"2\", \"ylab\": \"Nx (Mb)\", \"yplot\": \"3\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.4.0+galaxy0", + "type": "tool", + "uuid": "18c6ac70-f4d3-4d68-93f8-c08afafbc6c5", + "when": null, + "workflow_outputs": [ + { + "label": "Nx Plot", + "output_name": "output1", + "uuid": "d1dd55bd-0441-4cfd-baf2-767ef768d01e" + } + ] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "errors": null, + "id": 10, + "input_connections": { + "input1": { + "id": 8, + "output_name": "out_file1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Scatterplot with ggplot2", + "name": "input1" + } + ], + "label": "Size Plot", + "name": "Scatterplot with ggplot2", + "outputs": [ + { + "name": "output1", + "type": "png" + } + ], + "position": { + "left": 2083.3805541992188, + "top": 319.8011169433594 + }, + "post_job_actions": { + "RenameDatasetActionoutput1": { + "action_arguments": { + "newname": "Size Plot" + }, + "action_type": "RenameDatasetAction", + "output_name": "output1" + }, + "TagDatasetActionoutput1": { + "action_arguments": { + "tags": "#size_plot" + }, + "action_type": "TagDatasetAction", + "output_name": "output1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "5fe1dc76176e", + "name": "ggplot2_point", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"type_conditional\": {\"type_options\": \"lines\", \"__current_case__\": 2}, \"factor\": {\"factoring\": \"Single\", \"__current_case__\": 1, \"factorcol\": \"1\", \"colors\": \"Set1\", \"colororder\": \"1\"}, \"axis_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"axis_text_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"plot_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"gridlinecust\": \"default\", \"transform\": \"none\", \"scaling\": {\"plot_scaling\": \"Automatic\", \"__current_case__\": 0}, \"theme\": \"bw\", \"legend\": \"yes\"}, \"input1\": {\"__class__\": \"RuntimeValue\"}, \"out\": {\"unit_output_dim\": \"in\", \"width_output_dim\": \"6.0\", \"height_output_dim\": \"4.0\", \"dpi_output_dim\": \"300.0\", \"additional_output_format\": \"none\"}, \"title\": \"\", \"xlab\": \"Scaffold number\", \"xplot\": \"2\", \"ylab\": \"Cumulative Size (Mb)\", \"yplot\": \"3\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.4.0+galaxy0", + "type": "tool", + "uuid": "cce1fe43-55c6-4c1a-a957-ac7af9271c46", + "when": null, + "workflow_outputs": [ + { + "label": "Size Plot", + "output_name": "output1", + "uuid": "c979a10d-de93-4c02-b286-0ec0fca016b9" + } + ] + } + }, + "tags": "", + "uuid": "34d71948-bc67-4261-ad4c-6de491826e89" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "1b8e2d4e-3380-4414-bdb0-b356383c0ee2", + "when": null, + "workflow_outputs": [ + { + "label": "Nx Plot", + "output_name": "Nx Plot", + "uuid": "781f8511-c3fe-4954-afa8-d21c94c996a4" + }, + { + "label": "Size Plot", + "output_name": "Size Plot", + "uuid": "03a0d2a8-c2d5-4ca7-80fe-7d04d1c4894a" + }, + { + "label": null, + "output_name": "2:output", + "uuid": "8614c252-637a-48dc-a751-9a3fea85b376" + }, + { + "label": null, + "output_name": "3:output", + "uuid": "b1b37b5e-092a-4bcb-87ab-f8b74abe1ebb" + } + ] + }, + "38": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 38, + "input_connections": { + "infile": { + "id": 32, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 3176.285044352214, + "top": 1140.6685569069605 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"BEGIN{print \\\"Metric\\\\thap1\\\"}; {print}; \", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "e0c8072a-6132-4669-be68-a44981f659da", + "when": null, + "workflow_outputs": [] + }, + "39": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 39, + "input_connections": { + "infile": { + "id": 33, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 3177.439533580434, + "top": 1537.5955292672825 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"BEGIN{print \\\"Metric\\\\thap2\\\"}; {print}; \", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "3ae908c6-47d7-40b0-b73e-95f1ed49dd24", + "when": null, + "workflow_outputs": [] + }, + "40": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 40, + "input_connections": { + "input": { + "id": 39, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 3407.691331343218, + "top": 1368.6198841441765 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c2\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "1164d973-2ba9-4242-bae1-2a7b6c4678b6", + "when": null, + "workflow_outputs": [] + }, + "41": { + "annotation": "", + "content_id": "Paste1", + "errors": null, + "id": 41, + "input_connections": { + "input1": { + "id": 38, + "output_name": "outfile" + }, + "input2": { + "id": 40, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Paste", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 3649.617149584222, + "top": 1140.9336085464017 + }, + "post_job_actions": { + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "gfastats_asm_hap1_hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Paste1", + "tool_state": "{\"delimiter\": \"T\", \"input1\": {\"__class__\": \"ConnectedValue\"}, \"input2\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "bd181af5-44c6-4041-a2f0-e5cb8991b9fb", + "when": null, + "workflow_outputs": [ + { + "label": "Assembly statistics fir Hap1 and Hap2", + "output_name": "out_file1", + "uuid": "e83786b6-dd5e-4c91-8c36-c2d5eecab79d" + } + ] + } + }, + "tags": [ + "VGP", + "Reviewed" + ], + "uuid": "e6c42d60-3c0c-4c40-890a-0f5db9962b30", + "version": 17 +} \ No newline at end of file diff --git a/workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4/test-data/Genomescope Model Parameters.tabular b/workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4/test-data/Genomescope Model Parameters.tabular new file mode 100644 index 000000000..45cb7f90f --- /dev/null +++ b/workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4/test-data/Genomescope Model Parameters.tabular @@ -0,0 +1 @@ +0.149032332079309 0.0167109222305794 10.8626968626729 1.14405084318039 2217407.15645611 0