diff --git a/.gitignore b/.gitignore
index 61654834..0dbbb88a 100644
--- a/.gitignore
+++ b/.gitignore
@@ -24,3 +24,7 @@ docs/site/
 Manifest.toml
 
 .DS_Store
+
+LocalPreferences.toml
+
+TODO.md
diff --git a/src/alphabet.jl b/src/alphabet.jl
index 154f40a9..bd6ac362 100644
--- a/src/alphabet.jl
+++ b/src/alphabet.jl
@@ -102,7 +102,7 @@ If `s` cannot be encoded to the given alphabet, throw an `EncodeError`
     return y === nothing ? throw(EncodeError(A, s)) : y
 end
 
-tryencode(A::Alphabet, s::BioSymbol) = throw(EncodeError(A, s))
+tryencode(A::Alphabet, s::Any) = nothing
 
 """
     tryencode(::Alphabet, x::S)
@@ -387,3 +387,5 @@ function guess_alphabet(v::AbstractVector{UInt8})
     end
 end
 guess_alphabet(s::AbstractString) = guess_alphabet(codeunits(s))
+
+const KNOWN_ALPHABETS = Union{DNAAlphabet, RNAAlphabet, AminoAcidAlphabet}
diff --git a/src/biosequence/find.jl b/src/biosequence/find.jl
index 728f2e57..dfed0cfc 100644
--- a/src/biosequence/find.jl
+++ b/src/biosequence/find.jl
@@ -37,18 +37,18 @@ Base.findlast(f::Function, seq::BioSequence) = findprev(f, seq, lastindex(seq))
 
 # Finding specific symbols
 
-Base.findnext(x::DNA, seq::BioSequence{<:DNAAlphabet}, start::Integer) = Base.findnext(isequal(x), seq, start)
-Base.findnext(x::RNA, seq::BioSequence{<:RNAAlphabet}, start::Integer) = Base.findnext(isequal(x), seq, start)
-Base.findnext(x::AminoAcid, seq::BioSequence{AminoAcidAlphabet}, start::Integer) = Base.findnext(isequal(x), seq, start)
+Base.findnext(x::DNA, seq::BioSequence{<:DNAAlphabet}, start::Integer) = findnext(isequal(x), seq, start)
+Base.findnext(x::RNA, seq::BioSequence{<:RNAAlphabet}, start::Integer) = findnext(isequal(x), seq, start)
+Base.findnext(x::AminoAcid, seq::BioSequence{AminoAcidAlphabet}, start::Integer) = findnext(isequal(x), seq, start)
 
-Base.findprev(x::DNA, seq::BioSequence{<:DNAAlphabet}, start::Integer) = Base.findprev(isequal(x), seq, start)
-Base.findprev(x::RNA, seq::BioSequence{<:RNAAlphabet}, start::Integer) = Base.findprev(isequal(x), seq, start)
-Base.findprev(x::AminoAcid, seq::BioSequence{AminoAcidAlphabet}, start::Integer) = Base.findprev(isequal(x), seq, start)
+Base.findprev(x::DNA, seq::BioSequence{<:DNAAlphabet}, start::Integer) = findprev(isequal(x), seq, start)
+Base.findprev(x::RNA, seq::BioSequence{<:RNAAlphabet}, start::Integer) = findprev(isequal(x), seq, start)
+Base.findprev(x::AminoAcid, seq::BioSequence{AminoAcidAlphabet}, start::Integer) = findprev(isequal(x), seq, start)
 
-Base.findfirst(x::DNA, seq::BioSequence{<:DNAAlphabet}) = Base.findfirst(isequal(x), seq)
-Base.findfirst(x::RNA, seq::BioSequence{<:RNAAlphabet}) = Base.findfirst(isequal(x), seq)
-Base.findfirst(x::AminoAcid, seq::BioSequence{AminoAcidAlphabet}) = Base.findfirst(isequal(x), seq)
+Base.findfirst(x::DNA, seq::BioSequence{<:DNAAlphabet}) = findfirst(isequal(x), seq)
+Base.findfirst(x::RNA, seq::BioSequence{<:RNAAlphabet}) = findfirst(isequal(x), seq)
+Base.findfirst(x::AminoAcid, seq::BioSequence{AminoAcidAlphabet}) = findfirst(isequal(x), seq)
 
-Base.findlast(x::DNA, seq::BioSequence{<:DNAAlphabet}) = Base.findlast(isequal(x), seq)
-Base.findlast(x::RNA, seq::BioSequence{<:RNAAlphabet}) = Base.findlast(isequal(x), seq)
-Base.findlast(x::AminoAcid, seq::BioSequence{AminoAcidAlphabet}) = Base.findlast(isequal(x), seq)
\ No newline at end of file
+Base.findlast(x::DNA, seq::BioSequence{<:DNAAlphabet}) = findlast(isequal(x), seq)
+Base.findlast(x::RNA, seq::BioSequence{<:RNAAlphabet}) = findlast(isequal(x), seq)
+Base.findlast(x::AminoAcid, seq::BioSequence{AminoAcidAlphabet}) = findlast(isequal(x), seq)
\ No newline at end of file
diff --git a/src/counting.jl b/src/counting.jl
index 1d53f170..bafbf00d 100644
--- a/src/counting.jl
+++ b/src/counting.jl
@@ -3,8 +3,6 @@
 # Instead, we could emit the head and tail chunk seperately, then an iterator of
 # all the full chunks loaded as single elements from the underlying vector.
 
-const KNOWN_ALPHABETS = Union{DNAAlphabet, RNAAlphabet, AminoAcidAlphabet}
-
 trunc_seq(x::LongSequence, len::Int) = typeof(x)(x.data, len % UInt)
 trunc_seq(x::LongSubSeq, len::Int) = typeof(x)(x.data, first(x.part):first(x.part)+len-1)
 
diff --git a/src/longsequences/chunk_iterator.jl b/src/longsequences/chunk_iterator.jl
index 88ae0313..773b5f63 100644
--- a/src/longsequences/chunk_iterator.jl
+++ b/src/longsequences/chunk_iterator.jl
@@ -130,3 +130,78 @@ Base.eltype(::Type{<:PairedChunkIterator}) = NTuple{2, UInt64}
     b = iter_inbounds(it.b, last(state))
     ((first(a), first(b)), (last(a), last(b)))
 end
+
+# This returns (head, body, tail), where:
+# - head and tail are Tuple{UInt64, UInt8}, with a coding element and the number
+#   of coding bits in that element. Head is the partial coding element before any
+#   full elements, and tail is the partial after any coding elements.
+#   If head or tail is empty, the UInt8 is set to zero. By definition, it can be
+#   at most set to 63.
+#   If the sequence is composed of only one partial element, tail is nonempty
+#   and head is empty.
+# - body is a Tuple{UInt, UInt} with the (start, stop) indices of coding elements.
+#   If stop < start, there are no such elements.
+# TODO: The body should probably be a MemoryView in 1.11
+function parts(seq::LongSequence)
+    # LongSequence never has coding bits before the first chunks
+    head = (zero(UInt64), zero(UInt8))
+    len = length(seq)
+    # Shortcut to prevent annoying edge cases in the rest of the code
+    if iszero(len)
+        return (head, (UInt(1), UInt(0)), (zero(UInt64), zero(UInt8)))
+    end
+    lastbitindex(seq)
+    bits_in_tail = (offset(bitindex(seq, len + 1)) % UInt8) & 0x3f
+    lbi = bitindex(seq, len)
+    lbii = index(lbi)
+    tail = if iszero(bits_in_tail)
+        head
+    else
+        (@inbounds(seq.data[lbii]), bits_in_tail)
+    end
+    # If we have bits in the tail, then clearly those bits means the last bitindex
+    # points to one past the last full chunk
+    body = (UInt(1), (lbii - !iszero(bits_in_tail)) % UInt)
+    (head, body, tail)
+end
+
+function parts(seq::LongSubSeq)
+    data = seq.data
+    zero_end = (zero(UInt64), zero(UInt8))
+    len = length(seq)
+    # Again: Avoid annoying edge cases later
+    if iszero(len)
+        return (zero_end, (UInt(1), UInt(0)), zero_end)
+    end
+    lastbitindex(seq)
+    lbi = bitindex(seq, len)
+    lbii = index(lbi)
+    fbi = firstbitindex(seq)
+    fbii = index(fbi)
+    bits_in_head_naive = (((64 - offset(fbi)) % UInt8) & 0x3f)
+    # If first and last chunk index is the same, there are actually zero
+    # bits in head, as they are all in the tail
+    bits_in_head = bits_in_head_naive * (lbii != fbii)
+    # For the head, there are some uncoding lower bits. We need to shift
+    # the head right with this number.
+    head_shift = ((0x40 - bits_in_head_naive) & 0x3f)
+    head = if iszero(bits_in_head)
+        zero_end
+    else
+        chunk = @inbounds(data[fbii]) >> head_shift
+        (chunk, bits_in_head)
+    end
+    # However, if last and first chunk index is the same, there is no head
+    # chunk, and thus no head chunk to shift, but the TAIL chunk may not have coding bits at the lowest
+    # position.
+    tail_shift = (head_shift * (lbii == fbii)) & 63
+    bits_in_tail = (offset(bitindex(seq, len + 1)) % UInt8) & 0x3f
+    bits_in_tail -= tail_shift % UInt8
+    tail = if iszero(bits_in_tail)
+        zero_end
+    else
+        (@inbounds(data[lbii]) >> tail_shift, bits_in_tail)
+    end
+    body = (fbii + !iszero(bits_in_head), lbii - !iszero(bits_in_tail))
+    (head, body, tail)
+end
\ No newline at end of file
diff --git a/src/longsequences/operators.jl b/src/longsequences/operators.jl
index e53da895..4d0e0afe 100644
--- a/src/longsequences/operators.jl
+++ b/src/longsequences/operators.jl
@@ -235,4 +235,141 @@ function Base.:(==)(seq1::LongSequence{A}, seq2::LongSequence{A}) where {A <: Al
     end
 
     return true
+end
+
+## Search
+
+# We only dispatch on known alphabets, because new alphabets may implement == in surprising ways
+function Base.findnext(
+    cmp::Base.Fix2{<:Union{typeof(==), typeof(isequal)}},
+    seq::SeqOrView{<:KNOWN_ALPHABETS},
+    i::Integer,
+)
+    i = max(Int(i)::Int, 1)
+    i > length(seq) && return nothing
+    symbol = cmp.x
+    enc = tryencode(Alphabet(seq), symbol)
+    enc === nothing && return nothing
+    vw = @inbounds view(seq, i:lastindex(seq))
+    res = _findfirst(vw, enc)
+    res === nothing ? nothing : res + i - 1
+end
+
+function _findfirst(seq::SeqOrView{<:KNOWN_ALPHABETS}, enc::UInt64)
+    data = seq.data
+    enc *= encoding_expansion(BitsPerSymbol(seq))
+    ((head, head_bits), (body_i, body_stop), (tail, tail_bits)) = parts(seq)
+    symbols_in_head = div(head_bits, bits_per_symbol(Alphabet(seq))) % Int
+    # The idea here is that we xor with the coding elements, then check for the first
+    # occurrence of a zerod symbol, if any.
+    if !iszero(head_bits)
+        tu = trailing_unsets(BitsPerSymbol(seq), head ⊻ enc)
+        tu < symbols_in_head && return tu + 1
+    end
+    i = symbols_in_head + 1
+    while body_i ≤ body_stop
+        chunk = @inbounds data[body_i] ⊻ enc
+        ze = set_zero_encoding(BitsPerSymbol(seq), chunk)
+        if !iszero(ze)
+            return i + div(trailing_zeros(ze) % UInt, bits_per_symbol(Alphabet(seq))) % Int
+        end 
+        body_i += 1
+        i += symbols_per_data_element(seq)
+    end
+    if !iszero(tail_bits)
+        tu = trailing_unsets(BitsPerSymbol(seq), tail ⊻ enc)
+        tu < div(tail_bits, bits_per_symbol(Alphabet(seq))) && return tu + i
+    end
+    nothing
+end
+
+function Base.findprev(
+    cmp::Base.Fix2{<:Union{typeof(==), typeof(isequal)}},
+    seq::SeqOrView{<:KNOWN_ALPHABETS},
+    i::Integer,
+)
+    i = Int(i)::Int
+    i < 1 && return nothing
+    symbol = cmp.x
+    enc = tryencode(Alphabet(seq), symbol)
+    enc === nothing && return nothing
+    vw = @inbounds view(seq, 1:i)
+    _findlast(vw, enc)
+end
+
+# See comments in findfirst
+function _findlast(seq::SeqOrView{<:KNOWN_ALPHABETS}, enc::UInt64)
+    data = seq.data
+    enc *= encoding_expansion(BitsPerSymbol(seq))
+    ((head, head_bits), (body_stop, body_i), (tail, tail_bits)) = parts(seq)
+    i = lastindex(seq)
+    # This part is slightly different, because the coding bits are shifted to the right,
+    # but we need to count the leading bits.
+    # So, we need to mask off the top bits by OR'ing them with a bunch of 1's,
+    # and then ignore the number of symbols we've masked off when counting the number
+    # of leading nonzero symbols un the encoding
+    if !iszero(tail_bits)
+        symbols_in_tail = div(tail_bits, bits_per_symbol(Alphabet(seq))) % Int
+        tail = (tail ⊻ enc) | ~(UInt64(1) << (tail_bits & 0x3f) - 1)
+        masked_unsets = div((0x40 - tail_bits), bits_per_symbol(Alphabet(seq)))
+        lu = leading_unsets(BitsPerSymbol(seq), tail) - masked_unsets
+        lu < symbols_in_tail && return (i - lu) % Int
+        i -= lu
+    end
+    while body_i ≥ body_stop
+        chunk = @inbounds data[body_i] ⊻ enc
+        ze = set_zero_encoding(BitsPerSymbol(seq), chunk)
+        if !iszero(ze)
+            return i - div(leading_zeros(ze) % UInt, bits_per_symbol(Alphabet(seq))) % Int
+        end 
+        body_i -= 1
+        i -= symbols_per_data_element(seq)
+    end
+    if !iszero(head_bits)
+        symbols_in_head = div(head_bits, bits_per_symbol(Alphabet(seq))) % Int
+        head = (head ⊻ enc) | ~(UInt64(1) << (head_bits & 0x3f) - 1)
+        masked_unsets = div((0x40 - head_bits), bits_per_symbol(Alphabet(seq)))
+        lu = leading_unsets(BitsPerSymbol(seq), head) - masked_unsets
+        lu < symbols_in_head && return (i - lu) % Int
+    end
+    nothing
+end
+
+encoding_expansion(::BitsPerSymbol{8}) = 0x0101010101010101
+encoding_expansion(::BitsPerSymbol{4}) = 0x1111111111111111
+encoding_expansion(::BitsPerSymbol{2}) = 0x5555555555555555
+
+# For every 8-bit chunk, if the chunk is all zeros, set the lowest bit in the chunk,
+# else, zero the chunk.
+# E.g. 0x_0a_b0_0c_00_fe_00_ff_4e -> 0x_00_00_00_01_00_01_00_00
+function set_zero_encoding(B::BitsPerSymbol{8}, enc::UInt64)
+    enc = ~enc
+    enc &= enc >> 4
+    enc &= enc >> 2
+    enc &= enc >> 1
+    enc & encoding_expansion(B)
+end
+
+function set_zero_encoding(B::BitsPerSymbol{4}, enc::UInt64)
+    enc = ~enc
+    enc &= enc >> 2
+    enc &= enc >> 1
+    enc & encoding_expansion(B)
+end
+
+function set_zero_encoding(B::BitsPerSymbol{2}, enc::UInt64)
+    enc = ~enc
+    enc &= enc >> 1
+    enc & encoding_expansion(B)
+end
+
+# Count how many trailing chunks of B bits in encoding that are not all zeros
+function trailing_unsets(::BitsPerSymbol{B}, enc::UInt64) where B
+    u = set_zero_encoding(BitsPerSymbol{B}(), enc)
+    div(trailing_zeros(u) % UInt, B) % Int
+end
+
+function leading_unsets(::BitsPerSymbol{B}, enc::UInt64) where B
+    u = set_zero_encoding(BitsPerSymbol{B}(), enc)
+    div(leading_zeros(u) % UInt, B) % Int
 end
\ No newline at end of file
diff --git a/src/longsequences/seqview.jl b/src/longsequences/seqview.jl
index 014bcda5..b91511e3 100644
--- a/src/longsequences/seqview.jl
+++ b/src/longsequences/seqview.jl
@@ -52,25 +52,25 @@ function LongSubSeq{A}(seq::LongSubSeq{A}) where A
     return LongSubSeq{A}(seq.data, seq.part)
 end
 
-function LongSubSeq{A}(seq::LongSequence{A}, part::AbstractUnitRange{<:Integer}) where A
+Base.@propagate_inbounds function LongSubSeq{A}(seq::LongSequence{A}, part::AbstractUnitRange{<:Integer}) where A
     @boundscheck checkbounds(seq, part)
     return LongSubSeq{A}(seq.data, UnitRange{Int}(part))
 end
 
-function LongSubSeq{A}(seq::LongSubSeq{A}, part::AbstractUnitRange{<:Integer}) where A
+Base.@propagate_inbounds function LongSubSeq{A}(seq::LongSubSeq{A}, part::AbstractUnitRange{<:Integer}) where A
     @boundscheck checkbounds(seq, part)
     newpart = first(part) + first(seq.part) - 1 : last(part) + first(seq.part) - 1
     return LongSubSeq{A}(seq.data, newpart)
 end
 
-function LongSubSeq(seq::SeqOrView{A}, i) where A
+Base.@propagate_inbounds function LongSubSeq(seq::SeqOrView{A}, i) where A
 	return LongSubSeq{A}(seq, i)
 end
 
-LongSubSeq(seq::SeqOrView, ::Colon) = LongSubSeq(seq, 1:lastindex(seq))
-LongSubSeq(seq::BioSequence{A}) where A = LongSubSeq{A}(seq)
+Base.@propagate_inbounds LongSubSeq(seq::SeqOrView, ::Colon) = LongSubSeq(seq, 1:lastindex(seq))
+Base.@propagate_inbounds LongSubSeq(seq::BioSequence{A}) where A = LongSubSeq{A}(seq)
 
-Base.view(seq::SeqOrView, part::AbstractUnitRange) = LongSubSeq(seq, part)
+Base.@propagate_inbounds Base.view(seq::SeqOrView, part::AbstractUnitRange) = LongSubSeq(seq, part)
 
 function (::Type{T})(seq::SeqOrView{<:NucleicAcidAlphabet{2}}) where
          {T<:LongSequence{<:NucleicAcidAlphabet{4}}}
@@ -145,7 +145,7 @@ function (::Type{T})(seq::LongSequence{<:NucleicAcidAlphabet{N}}) where
 	T(seq.data, 1:length(seq))
 end
 
-function (::Type{T})(seq::LongSequence{<:NucleicAcidAlphabet{N}}, part::AbstractUnitRange{<:Integer}) where
+Base.@propagate_inbounds function (::Type{T})(seq::LongSequence{<:NucleicAcidAlphabet{N}}, part::AbstractUnitRange{<:Integer}) where
 	{N, T<:LongSubSeq{<:NucleicAcidAlphabet{N}}}
 	@boundscheck checkbounds(seq, part)
 	T(seq.data, UnitRange{Int}(part))
diff --git a/test/alphabet.jl b/test/alphabet.jl
index 180b2688..264cd535 100644
--- a/test/alphabet.jl
+++ b/test/alphabet.jl
@@ -129,7 +129,7 @@ end
         @test tryencode(DNAAlphabet{2}(), DNA_M) === nothing
         @test tryencode(DNAAlphabet{2}(), DNA_N) === nothing
         @test tryencode(DNAAlphabet{2}(), DNA_Gap) === nothing
-        @test_throws EncodeError tryencode(DNAAlphabet{2}(), RNA_G)
+        @test tryencode(DNAAlphabet{2}(), RNA_G) === nothing
 
         # 4 bits
         for nt in BioSymbols.alphabet(DNA)
@@ -154,7 +154,7 @@ end
         @test tryencode(RNAAlphabet{2}(), RNA_M) === nothing
         @test tryencode(RNAAlphabet{2}(), RNA_N) === nothing
         @test tryencode(RNAAlphabet{2}(), RNA_Gap) === nothing
-        @test_throws EncodeError tryencode(RNAAlphabet{2}(), DNA_G)
+        @test tryencode(RNAAlphabet{2}(), DNA_G) === nothing
 
         # 4 bits
         for nt in BioSymbols.alphabet(RNA)
diff --git a/test/longsequences/find.jl b/test/longsequences/find.jl
index ab580292..e8a50fdc 100644
--- a/test/longsequences/find.jl
+++ b/test/longsequences/find.jl
@@ -1,35 +1,93 @@
 @testset "Find" begin
-    seq = dna"ACGNA"
-    @test findnext(isequal(DNA_A), seq, 1) == 1
-    @test findnext(isequal(DNA_C), seq, 1) == 2
-    @test findnext(isequal(DNA_G), seq, 1) == 3
-    @test findnext(isequal(DNA_N), seq, 1) == 4
-    @test findnext(isequal(DNA_T), seq, 1) === nothing
-    @test findnext(isequal(DNA_A), seq, 2) == 5
+    seq = dna"TACT-WKKATYACCG"
 
-    @test_throws BoundsError findnext(isequal(DNA_A), seq, 0)
-    @test findnext(isequal(DNA_A), seq, 6) === nothing
+    @test findfirst(==(DNA_T), seq) == 1
+    @test findfirst(==(DNA_A), seq) == 2
+    @test findfirst(isequal(DNA_C), seq) == 3
+    @test findfirst(==(DNA_Gap), seq) == 5
+    @test findfirst(isequal(DNA_W), seq) == 6
+    @test findfirst(==(DNA_Y), seq) == 11
+    @test findfirst(==(DNA_G), seq) == 15
+    @test findfirst(==(DNA_M), seq) === nothing
+    @test findfirst(==(RNA_A), seq) === nothing
+    @test findfirst(==(AA_W), seq) === nothing
+    @test findfirst(==('C'), seq) === nothing
 
-    @test findprev(isequal(DNA_A), seq, 4) == 1
-    @test findprev(isequal(DNA_C), seq, 4) == 2
-    @test findprev(isequal(DNA_G), seq, 4) == 3
-    @test findprev(isequal(DNA_N), seq, 4) == 4
-    @test findprev(isequal(DNA_T), seq, 4) === nothing
-    @test findprev(isequal(DNA_G), seq, 2) === nothing
+    @test findlast(isequal(DNA_C), seq) == 14
+    @test findlast(isequal(DNA_G), seq) == 15
+    @test findlast(isequal(DNA_Y), seq) == 11
+    @test findlast(isequal(DNA_W), seq) == 6
+    @test findlast(isequal(RNA_Y), seq) === nothing
+    @test findlast(isequal(RNA_Gap), seq) === nothing
 
-    @test findprev(isequal(DNA_A), seq, 0) === nothing
-    @test_throws BoundsError findprev(isequal(DNA_A), seq, 6)
+    #               1   5    10   15   20
+    seq = view(aa"WKRRLY-JNMOPQALKAVWYOPQRT", 3:22)
+    @test findnext(==(AA_R), seq, 1) == 1
+    @test findnext(==(AA_R), seq, 3) === nothing
+    @test findnext(==(AA_J), seq, 6) == 6
+    @test findnext(==(AA_J), seq, 7) === nothing
+    @test findnext(==(AA_Q), seq, 5) == 11
+    @test findnext(==(AA_V), seq, 1) == 16
+    @test findnext(==(AA_Y), seq, 4) == 4
+    @test findnext(==(AA_Y), seq, 5) == 18
+    @test findnext(==(DNA_M), seq, 1) === nothing
+    @test findnext(==(RNA_A), seq, 1) === nothing
+    @test findnext(==(AA_C), seq, 1) === nothing
+    @test findnext(==(19), seq, 1) === nothing
 
-    seq = dna"ACGNAN"
-    @test findfirst(isequal(DNA_A), seq) == 1
-    @test findfirst(isequal(DNA_N), seq) == 4
-    @test findfirst(isequal(DNA_T), seq) === nothing
+    @test findprev(==(AA_R), seq, 20) == 2
+    @test findprev(==(AA_K), seq, 15) == 14
+    @test findprev(==(AA_Y), seq, 20) == 18
+    @test findprev(==(AA_Y), seq, 17) == 4
+    @test findlast(==(AA_Q), seq) == 11
+    @test findprev(==(AA_J), seq, 16) == 6
+    @test findprev(==(AA_Gap), seq, 9) == 5
+    @test findprev(==(AA_O), seq, 3) === nothing
+    @test findprev(==(AA_L), seq, 2) === nothing
+    @test findprev(==(AA_H), seq, 17) === nothing
 
-    @test findlast(isequal(DNA_A), seq) == 5
-    @test findlast(isequal(DNA_N), seq) == 6
-    @test findlast(isequal(DNA_T), seq) === nothing
+    seq = LongRNA{2}(rna"UAGUCGUAGC")
+    @test findfirst(==(RNA_U), seq) == 1
+    @test findfirst(==(RNA_A), seq) == 2
+    @test findfirst(==(RNA_G), seq) == 3
+    @test findfirst(==(RNA_C), seq) == 5
+    @test findfirst(==(RNA_Gap), seq) === nothing
+    @test findlast(==(RNA_G), seq) == 9
 
+    # View with head and chunk only
+    #                        1   5    10   15   20 
+    seq = view(dna"TAGTCKYDDBN--ACGKMYAGCTATAYYKKM-", 11:32)
+    @test findnext(==(DNA_Gap), seq, 1) == 2
+    @test findnext(==(DNA_C), seq, 2) == 5
+    @test findnext(==(DNA_Y), seq, 2) == 9
+    @test findnext(==(DNA_Y), seq, 7) == 9
+    @test findnext(==(DNA_M), seq, 8) == 8
+    @test findnext(==(DNA_M), seq, 9) == 21
 
+    # View with only tail
+    #               1234
+    seq = view(aa"KWYPAV-L", 3:6)
+    @test findnext(==(AA_K), seq, 1) === nothing
+    @test findnext(==(AA_Y), seq, 1) == 1
+    @test findnext(==(AA_V), seq, 2) == 4
+    @test findnext(==(AA_A), seq, 3) == 3
+    @test findnext(==(AA_A), seq, 4) === nothing
+    @test findnext(==(RNA_Y), seq, 1) === nothing
+
+    @test findprev(==(AA_K), seq, 4) === nothing
+    @test findprev(==(AA_P), seq, 3) == 2
+    @test findprev(==(AA_A), seq, 2) === nothing
+    @test findprev(==(AA_Y), seq, 4) == 1
+
+    # Empty view
+    seq = view(dna"ATCGGACTGTAGTATGAACGGATATATGCTTATAATG", 19:18)
+    for i in [DNA_A, DNA_C, DNA_G, DNA_T, DNA_Gap]
+        @test findfirst(==(i), seq) === nothing
+        @test findlast(==(i), seq) === nothing
+    end
+end
+
+@testset "Search" begin
     #         0000000001111
     #         1234567890123
     seq = dna"NNNNNGATCGATC"